ПАТЕНТНЫЙ ПОИСК В РФ
НОВЫЕ ПАТЕНТЫ, ЗАЯВКИ НА ПАТЕНТ
БИБЛИОТЕКА ПАТЕНТОВ НА ИЗОБРЕТЕНИЯ

Способы измерения или испытания, использующие ферменты или микроорганизмы, составы для них, способы получения подобных составов: .использующие нуклеиновые кислоты – C12Q 1/68

Раздел C ХИМИЯ; МЕТАЛЛУРГИЯ
C12 Биохимия; пиво; алкогольные напитки; вино; уксус; микробиология; энзимология; получение мутаций; генная инженерия
C12Q Способы измерения или испытания, использующие ферменты или микроорганизмы; составы или индикаторная бумага для них; способы получения подобных составов; контроль за условиями в микробиологических или ферментативных процессах
C12Q 1/00 Способы измерения или испытания, использующие ферменты или микроорганизмы; составы для них; способы получения подобных составов
C12Q 1/68 .использующие нуклеиновые кислоты

Патенты в данной категории

СПОСОБ ИДЕНТИФИКАЦИИ ВЫЗЫВАЮЩИХ МУКОВИСЦИДОЗ МУТАЦИЙ В ГЕНЕ CFTR ЧЕЛОВЕКА, НАБОР ПРАЙМЕРОВ, БИОЧИП, НАБОР МИШЕНЕЙ И ТЕСТ-СИСТЕМА, ИСПОЛЬЗУЕМЫЕ В СПОСОБЕ

Изобретение относится к биотехнологии. Описан набор праймеров для амплификации фрагментов гена CFTR. Представлены биочип и набор мишеней для биочипа. Описан способ идентификации мутаций в гене CFTR человека, вызывающих муковисцидоз, включающий использование описанных праймеров. Представлена тест-система, которая содержит описанные праймеры и биочип. Изобретение расширяет арсенал технических средств, используемых для диагностики муковисцидоза, позволяя быстро и специфично диагностировать соответствующие мутации. 5 н. и 5 з.п. ф-лы, 2 ил, 4 табл., 6 пр.

2529717
патент выдан:
опубликован: 27.09.2014
АПТАМЕР, СПЕЦИФИЧНЫЙ К ОПУХОЛЕВЫМ ТКАНЯМ ЛЕГКОГО ЧЕЛОВЕКА

Изобретение относится к области биотехнологии, конкретно к выявлению рака легкого с помощью аптамеров, и может быть использовано в диагностике. Аптамеры получают в результате селекции, включающей чередование раундов позитивной селекции аптамеров к измельченным опухолевым тканям легкого человека, забиравшимся после операции у онкологических больных, и негативной селекции к здоровым тканям легкого и цельной крови здоровых людей, с выявлением пула аптамеров с наибольшей аффинностью, его клонирования, секвенирования, проверки на специфичность связывания с опухолевыми клетками легкого. Полученные аптамеры обладают высокой чувствительностью к продуктам распада опухоли и циркулирующим раковым клеткам в периферической крови больных раком легкого, что позволяет повысить эффективность диагностики рака легкого человека. 2 з.п. ф-лы, 2 ил., 1 пр.

2528870
патент выдан:
опубликован: 20.09.2014
СПОСОБ ВЫЯВЛЕНИЯ МИКОБАКТЕРИЙ ТУБЕРКУЛЕЗА ГЕНОТИПА ВЕIJING В РЕЖИМЕ РЕАЛЬНОГО ВРЕМЕНИ

Изобретение относится к медицине и микробиологии. Предложен способ определения микобактерий туберкулеза генотипа Beijing в режиме реального времени путем определения вставки элемента IS6110 в локусе генома dnaA-dnaN,отличающийся тем, что применяют ПЦР в режиме реального времени с использованием двух специфических праймеров 5`-AGATCAGAGAGTCTCCGGACTCA и 5`-CGCCGGGACTGTATGAGTCT и флуоресцентно-меченого зонда R6G-5`-TGTGCACAGCGACACTCACAGCCA-3`-BHQ2, оценку результата производят путем регистрации сигнала флуоресценции по каналу R6G с длиной волны 555нм, причем при наличии в образце ДНК штамма микобактерий туберкулеза генотипа Beijing экспоненциальный рост сигнала флуоресценции ПЦР при анализе чистой ДНК происходит между 10-15 циклами, а при анализе клеточных лизатов - между 15 и 20 циклами. Изобретение может быть использовано для лабораторного определения микобактерий туберкулеза генотипа Beijing. 3 ил., 2 пр.

2528866
патент выдан:
опубликован: 20.09.2014
СПОСОБ ПРОВЕДЕНИЯ ПЦР И ПЦР-ПДРФ ДЛЯ ИДЕНТИФИКАЦИИ АЛЛЕЛЬНЫХ ВАРИАНТОВ Waxy-ГЕНОВ ПШЕНИЦЫ

Изобретение относится к биотехнологии. Описан способ проведения ПЦР для эффективной идентификации аллельных вариантов Waxy-генов пшеницы. Способ отличается от известных из уровня техники использованием прямого праймера 4F-c: 5'-CCCCCAAGAGCAACTACCAGT-3'. Также описан способ ПЦР-ПДРФ для эффективной идентификации аллельных вариантов Waxy-генов пшеницы. Способ отличается от известных из уровня техники тем, что после этапа ПЦР проводят процедуру ПДРФ-анализа с эндонуклеазным расщеплением ампликонов рестриктазой AcsI. Цель изобретения - разработка способов проведения ПЦР и ПЦР-ПДРФ для эффективной идентификации аллельных вариантов Waxy-генов пшеницы. 2 н.п. ф-лы, 4 ил., 2 табл.

2528748
патент выдан:
опубликован: 20.09.2014
СИНТЕТИЧЕСКИЕ ОЛИГОНУКЛЕОТИДНЫЕ ПРАЙМЕРЫ ДЛЯ ИДЕНТИФИКАЦИИ ВИРУСА БЛЮТАНГА НУКЛЕОТИПА В (3, 13 И 16 СЕРОТИПЫ) МЕТОДОМ ОТ-ПЦР

Изобретение относится к биотехнологии, а именно к генетической инженерии. Техническим результатом изобретения является возможность определения генетической группы - нуклеотипа B вируса блютанга с помощью ОТ-ПЦР, что позволит существенно сократить материальные затраты и время проведения работ по определению серотипа вируса блютанга в образцах исследуемого биологического материала. Предложенные праймеры используются для идентификации вируса блютанга нуклеотипа B (3, 13 и 16 серотипы) методом ОТ-ПЦР. 2 табл.

2528745
патент выдан:
опубликован: 20.09.2014
СПОСОБ ПРОВЕДЕНИЯ ПЦР-ПДРФ ДЛЯ ГЕНОТИПИРОВАНИЯ КРУПНОГО РОГАТОГО СКОТА ПО АЛЛЕЛЯМ А И К ГЕНА DGAT1

Цель изобретения - разработка эффективного способа генотипирования крупного рогатого скота по DGAT1-гену на основе ПЦР-ПДРФ-анализа. Разработанный способ проведения ПЦР-ПДРФ для генотипирования крупного рогатого скота по аллелям А и К гена DGAT1, отличающийся от ближайшего прототипа [1] тем, что на этапе ПЦР используются другие последовательности олигонуклеотидных праймеров:

DGAT1-1: 5'-CCGCTTGCTCGTAGCTTTCGAAGGTAACGC-3' (SEQ ID NO:1)

DGAT1-2: 5'-CCGCTTGCTCGTAGCTTTGGCAGGTAACAA-3' (SEQ ID NO:2)

DGAT1-3: 5'-AGGATCCTCACCGCGGTAGGTCAGG-3' (SEQ ID NO:3),

а на этапе ПДРФ применяется другая эндонуклеаза рестрикции - TaqI, с генерацией генотип-специфичных фрагментов: генотип АА=82/18 bp, генотип КК=100 bp и генотип АК=100/82/18 bp (фиг.1 и 2). 2 ил., 2 табл.

2528743
патент выдан:
опубликован: 20.09.2014
СИНТЕТИЧЕСКИЕ ОЛИГОНУКЛЕОТИДНЫЕ ПРАЙМЕРЫ И СПОСОБ ВЫЯВЛЕНИЯ ГЕНОТИПОВ ДЛЯ ИДЕНТИФИКАЦИИ ЛИЧНОСТИ С ПОМОЩЬЮ СИСТЕМЫ МИКРОСАТЕЛЛИТНЫХ ДНК-МАРКЕРОВ Y-ХРОМОСОМЫ

Изобретение относится к области биотехнологии, конкретно к набору синтетических олигонуклеотидных пар праймеров, и может быть использовано в судебно-медицинской идентификационной экспертизе. Заявленный набор состоит из пар праймеров, комплементарных соответствующим участкам пятнадцати микросателлитных локусов Y-хромосомы, которые представляют собой пары праймеров, из которых один имеет флуоресцентную метку, а второй является немеченым, при этом прямые праймеры для каждого из локусов несут на 5'-конце флуоресцентную метку: ТЕТ (4,7,2',7'-тетрахлоро-6-карбоксифлуоресцеин) для DYS385a/b, DYS390, DYS391, DYS426 и DYS439; FAM (6-карбоксифлуоресцеин) для DYS392, DYS393, DYS437 и DYS438; и HEX (4,7,2',4',5',7'-гексахлоро-6-карбоксифлуоресцеин) для DYS394, DYS388, DYS389I/II и DYS434. Изобретение относится также к способу выявления генотипов для идентификации личности в российской популяции с использованием вышеуказанных праймеров. Изобретение позволяет проводить идентификацию личности в российской популяции с высокой чувствительностью, специфичностью и точностью по сравнению с существующими аналогами. 2 н.п. ф-лы, 2 ил.

2528742
патент выдан:
опубликован: 20.09.2014
СПОСОБ ОЦЕНКИ ЧУВСТВИТЕЛЬНОСТИ КЛЕТОК РАКА ЛЕГКОГО К ДОКСОРУБИЦИНУ НА ОСНОВАНИИ УРОВНЕЙ ЭКСПРЕССИИ МАРКЕРНЫХ ГЕНОВ И НАБОР ДЛЯ ЕГО ОСУЩЕСТВЛЕНИЯ

Изобретение относится к биотехнологии и представляет собой способ оценки чувствительности клеток рака легкого к доксорубицину (IC50), а также набор для осуществления данного способа. Способ основан на сравнении уровней экспрессии маркерных генов АВСС1, ERCC1, FTL, GSTP1, МТ2А, RRM1, TUBB3 в исследуемых клетках с уровнями экспрессии указанных генов в контрольных клетках NCI-H322. Способ включает гибридизацию флуоресцентно меченых препаратов нуклеиновых кислот, приготовленных из клеток или тканей человека, с массивом данных олигонуклеотидных зондов, иммобилизованных на твердой подложке. Отмывают подложку от неспецифически связавшихся препаратов. Сканируют подложку лазерным сканером и анализируют полученное изображение. При повышенной экспрессии генов ERCC1, МТ2А, RRM1 и TUBB3 и пониженной экспрессии генов АВСС1, GSTP1, FTL в исследуемых клетках по отношению к клеткам NCI-H322, IC50 доксорубицина для исследуемых клеток оценивают на уровне IC50 0,54 мкМ, и клетки относят к устойчивым. При пониженной экспрессии генов ERCC1, МТ2А, RRM1 и TUBB3 и повышенной экспрессии генов АВСС1, GSTP1, FTL в исследуемых клетках по отношению к клеткам NCI-H322, IC50 доксорубицина для исследуемых клеток оценивают на уровне IC50 0,073 мкМ, и клетки относят к чувствительным. Предложенное изобретение позволяет определять чувствительность клеток рака легкого к доксорубицину с высокой точностью. 2 н.п. ф-лы, 1 ил., 1 табл., 2 пр.

2528247
патент выдан:
опубликован: 10.09.2014
БИОЛОГИЧЕСКИЙ МИКРОЧИП ДЛЯ ВЫЯВЛЕНИЯ И МНОГОПАРАМЕТРИЧЕСКОГО АНАЛИЗА ПРОТИВОХОЛЕРНЫХ АНТИТЕЛ

Изобретение относится к области медицины, в частности к клинической лабораторной диагностике. Предложен биологический микрочип для выявления и многопараметрического анализа противохолерных антител в сыворотке крови человека, содержащий массив дискретно нанесенных и иммобилизованных на поверхности подложки O-антигенов V. cholerae и холерного токсина, сгруппированных в отдельные зоны. Изобретение обеспечивает проведение параллельного иммунологического анализа нескольких образцов сыворотки крови человека на наличие противохолерных антител к широкому спектру антигенов возбудителя холеры с определением иммуноглобулинов класса G и M за короткое время. 2 з.п. ф-лы, 3 ил., 2 пр.

2528099
патент выдан:
опубликован: 10.09.2014
НАБОР СИНТЕТИЧЕСКИХ ОЛИГОНУКЛЕОТИДОВ ДЛЯ АМПЛИФИКАЦИИ И СЕКВЕНИРОВАНИЯ ITS1-5.8S-ITS2 СОСУДИСТЫХ РАСТЕНИЙ

Изобретение относится к области биохимии, в частности к набору синтетических олигонуклеотидов для амплификации и последующего секвенирования ITS1-5.8S-ITS2 сосудистых растений, включающего проведение полимеразой цепной реакции с помощью универсальных праймеров со следующим нуклеотидным составом: primer ITS-for CGTAACAAGGTTTCCGTAG, primer ITS-rew GGAATCCTTGTAAGTTTCTTT. Изобретение позволяет эффективно анализировать структуру внутреннего транскрибируемого спейсера рибосомной ДНК сосудистых растений. 1ил.

2528063
патент выдан:
опубликован: 10.09.2014
СПОСОБ И НАБОР ДЛЯ ДЕТЕКЦИИ МИКРООРГАНИЗМОВ

Группа изобретений относится к области микробиологии и биотехнологии. Способ детекции живых клеток микроорганизма в тестируемом образце путем отличия живых клеток от мертвых клеток или поврежденных клеток предусматривает добавление в тестируемый образец средства, способного к ковалентному связыванию с ДНК или РНК при облучении светом с длиной волны от 350 нм до 700 нм; облучение тестируемого образца; амплификацию мишеневой области ДНК или РНК микроорганизма, содержащегося в тестируемом образце, способом амплификации нуклеиновых кислот в присутствии средства подавления действия вещества, ингибирующего амплификацию нуклеиновых кислот, соли магния, соли органической кислоты или соли фосфорной кислоты, без выделения нуклеиновых кислот из клеток и анализа продукта амплификации. Способ может быть осуществлен посредством применения набора, состоящего из средства, способного к ковалентному связыванию с ДНК или РНК при облучении светом с длиной волны от 350 нм до 700 нм, средства подавления действия вещества, ингибирующего амплификацию нуклеиновых кислот и праймеров для амплификации мишеневой области. При помощи данных изобретений можно с высокой чувствительностью и точностью детектировать живые клетки микроорганизмов в различных биологических образцах. 2 н. и 25 з.п. ф-лы, 17 ил., 12 табл., 9 пр.

2527897
патент выдан:
опубликован: 10.09.2014
СИНТЕТИЧЕСКИЕ ОЛИГОНУКЛЕОТИДНЫЕ ПРАЙМЕРЫ ДЛЯ ИДЕНТИФИКАЦИИ ШТАММОВ И ИЗОЛЯТОВ БАКТЕРИИ Pasteurella multocida СЕРОГРУППЫ А У КРУПНОГО РОГАТОГО СКОТА И СПОСОБ ИХ ПРИМЕНЕНИЯ

Изобретение относится к ветеринарной микробиологии и биотехнологии, а именно к генетической инженерии. Предложены синтетические олигонуклеотидные праймеры для идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы A у крупного рогатого скота и способ их применения. Предложенный способ включает проведение ПЦР с синтетическими олигонуклеотидными праймерами на район гена hyaD Pasteurella multocida, перенос продукта амплификации на гель и оценку проведения реакции. Для постановки ПЦР используют ДНК, выделенную из патологического материала или бактериальных культур. ПЦР проводят в 1 раунд. В случае положительной реакции синтезируется фрагмент, соответствующий размеру 218 п.н. Способ может быть использован в ветеринарной микробиологии для диагностики пастереллеза сельскохозяйственных животных. 2 н.п. ф-лы, 5 табл.

2527153
патент выдан:
опубликован: 27.08.2014
СПОСОБ ВИДОВОЙ И ШТАММОВОЙ ИДЕНТИФИКАЦИИ БИФИДОБАКТЕРИЙ ФИЛОТИПА Bifidobacterium longum

Изобретение относится к области биотехнологии и касается видовой и штаммовой идентификации бифидобактерий филотипа Bifidobacterium longum. Представленный способ основан на комбинации и полиморфизме генов токсин-антитоксин суперсемейства RelBE и характеризуется тем, что для идентификации проводят амплификацию с геномной ДНК с использованием набора видо- и штаммоспецифичных олигонуклеотидов, ПЦР продукты анализируют в агарозном геле, а размер полученного фрагмента определяют с помощью ДНК-маркера. Исследуемые штаммы относят к определенному виду и/или штамму в случае наработки фрагментов при использовании определенных олигонуклеотидов. Представленное изобретение может быть использовано для идентификации штаммов бифидобактерий, определения исследуемых штаммов в клинических пробах или их молекулярного отслеживания в коммерческих препаратах. 3 табл.

2527069
патент выдан:
опубликован: 27.08.2014
ФАРМАКОДИНАМИЧЕСКИЕ МАРКЕРЫ, ИНДУЦИРОВАННЫЕ ИНТЕРФЕРОНОМ АЛЬФА

Изобретение относится к иммунологии. Предложены варианты применения вариантов набора генов (фармакодинамических (ФД) маркеров) с повышенной регуляцией экспрессии или действия, индуцируемых интерфероном альфа (ИФН ). Описаны варианты способа идентификации пациентов для получения MEDI-545 по обнаружению таких профилей экспрессии ИФН -индуцируемых ФД маркеров. Использование изобретения обеспечивает распознавание тех пациентов, для которых лечение нейтрализующим антителом MEDI-545 может быть действительно эффективным, что может найти применение в медицине. 7 н. и 3 з.п. ф.-лы, 90 ил., 33 табл., 22 пр.

2527068
патент выдан:
опубликован: 27.08.2014
СПОСОБ ИДЕНТИФИКАЦИИ ЛАКТОБАЦИЛЛ

Изобретение относится к области биотехнологии и касается способа идентификации лактобацилл. Представленный способ основан на комбинации и полиморфизме генов токсин-антитоксин суперсемейств RelBE и MazEF и характеризуется тем, что для идентификации проводят амплификацию геномных ДНК с использованием набора олегонуклеотидов определенной структуры, ПЦР-продукты анализируют в агарозном геле, а размер полученного фрагмента определяют с помощью ДНК-маркера. Исследуемый штамм относят к определенной группе, виду или штамму в случае наработки фрагментов при использовании определенных олигонуклеотидов. Представленное изобретение может быть использовано для идентификации штаммов лактобацилл в микробиоте человека, продуктах питания, а также для определения исследуемого штамма в клинических пробах или молекулярного отслеживания в коммерческих препаратах. 3 табл., 3 пр.

2526576
патент выдан:
опубликован: 27.08.2014
НАБОР СИНТЕТИЧЕСКИХ ОЛИГОНУКЛЕИТИДОВ ДЛЯ ВЫЯВЛЕНИЯ ВИДОВОЙ ПРИНАДЛЕЖНОСТИ РОДИОЛЫ ЧЕТЫРЕХНАДРЕЗНОЙ (Rhodiola quadrifida (Pall.) Fisch. et Mey.)

Изобретение относится к биотехнологии и представляет собой набор синтетических олигонуклеотидов для выявления видовой принадлежности родиолы четырехнадрезной {Rhodiola quadrifida (Pall.) Fisch. et Mey). Набор включает видоспецифичные участки для создания прямого, обратного праймеров и разрушаемого зонда, а именно прямой праймер - CGGCAACGGATATCTCGGCT-3', обратный праймер - 5'-GGCCTCGCААССАССACTTGTC-3', разрушаемый зонд - (флуоресцентная метка)-5'-CCGTGAACCATCGAGTTTTT-3'-(гаситель). Предложенное изобретение позволяет достоверно, быстро и с высокой чувствительностью идентифицировать видовую принадлежность лекарственного растения - родиолы четырехнадрезной (Rhodiola quadrifida (Pall.) Fisch. et Mey.) в ходе проведения скрининга растительного сырья. 1 ил., 1 пр.

2526499
патент выдан:
опубликован: 20.08.2014
СПОСОБ ОПРЕДЕЛЕНИЯ ГЕНОТИПОВ ЗОЛОТИСТОГО СТАФИЛОКОККА

Изобретение касается способа определения генотипов золотистого стафилококка. Представленный способ включает получение чистой культуры микроорганизмов на плотной питательной среде с последующим выделением и амплификацией ДНК возбудителя с помощью мультиплексной полимеразной цепной реакции (ПЦР) и с детекцией результатов методом электрофореза в агарозном геле. При осуществлении мультиплексной ПЦР используют четыре пары праймеров, комплементарных к участкам гена внеклеточной термонуклеазы ( nuc), гена лейкоцидина Пантона-Валлентайна (pvl), гена белка токсического шока (tst) и гена устойчивости к метициллину (mecA). Генотипы золотистого стафилококка определяют по наличию или отсутствию генов вирулентности pvl и tst и гена устойчивости к метициллину mecA или их сочетаний. Изобретение позволяет определять отдельные генотипы золотистого стафилококка одновременно в одной мультиплексной реакции, а также исключить предварительный этап идентификации микроорганизма. 1 ил., 2 табл., 2 пр.

2526497
патент выдан:
опубликован: 20.08.2014
НАБОР ОЛИГОНУКЛЕОТИДНЫХ ПРАЙМЕРОВ И ФЛУОРЕСЦЕНТНОМЕЧЕНОГО ЗОНДА ДЛЯ ВИДОСПЕЦИФИЧНОЙ ЭКСПРЕСС-ИДЕНТИФИКАЦИИ РНК ВИРУСА ХУНИН МЕТОДОМ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ В РЕАЛЬНОМ ВРЕМЕНИ

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Хунин методом полимеразной цепной реакции в реальном времени. Представленный набор включает последовательности олигонуклеотидов, видоспецифичные для вируса Хунин и имеющие следующую структуру:

внешний: 5 3 5 TCTTCTTCCCCCYTTTTAGTCTTTCT 3

внутренний: 5 3 5 CGCACAGTGGATCCTAGGCA 3

зонд: FAM - TGAGTCCATCTAAAGCTTGGNACCTCCTT - BHQ1.

Охарактеризованное решение может быть использовано в медицине и эпидемиологии для выявления генетического материала вируса Хунин в клинических или секционных образцах. 2 ил., 1 табл., 2 пр.

2525938
патент выдан:
опубликован: 20.08.2014
НАБОР ОЛИГОНУКЛЕОТИДНЫХ ПРАЙМЕРОВ И ФЛУОРЕСЦЕНТНОМЕЧЕНОГО ЗОНДА ДЛЯ ВИДОСПЕЦИФИЧНОЙ ЭКСПРЕСС-ИДЕНТИФИКАЦИИ РНК ВИРУСА МАЧУПО МЕТОДОМ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ В РЕАЛЬНОМ ВРЕМЕНИ

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченного зонда для видоспецифичной экспресс-идентификации РНК вируса Мачупо методом полимеразной цепной реакции в реальном времени. Представленный набор включает последовательности олигонуклеотидов, видоспецифичные для вируса Мачупо и имеющие следующую структуру:

внешний: 5 3 5 TCCTCYTCACCCCTTTTGTTCTTTCT 3

внутренний: 5 3 5 CGCACAGTGGATCCTAGGCA 3

зонд: R6G - TGAGTCCACCGRAAGCTGGGRATYTCYTT - BHQ1. Охарактеризованное решение может быть использовано в медицинской практике для выявления генетического материала вируса Мачупо в клинических или секционных образцах. 2 ил., 1 табл., 2 пр.

2525937
патент выдан:
опубликован: 20.08.2014
СПОСОБ ВИДОВОЙ ДИФФЕРЕНЦИАЦИИ ЖИЗНЕСПОСОБНЫХ РОДОКОККОВ, ИММОБИЛИЗОВАННЫХ В ГЕЛЕВОМ НОСИТЕЛЕ

Изобретение относится к биотехнологии и может быть использовано для дифференцированного определения числа жизнеспособных актинобактерий рода Rhodococcus, иммобилизованных в нерастворимом гелевом носителе. Способ предусматривает следующее. Гранулу биокатализатора с заключенными в ней клетками одного или нескольких видов родококков помещают в лунку 96-луночного планшета, добавляют краситель иодонитротетразолий (INT). После появления специфического фиолетового окрашивания формазана измеряют оптическую плотность гранулы с помощью планшетного фотометра. В случае окрашенного субстрата или предварительного нахождения иммобилизованного биокатализатора в почве проводят экстракцию формазана 96% этанолом и измеряют оптическую плотность экстракта. Число жизнеспособных родококков в грануле геля определяют с помощью калибровочного графика зависимости оптической плотности от числа живых клеток в суспензии, определенного традиционным методом высева на плотную питательную среду. Затем из окрашенной красителем гранулы биокатализатора или из гранулы после экстракции красителя выделяют ДНК и проводят ПЦР с использованием наборов видоспецифических праймеров. Определяют видовое положение иммобилизованных родококков. Изобретение позволяет сократить время дифференциации родококков и повысить точность способа. 1 з.п. ф-лы, 3 табл., 4 ил., 4 пр.

2525934
патент выдан:
опубликован: 20.08.2014
СПОСОБ ОПРЕДЕЛЕНИЯ НУКЛЕОТИДНОЙ ПОСЛЕДОВАТЕЛЬНОСТИ Pu(5mC)GPy В ЗАДАННОМ ПОЛОЖЕНИИ ПРОТЯЖЕННОЙ ДНК

Изобретение относится к биотехнологии. Предложенный способ предусматривает получение образцов высокоочищенной ДНК, фрагментацию выделенной ДНК эндонуклеазой рестрикции, не имеющей сайта узнавания в амплифицируемом районе, гидролиз фрагментированной ДНК метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI или ее изошизомером, лигирование универсального олигонуклеотидного адаптера к гидролизованной ДНК с последующей амплификацией в реальном времени с использованием праймера и зонда, комплементарных исследуемой ДНК и гибридного праймера, 3' конец которого комплементарен не менее 3 нуклеотидам 3' конца ДНК у исследуемого места гидролиза GlaI, а оставшаяся часть комплементарна адаптерной последовательности, и составление заключения на основании флуоресцентного сигнала о наличии последовательности Pu(5mC)GPy. 3 з.п. ф-лы, 4 ил., 5 табл., 5 пр.

2525710
патент выдан:
опубликован: 20.08.2014
СПОСОБЫ ОПРЕДЕЛЕНИЯ ВОСПРИИМЧИВОСТИ ПАЦИЕНТА К ВНУТРИБОЛЬНИЧНОЙ ИНФЕКЦИИ И СОСТАВЛЕНИЯ ПРОГНОЗА РАЗВИТИЯ СЕПТИЧЕСКОГО СИНДРОМА

Изобретение относится к биотехнологии, конкретно к определению восприимчивости к внутрибольничной инфекции пациента с септическим шоком, и может быть использовано в медицине. Получают биологический образец, выбранный из образца крови, сыворотки, слюны, ткани или циркулирующих клеток пациента и экстрагируют биологический материал: нуклеиновую кислоту или белок из биологического образца. С использованием специфического реагента в отношении продукта экспрессии гена-мишени S100A9, выбранного из праймера амплификации, зонда гибридизации и/или антитела, определяют экспрессию гена-мишени S100A9. Изобретение позволяет по сверхэкспрессии гена-мишени S100A9 по отношению к определенной пороговой величине определить, что пациент с септическим шоком восприимчив к внутрибольничной инфекции. 2 н. и 9 з.п.ф-лы, 2 ил., 3 табл., 5 пр.

2525707
патент выдан:
опубликован: 20.08.2014
НАБОР ДЛЯ ВЫЯВЛЕНИЯ ВОЗБУДИТЕЛЯ КУ-ЛИХОРАДКИ В БИОЛОГИЧЕСКОМ МАТЕРИАЛЕ МЕТОДОМ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ В РЕЖИМЕ РЕАЛЬНОГО ВРЕМЕНИ (ПЦР-РВ)

Изобретение относится к области биотехнологии и касается набора для выявления Ку-лихорадки методом ПЦР-РВ. Охарактеризованный набор содержит синтетические олигонуклеотиды, ограничивающие фрагмент гена groEL:

GroEL F 5 CTTCTACTGTTATGACGCCTTCTTTGC 3

GroEL R 5 CGCAAGTAGGCACCATTTCTGC 3 ,

и флуоресцентный зонд:

GroEL Probe 5 FAM-CACTTTCTCCATCGCTTCCGCAATAATA-TAMRA 3 .

Изобретение может быть использовано в медицине, ветеринарии, клинической лабораторной диагностике для выявления ДНК бактерии Coxiella burnetii в пробах, а также для решения научно-исследовательских задач по изучению данного микроорганизма. 2 табл., 2 пр.

2525059
патент выдан:
опубликован: 10.08.2014
МАРКЕРЫ РИСКА СЕРДЕЧНО-СОСУДИСТОГО ЗАБОЛЕВАНИЯ

Предложенная группа изобретений относится к области медицины. Предложены способ и набор для определения наличия у пациента повышенного риска обладания сердечно-сосудистым заболеванием или нарушением по полиморфным вариантам генов. Предложен способ идентификации пациента, который нуждается в ранней и/или агрессивной или профилактической терапии сердечно-сосудистого заболевания и способ лечения такого пациента. Предложенная группа изобретений обеспечивает эффективные способы и наборы для определения риска обладания сердечно-сосудистым заболеванием, что позволяет идентифицировать пациента, который нуждается в терапии сердечно-сосудистого заболевания. 4 н. и 6 з.п. ф-лы, 4 ил., 18 табл., 1 пр.

2524659
патент выдан:
опубликован: 27.07.2014
СПОСОБ СПЕЦИФИЧНОЙ ДЕТЕКЦИИ МАЛОПРЕДСТАВЛЕННЫХ ФРАКЦИЙ РНК В В БИОЛОГИЧЕСКОМ ОБРАЗЦЕ

Изобретение относится к области молекулярной биологии и генной инженерии. Предложены способ и набор для детекции малопредставленных фракций РНК в биологическом образце и для детекции микоплазменного загрязнения, для чего используют операции обратной транскрипции РНК в кДНК с использованием обратной транскриптазы Thermus thermophilus (rTth-pol) в условиях "горячего старта", инактивации ОТ обработкой хаотропным средством, детекции представляющей интерес кДНК посредством полимеразной цепной реакции (ПЦР). Изобретение может быть использовано для тестирования на наличие микоплазм в медицине. 3 н. и 12 з. п. ф-лы, 3 табл., 3 пр.

2524115
патент выдан:
опубликован: 27.07.2014
СПОСОБ АМПЛИФИКАЦИИ И ДЕТЕКЦИИ НУКЛЕОТИДНЫХ ПОСЛЕДОВАТЕЛЬНОСТЕЙ В РЕАКЦИОННОЙ СМЕСИ И ИСПОЛЬЗУЕМЫЙ В НЕМ НАБОР

Настоящее изобретение относится к области биотехнологии и касается способа амплификации и детекции нуклеотидных последовательностей в реакционной смеси и набору, используемому в этом способе. Представленный способ включает предоставление исследуемого образца, реагентов для осуществления амплификации посредством полимеразной цепной реакции (ПЦР) и, по меньшей мере, четырех двояко-меченных зондов. Каждый из зондов является специфическим к своей нуклеотидной последовательности, подлежащей детекции, несет флуоресцентную метку и соответствующий тушитель флуоресценции, причем два зонда несут одинаковую метку и зонды, которые несут одинаковую метку, различаются по температуре плавления (Тпл., Tm). Далее проводят амплификацию нуклеотидных последовательностей и анализ кривой плавления при помощи двояко-меченных зондов в реакционной смеси. Охарактеризованное решение может быть использовано в мультиплексном ПЦР-анализе в реальном времени при диагностике биоагентов. 2 н. и 7 з.п. ф-лы, 9 ил., 21 табл., 2 пр.

2523589
патент выдан:
опубликован: 20.07.2014
СПОСОБ КОЛИЧЕСТВЕННОЙ ОЦЕНКИ ЭФФЕКТИВНОСТИ ОЛЕИНОВОЙ КИСЛОТЫ КАК ПЕРЕНОСЧИКА РНК ЧЕРЕЗ БИОЛОГИЧЕСКИЕ МЕМБРАНЫ

Изобретение относится к области биохимии. Проводят количественную оценку эффективности олеиновой кислоты как переносчика РНК через биологические мембраны. В качестве биологической мембраны используют клетки сочных мешочков спелой пульпы плода медового помело из рода Citrus. В качестве переносчика РНК используют олеиновую кислоту, содержащуюся в препарате Виталанг-2 в количестве 10,8% и составляющую комплекс с РНК. Для сравнения используют препарат Виталанг-1, содержащий чистую РНК. Клетки помело заливают раздельно водными растворами препаратов Виталанг-1, Виталанг-2 и дистиллированной водой в количестве по 4,8 мл в каждом флакончике. Инкубируют в течение 22 ч при комнатной температуре. С помощью спектрофотометра измеряют оптическую плотность растворов против дистиллированной воды, определяя содержание РНК в клетках помело и окружающем растворе. В результате сравнения полученных значений оптической плотности растворов делают вывод о том, что Виталанг-2 проникает через биологические мембраны в 4,7-4,9 раза эффективнее Виталанга-1. Устанавливают, что спектры поглощения извлеченной из сочных мешочков РНК идентичны таковым для исходных соединений. Изобретение позволяет оценить эффективность олеиновой кислоты, используемой в качестве переносчика РНК через биологические мембраны. 1 пр.

2523119
патент выдан:
опубликован: 20.07.2014
СИНТЕТИЧЕСКИЕ ОЛИГОНУКЛЕОТИДЫ-ПРАЙМЕРЫ, ИСПОЛЬЗУЕМЫЕ ДЛЯ ПОЛУЧЕНИЯ НУКЛЕОТИДНЫХ ПОСЛЕДОВАТЕЛЬНОСТЕЙ ГЕНОВ РВ2, РВ1, РА, NP, MP, NS НИЗКОПАТОГЕННЫХ ВИРУСОВ ГРИППА ПТИЦ.

Изобретение относится к области биотехнологии и касается синтетических олигонуклеотидов-праймеров. Представленные праймеры фланкируют участки генов PB2, PB1, PA, NP, MP, NS низкопатогенных вирусов гриппа птиц и не дают перекрестных реакций с родственными видам. Разработанные праймеры позволяют получить полную информацию о генах вирусов гриппа птиц, их принадлежности к той или иной генетической линии вируса, наличии нуклеотидных/аминокислотных замен в геноме патогена. Представленное изобретение может быть использовано в диагностических целях идентификации вируса гриппа птиц в вирусологии и ветеринарии, а также для решения научно-исследовательских задач по изучению данного вируса. 1 ил., 2 табл., 4 пр.

2522822
патент выдан:
опубликован: 20.07.2014
СПОСОБ ОПРЕДЕЛЕНИЯ УРОВНЯ ТРАНСКРИПЦИИ ГЕНА, КОДИРУЮЩЕГО ХЕМОКИН CCL2 (МСР-1) ЧЕЛОВЕКА И НАБОР ДЛЯ ЕГО ОСУЩЕСТВЛЕНИЯ

Группа изобретений относится к области биотехнологии. Способ определения уровня экспрессии гена МСР1 (CCL2) предусматривает оценку количества его мРНК методом полимеразной цепной реакции (ОТ-ПЦР) с детекцией сигнала в реальном времени в образцах клеток, тканей и биологических жидкостей человека. Разработан набор для количественного определения мРНК МСР1, включающий комбинации олигонуклеотидных праймеров и флюоресцентных зондов для ОТ-ПЦР в реальном времени, для определения количества кДНК гена МСР1 и нормировочных генов RPL32, АСТВ, PII. Использование группы изобретений позволяет уменьшить ошибки вычисления, вносимые при использовании одного нормировочного гена без увеличения числа амплификаций, а также уменьшить ошибки вычислений, возникающие при упрощенном предположении о равенстве эффективности реакций амплификации кДНК MCP1 и нормировачного гена, имеющего место в методе Ct. 2 н.п. ф-лы, 2 ил., 3 табл., 1 пр.

2522801
патент выдан:
опубликован: 20.07.2014
РЕГИСТРАЦИЯ РАХ2 ДЛЯ ДИАГНОСТИКИ РАКА МОЛОЧНОЙ ЖЕЛЕЗЫ

Изобретение относится к области медицины, генетической инженерии и молекулярной биологии. Предложен способ мониторинга рака молочной железы у субъекта. Способ включает определение отношения экспрессии гена парного бокса 2 к экспрессии гена бета-дефензина-1 (PAX2-к-DEFB1) в клетках, полученных из молочной железы субъекта, при этом отношение экспрессии PAX2-к-DEFB1 коррелирует с состояниями молочной железы. Также предложен набор для мониторинга рака молочной железы. Изобретение может быть использовано в медицине при лечении и мониторинге рака. 3 н. и 7 з. п. ф-лы, 40 ил., 8 табл., 17 пр.

2522485
патент выдан:
опубликован: 20.07.2014
Наверх