Способы измерения или испытания, использующие ферменты или микроорганизмы; составы или индикаторная бумага для них; способы получения подобных составов; контроль за условиями в микробиологических или ферментативных процессах – C12Q

C12 Биохимия; пиво; алкогольные напитки; вино; уксус; микробиология; энзимология; получение мутаций; генная инженерия
C12Q Способы измерения или испытания, использующие ферменты или микроорганизмы; составы или индикаторная бумага для них; способы получения подобных составов; контроль за условиями в микробиологических или ферментативных процессах
C12Q 1/00 Способы измерения или испытания, использующие ферменты или микроорганизмы; составы для них; способы получения подобных составов
устройства для измерения или испытания при работе с ферментами или микроорганизмами, например счетчики колоний  C 12M 1/34
C12Q 3/00 Способы контроля за условиями
устройства для этой цели  C 12M 1/36; управление или регулирование вообще  G 05

Патенты в данной категории


Изобретение относится к биотехнологии. Описан набор праймеров для амплификации фрагментов гена CFTR. Представлены биочип и набор мишеней для биочипа. Описан способ идентификации мутаций в гене CFTR человека, вызывающих муковисцидоз, включающий использование описанных праймеров. Представлена тест-система, которая содержит описанные праймеры и биочип. Изобретение расширяет арсенал технических средств, используемых для диагностики муковисцидоза, позволяя быстро и специфично диагностировать соответствующие мутации. 5 н. и 5 з.п. ф-лы, 2 ил, 4 табл., 6 пр.

опубликован: 27.09.2014

Изобретение относится к биотехнологии, в частности к ветеринарной микробиологии. Определяют чувствительность бактерий, вызывающих кишечные инфекции, к комплексным антибактериальным препаратам. Проводят разведение антибактериальных препаратов в концентрации 10 мкг/мл в питательной среде с рН 7,2-7,6. Подготовленную взвесь бактерий вносят в лунки, содержащие приготовленные разведения. Вносят индикатор - 0,5% раствор бромкрезолового пурпурного в количестве 10 мкл. Инкубируют в течение 3-4 ч. Проводят визуальную оценку роста бактерий и оценку окраски среды в лунке при достижении рН 5,2-6,8 среды. Делают вывод о чувствительности бактерий к комплексным антибактериальным препаратам по наличию или отсутствию роста бактерий и изменению окраски среды с красной на желтую. Чувствительными считают бактерии, у которых отсутствует рост и изменение цвета питательной среды с антибактериальными препаратами. Устойчивыми считаются бактерии, у которых наблюдается рост и изменение цвета среды с антибактериальными препаратами. Изобретение позволяет сократить время определения чувствительности бактерий, вызывающих кишечные инфекции у животных, к комплексным антибактериальным препаратам. 3 табл., 1 пр.

опубликован: 27.09.2014

Изобретение относится к области микробиологии. Готовят две взвеси. Клинические полиантибиотикорезистентные штаммы Escherichia coli добавляют в изотонический раствор NaCl до достижения концентрации 30-40 тыс. КОЕ/мл. Добавляют наночастицы меди в раствор NaCl до достижения концентрации 0,01-0,05 мг/мл. Приготавливают суспензию этилендиаминтетрауксусной кислоты - ЭДТА путем ее разведения в дистиллированной воде из расчета 0,1-0,2:1 соответственно. Добавляют в приготовленную суспензию NaOH до получения раствора ЭДТА с рН=7,6-8. Соединяют приготовленные взвеси и раствор ЭДТА в следующих соотношениях, мас.%: взвесь наночастиц меди - 70-85, взвесь микроорганизмов - 10-20, раствор ЭДТА - 5-10. Инкубируют в шейкере при 100-150 об/мин и температуре 36-38°C в течение 40-60 минут. Высевают полученную биомассу на твердую питательную среду объемом 20-25 мл в количестве 0,1-0,12 мл. Инкубируют в термостате при температуре 36-38°C в течение 18-24 часов. Определяют чувствительность штаммов E.coli к антибиотикам. Изобретение позволяет увеличить чувствительность штаммов бактерий E.coli к антибиотикам гентамицину и ампицилину. 2 табл., 1 з.п. ф-лы, 1 пр.

опубликован: 27.09.2014

Изобретение относится к биотехнологии, а именно к получению питательных сред, которые создают оптимальные условия для выделения и выращивания бруцеллезного микроба. Питательная среда включает плотную и жидкую фазы. Плотная фаза содержит мясную воду, пептон сухой ферментативный, печеночный настой, натрий хлористый, агар микробиологический в заданном соотношении компонентов. Жидкая фаза содержит гидролизат говяжьего мяса, натрий хлористый, глицерин, глюкозу, цитрат натрия, липоевую кислоту, метабисульфит натрия и дистиллированную воду в заданном соотношении компонентов. Изобретение позволяет сократить сроки выращивания бруцеллезного микроба. 2 пр.

опубликован: 27.09.2014

Изобретение относится к области биотехнологии, конкретно к выявлению рака легкого с помощью аптамеров, и может быть использовано в диагностике. Аптамеры получают в результате селекции, включающей чередование раундов позитивной селекции аптамеров к измельченным опухолевым тканям легкого человека, забиравшимся после операции у онкологических больных, и негативной селекции к здоровым тканям легкого и цельной крови здоровых людей, с выявлением пула аптамеров с наибольшей аффинностью, его клонирования, секвенирования, проверки на специфичность связывания с опухолевыми клетками легкого. Полученные аптамеры обладают высокой чувствительностью к продуктам распада опухоли и циркулирующим раковым клеткам в периферической крови больных раком легкого, что позволяет повысить эффективность диагностики рака легкого человека. 2 з.п. ф-лы, 2 ил., 1 пр.

опубликован: 20.09.2014

Способ оценки выживаемости бифидо- и лактобактерий в желудочно-кишечном тракте экспериментальных животных включает получение мутантов указанных бактерий на плотных питательных средах с повышающимися концентрациями рифампицина, начиная от 10 мкг·мл-1. Выросшие спонтанные мутанты отбирают и повторно высевают на плотную питательную среду с рифампицином в концентрации до 160 мкг·мл-1. Для введения экспериментальным животным отбирают мутанты с наследственно закрепленными признаками устойчивости к рифампицину в концентрации 150-160 мкг·мл-1 в питательной среде. Количество вводимых мутантов подсчитывают. После выдерживания животных отобранные фекалии суспендируют в изотоническом растворе хлорида натрия. Отбирают надосадочную жидкость, которую высевают на поверхность плотной питательной среды в чашках Петри, содержащей 110 мкг·мл -1 рифампицина. Инкубируют в течение 72 ч в микроаэрофильных условиях при 37°С. Определяют число выросших колоний, пересчитывают количество жизнеспособных бактерий на 1 г фекалий. Определяют долю выживших микроорганизмов от числа введенных, по величине которой судят об их выживаемости. Изобретение позволяет эффективно определить долю выживших бифидобактерий и лактобактерий, прошедших через ЖКТ животных. 2 ил., 3 табл., 3 пр.

опубликован: 20.09.2014

Изобретение относится к медицине и микробиологии. Предложен способ определения микобактерий туберкулеза генотипа Beijing в режиме реального времени путем определения вставки элемента IS6110 в локусе генома dnaA-dnaN,отличающийся тем, что применяют ПЦР в режиме реального времени с использованием двух специфических праймеров 5`-AGATCAGAGAGTCTCCGGACTCA и 5`-CGCCGGGACTGTATGAGTCT и флуоресцентно-меченого зонда R6G-5`-TGTGCACAGCGACACTCACAGCCA-3`-BHQ2, оценку результата производят путем регистрации сигнала флуоресценции по каналу R6G с длиной волны 555нм, причем при наличии в образце ДНК штамма микобактерий туберкулеза генотипа Beijing экспоненциальный рост сигнала флуоресценции ПЦР при анализе чистой ДНК происходит между 10-15 циклами, а при анализе клеточных лизатов - между 15 и 20 циклами. Изобретение может быть использовано для лабораторного определения микобактерий туберкулеза генотипа Beijing. 3 ил., 2 пр.

опубликован: 20.09.2014

Изобретение относится к биотехнологии. Описан способ проведения ПЦР для эффективной идентификации аллельных вариантов Waxy-генов пшеницы. Способ отличается от известных из уровня техники использованием прямого праймера 4F-c: 5'-CCCCCAAGAGCAACTACCAGT-3'. Также описан способ ПЦР-ПДРФ для эффективной идентификации аллельных вариантов Waxy-генов пшеницы. Способ отличается от известных из уровня техники тем, что после этапа ПЦР проводят процедуру ПДРФ-анализа с эндонуклеазным расщеплением ампликонов рестриктазой AcsI. Цель изобретения - разработка способов проведения ПЦР и ПЦР-ПДРФ для эффективной идентификации аллельных вариантов Waxy-генов пшеницы. 2 н.п. ф-лы, 4 ил., 2 табл.

опубликован: 20.09.2014

Изобретение относится к биотехнологии, а именно к генетической инженерии. Техническим результатом изобретения является возможность определения генетической группы - нуклеотипа B вируса блютанга с помощью ОТ-ПЦР, что позволит существенно сократить материальные затраты и время проведения работ по определению серотипа вируса блютанга в образцах исследуемого биологического материала. Предложенные праймеры используются для идентификации вируса блютанга нуклеотипа B (3, 13 и 16 серотипы) методом ОТ-ПЦР. 2 табл.

опубликован: 20.09.2014

Цель изобретения - разработка эффективного способа генотипирования крупного рогатого скота по DGAT1-гену на основе ПЦР-ПДРФ-анализа. Разработанный способ проведения ПЦР-ПДРФ для генотипирования крупного рогатого скота по аллелям А и К гена DGAT1, отличающийся от ближайшего прототипа [1] тем, что на этапе ПЦР используются другие последовательности олигонуклеотидных праймеров:




а на этапе ПДРФ применяется другая эндонуклеаза рестрикции - TaqI, с генерацией генотип-специфичных фрагментов: генотип АА=82/18 bp, генотип КК=100 bp и генотип АК=100/82/18 bp (фиг.1 и 2). 2 ил., 2 табл.

опубликован: 20.09.2014

Изобретение относится к области биотехнологии, конкретно к набору синтетических олигонуклеотидных пар праймеров, и может быть использовано в судебно-медицинской идентификационной экспертизе. Заявленный набор состоит из пар праймеров, комплементарных соответствующим участкам пятнадцати микросателлитных локусов Y-хромосомы, которые представляют собой пары праймеров, из которых один имеет флуоресцентную метку, а второй является немеченым, при этом прямые праймеры для каждого из локусов несут на 5'-конце флуоресцентную метку: ТЕТ (4,7,2',7'-тетрахлоро-6-карбоксифлуоресцеин) для DYS385a/b, DYS390, DYS391, DYS426 и DYS439; FAM (6-карбоксифлуоресцеин) для DYS392, DYS393, DYS437 и DYS438; и HEX (4,7,2',4',5',7'-гексахлоро-6-карбоксифлуоресцеин) для DYS394, DYS388, DYS389I/II и DYS434. Изобретение относится также к способу выявления генотипов для идентификации личности в российской популяции с использованием вышеуказанных праймеров. Изобретение позволяет проводить идентификацию личности в российской популяции с высокой чувствительностью, специфичностью и точностью по сравнению с существующими аналогами. 2 н.п. ф-лы, 2 ил.

опубликован: 20.09.2014

Изобретение относится к биотехнологии и представляет собой способ оценки чувствительности клеток рака легкого к доксорубицину (IC50), а также набор для осуществления данного способа. Способ основан на сравнении уровней экспрессии маркерных генов АВСС1, ERCC1, FTL, GSTP1, МТ2А, RRM1, TUBB3 в исследуемых клетках с уровнями экспрессии указанных генов в контрольных клетках NCI-H322. Способ включает гибридизацию флуоресцентно меченых препаратов нуклеиновых кислот, приготовленных из клеток или тканей человека, с массивом данных олигонуклеотидных зондов, иммобилизованных на твердой подложке. Отмывают подложку от неспецифически связавшихся препаратов. Сканируют подложку лазерным сканером и анализируют полученное изображение. При повышенной экспрессии генов ERCC1, МТ2А, RRM1 и TUBB3 и пониженной экспрессии генов АВСС1, GSTP1, FTL в исследуемых клетках по отношению к клеткам NCI-H322, IC50 доксорубицина для исследуемых клеток оценивают на уровне IC50 0,54 мкМ, и клетки относят к устойчивым. При пониженной экспрессии генов ERCC1, МТ2А, RRM1 и TUBB3 и повышенной экспрессии генов АВСС1, GSTP1, FTL в исследуемых клетках по отношению к клеткам NCI-H322, IC50 доксорубицина для исследуемых клеток оценивают на уровне IC50 0,073 мкМ, и клетки относят к чувствительным. Предложенное изобретение позволяет определять чувствительность клеток рака легкого к доксорубицину с высокой точностью. 2 н.п. ф-лы, 1 ил., 1 табл., 2 пр.

опубликован: 10.09.2014

Изобретение относится к области медицины, в частности к клинической лабораторной диагностике. Предложен биологический микрочип для выявления и многопараметрического анализа противохолерных антител в сыворотке крови человека, содержащий массив дискретно нанесенных и иммобилизованных на поверхности подложки O-антигенов V. cholerae и холерного токсина, сгруппированных в отдельные зоны. Изобретение обеспечивает проведение параллельного иммунологического анализа нескольких образцов сыворотки крови человека на наличие противохолерных антител к широкому спектру антигенов возбудителя холеры с определением иммуноглобулинов класса G и M за короткое время. 2 з.п. ф-лы, 3 ил., 2 пр.

опубликован: 10.09.2014

Изобретение относится к области биохимии, в частности к набору синтетических олигонуклеотидов для амплификации и последующего секвенирования ITS1-5.8S-ITS2 сосудистых растений, включающего проведение полимеразой цепной реакции с помощью универсальных праймеров со следующим нуклеотидным составом: primer ITS-for CGTAACAAGGTTTCCGTAG, primer ITS-rew GGAATCCTTGTAAGTTTCTTT. Изобретение позволяет эффективно анализировать структуру внутреннего транскрибируемого спейсера рибосомной ДНК сосудистых растений. 1ил.

опубликован: 10.09.2014

Группа изобретений относится к области микробиологии и биотехнологии. Способ детекции живых клеток микроорганизма в тестируемом образце путем отличия живых клеток от мертвых клеток или поврежденных клеток предусматривает добавление в тестируемый образец средства, способного к ковалентному связыванию с ДНК или РНК при облучении светом с длиной волны от 350 нм до 700 нм; облучение тестируемого образца; амплификацию мишеневой области ДНК или РНК микроорганизма, содержащегося в тестируемом образце, способом амплификации нуклеиновых кислот в присутствии средства подавления действия вещества, ингибирующего амплификацию нуклеиновых кислот, соли магния, соли органической кислоты или соли фосфорной кислоты, без выделения нуклеиновых кислот из клеток и анализа продукта амплификации. Способ может быть осуществлен посредством применения набора, состоящего из средства, способного к ковалентному связыванию с ДНК или РНК при облучении светом с длиной волны от 350 нм до 700 нм, средства подавления действия вещества, ингибирующего амплификацию нуклеиновых кислот и праймеров для амплификации мишеневой области. При помощи данных изобретений можно с высокой чувствительностью и точностью детектировать живые клетки микроорганизмов в различных биологических образцах. 2 н. и 25 з.п. ф-лы, 17 ил., 12 табл., 9 пр.

опубликован: 10.09.2014

Группа изобретений относится к области биотехнологии, а именно к исследованию биомолекулярных взаимодействий и детектированию биомолекул с использованием поверхностного плазмонного резонанса. Описаны биологический сенсор, а также способ создания биологического сенсора с использованием тонких пленок на основе графена, оксида графена или однослойных или многослойных углеродных нанотрубок. Биологический сенсор состоит из подложки, металлической пленки, на поверхность которой нанесен промежуточный связующий слой, выполненный из тонкой пленки из графена, или тонкой пленки оксида графена, или тонкой пленки из углеродных нанотрубок. На поверхность промежуточного связующего слоя конформно и однородно адсорбирован биоспецифический слой. В качестве биоспецифического слоя может выступать слой молекул связывающего партнера анализируемого вещества или слой из комплекса биологических молекул, способных химически взаимодействовать с молекулами связывающего партнера и образовавших с ними комплекс. Также в качестве биоспецифического слоя может выступать слой гидрогеля, на который осаждены молекулы связывающего партнера и/или комплекс из молекул связывающего партнера и биологических молекул, которые могут образовывать химическую связь с молекулами связывающего партнера. Описанный способ получения биологического сенсора включает в себя стадии нанесения металлической пленки, промежуточного связующего слоя и биоспецифического слоя. Достигается высокая чувствительность биосенсора в сочетании с высокой биоспецифичностью; расширение спектра применения устройства; защита металлической пленки от воздействий внешней среды; возможность детектирования крупных биологических объектов. 2 н. и 25 з.п. ф-лы, 9 ил.

опубликован: 10.09.2014

Изобретение относится к ветеринарной микробиологии и биотехнологии, а именно к генетической инженерии. Предложены синтетические олигонуклеотидные праймеры для идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы A у крупного рогатого скота и способ их применения. Предложенный способ включает проведение ПЦР с синтетическими олигонуклеотидными праймерами на район гена hyaD Pasteurella multocida, перенос продукта амплификации на гель и оценку проведения реакции. Для постановки ПЦР используют ДНК, выделенную из патологического материала или бактериальных культур. ПЦР проводят в 1 раунд. В случае положительной реакции синтезируется фрагмент, соответствующий размеру 218 п.н. Способ может быть использован в ветеринарной микробиологии для диагностики пастереллеза сельскохозяйственных животных. 2 н.п. ф-лы, 5 табл.

опубликован: 27.08.2014

Изобретение относится к области биотехнологии и касается видовой и штаммовой идентификации бифидобактерий филотипа Bifidobacterium longum. Представленный способ основан на комбинации и полиморфизме генов токсин-антитоксин суперсемейства RelBE и характеризуется тем, что для идентификации проводят амплификацию с геномной ДНК с использованием набора видо- и штаммоспецифичных олигонуклеотидов, ПЦР продукты анализируют в агарозном геле, а размер полученного фрагмента определяют с помощью ДНК-маркера. Исследуемые штаммы относят к определенному виду и/или штамму в случае наработки фрагментов при использовании определенных олигонуклеотидов. Представленное изобретение может быть использовано для идентификации штаммов бифидобактерий, определения исследуемых штаммов в клинических пробах или их молекулярного отслеживания в коммерческих препаратах. 3 табл.

опубликован: 27.08.2014

Изобретение относится к иммунологии. Предложены варианты применения вариантов набора генов (фармакодинамических (ФД) маркеров) с повышенной регуляцией экспрессии или действия, индуцируемых интерфероном альфа (ИФН ). Описаны варианты способа идентификации пациентов для получения MEDI-545 по обнаружению таких профилей экспрессии ИФН -индуцируемых ФД маркеров. Использование изобретения обеспечивает распознавание тех пациентов, для которых лечение нейтрализующим антителом MEDI-545 может быть действительно эффективным, что может найти применение в медицине. 7 н. и 3 з.п. ф.-лы, 90 ил., 33 табл., 22 пр.

опубликован: 27.08.2014

Изобретение относится к области биотехнологии и касается способа идентификации лактобацилл. Представленный способ основан на комбинации и полиморфизме генов токсин-антитоксин суперсемейств RelBE и MazEF и характеризуется тем, что для идентификации проводят амплификацию геномных ДНК с использованием набора олегонуклеотидов определенной структуры, ПЦР-продукты анализируют в агарозном геле, а размер полученного фрагмента определяют с помощью ДНК-маркера. Исследуемый штамм относят к определенной группе, виду или штамму в случае наработки фрагментов при использовании определенных олигонуклеотидов. Представленное изобретение может быть использовано для идентификации штаммов лактобацилл в микробиоте человека, продуктах питания, а также для определения исследуемого штамма в клинических пробах или молекулярного отслеживания в коммерческих препаратах. 3 табл., 3 пр.

опубликован: 27.08.2014

Изобретение относится к биотехнологии и представляет собой набор синтетических олигонуклеотидов для выявления видовой принадлежности родиолы четырехнадрезной {Rhodiola quadrifida (Pall.) Fisch. et Mey). Набор включает видоспецифичные участки для создания прямого, обратного праймеров и разрушаемого зонда, а именно прямой праймер - CGGCAACGGATATCTCGGCT-3', обратный праймер - 5'-GGCCTCGCААССАССACTTGTC-3', разрушаемый зонд - (флуоресцентная метка)-5'-CCGTGAACCATCGAGTTTTT-3'-(гаситель). Предложенное изобретение позволяет достоверно, быстро и с высокой чувствительностью идентифицировать видовую принадлежность лекарственного растения - родиолы четырехнадрезной (Rhodiola quadrifida (Pall.) Fisch. et Mey.) в ходе проведения скрининга растительного сырья. 1 ил., 1 пр.

опубликован: 20.08.2014

Изобретение касается способа определения генотипов золотистого стафилококка. Представленный способ включает получение чистой культуры микроорганизмов на плотной питательной среде с последующим выделением и амплификацией ДНК возбудителя с помощью мультиплексной полимеразной цепной реакции (ПЦР) и с детекцией результатов методом электрофореза в агарозном геле. При осуществлении мультиплексной ПЦР используют четыре пары праймеров, комплементарных к участкам гена внеклеточной термонуклеазы ( nuc), гена лейкоцидина Пантона-Валлентайна (pvl), гена белка токсического шока (tst) и гена устойчивости к метициллину (mecA). Генотипы золотистого стафилококка определяют по наличию или отсутствию генов вирулентности pvl и tst и гена устойчивости к метициллину mecA или их сочетаний. Изобретение позволяет определять отдельные генотипы золотистого стафилококка одновременно в одной мультиплексной реакции, а также исключить предварительный этап идентификации микроорганизма. 1 ил., 2 табл., 2 пр.

опубликован: 20.08.2014

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Хунин методом полимеразной цепной реакции в реальном времени. Представленный набор включает последовательности олигонуклеотидов, видоспецифичные для вируса Хунин и имеющие следующую структуру:


внутренний: 5 3 5 CGCACAGTGGATCCTAGGCA 3


Охарактеризованное решение может быть использовано в медицине и эпидемиологии для выявления генетического материала вируса Хунин в клинических или секционных образцах. 2 ил., 1 табл., 2 пр.

опубликован: 20.08.2014

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченного зонда для видоспецифичной экспресс-идентификации РНК вируса Мачупо методом полимеразной цепной реакции в реальном времени. Представленный набор включает последовательности олигонуклеотидов, видоспецифичные для вируса Мачупо и имеющие следующую структуру:


внутренний: 5 3 5 CGCACAGTGGATCCTAGGCA 3

зонд: R6G - TGAGTCCACCGRAAGCTGGGRATYTCYTT - BHQ1. Охарактеризованное решение может быть использовано в медицинской практике для выявления генетического материала вируса Мачупо в клинических или секционных образцах. 2 ил., 1 табл., 2 пр.

опубликован: 20.08.2014

Изобретение относится к биотехнологии и может быть использовано для дифференцированного определения числа жизнеспособных актинобактерий рода Rhodococcus, иммобилизованных в нерастворимом гелевом носителе. Способ предусматривает следующее. Гранулу биокатализатора с заключенными в ней клетками одного или нескольких видов родококков помещают в лунку 96-луночного планшета, добавляют краситель иодонитротетразолий (INT). После появления специфического фиолетового окрашивания формазана измеряют оптическую плотность гранулы с помощью планшетного фотометра. В случае окрашенного субстрата или предварительного нахождения иммобилизованного биокатализатора в почве проводят экстракцию формазана 96% этанолом и измеряют оптическую плотность экстракта. Число жизнеспособных родококков в грануле геля определяют с помощью калибровочного графика зависимости оптической плотности от числа живых клеток в суспензии, определенного традиционным методом высева на плотную питательную среду. Затем из окрашенной красителем гранулы биокатализатора или из гранулы после экстракции красителя выделяют ДНК и проводят ПЦР с использованием наборов видоспецифических праймеров. Определяют видовое положение иммобилизованных родококков. Изобретение позволяет сократить время дифференциации родококков и повысить точность способа. 1 з.п. ф-лы, 3 табл., 4 ил., 4 пр.

опубликован: 20.08.2014

Изобретение относится к биотехнологии. Предложенный способ предусматривает получение образцов высокоочищенной ДНК, фрагментацию выделенной ДНК эндонуклеазой рестрикции, не имеющей сайта узнавания в амплифицируемом районе, гидролиз фрагментированной ДНК метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI или ее изошизомером, лигирование универсального олигонуклеотидного адаптера к гидролизованной ДНК с последующей амплификацией в реальном времени с использованием праймера и зонда, комплементарных исследуемой ДНК и гибридного праймера, 3' конец которого комплементарен не менее 3 нуклеотидам 3' конца ДНК у исследуемого места гидролиза GlaI, а оставшаяся часть комплементарна адаптерной последовательности, и составление заключения на основании флуоресцентного сигнала о наличии последовательности Pu(5mC)GPy. 3 з.п. ф-лы, 4 ил., 5 табл., 5 пр.

опубликован: 20.08.2014

Изобретение относится к биотехнологии, конкретно к определению восприимчивости к внутрибольничной инфекции пациента с септическим шоком, и может быть использовано в медицине. Получают биологический образец, выбранный из образца крови, сыворотки, слюны, ткани или циркулирующих клеток пациента и экстрагируют биологический материал: нуклеиновую кислоту или белок из биологического образца. С использованием специфического реагента в отношении продукта экспрессии гена-мишени S100A9, выбранного из праймера амплификации, зонда гибридизации и/или антитела, определяют экспрессию гена-мишени S100A9. Изобретение позволяет по сверхэкспрессии гена-мишени S100A9 по отношению к определенной пороговой величине определить, что пациент с септическим шоком восприимчив к внутрибольничной инфекции. 2 н. и 9 з.п.ф-лы, 2 ил., 3 табл., 5 пр.

опубликован: 20.08.2014

Изобретение относится к биотехнологии. Способ предназначен для выявления внутрибольничных штаммов микроорганизмов при проведении эпидемиологического мониторинга. Готовят водно-спиртовые растворы 3-4 анилиновых красителей. Добавляют стандартизированную взвесь исследуемой микробной культуры. Инкубируют, оценивают полученные результаты и определяют тождественность штаммов. Причем при тождественности показателей чувствительности выделенных и изученных микробных культур к каждому соответствующему анилиновому красителю устанавливают выявление внутрибольничного штамма. Изобретение позволяет повысить точность способа. 4 табл., 3 пр.

опубликован: 20.08.2014

Изобретение относится к биотехнологии. Способ предусматривает отбор проб почвы, внесение в почву метсульфурон метила (МСМ) в заданном количестве с последующей инкубацией и определением удельной метаболической активности (УМА) сапрофитного комплекса почвы при помощи мультисубстратного тестирования (МСТ) и учета числа КОЕ (колониеобразующих единиц) на разбавленной агаризованной среде. Уровень детоксикационной активности оценивают по относительной величине повышения УМА сапрофитного микробного сообщества почвы при внесении МСМ в сравнении с показателями почвы без его внесения (показатель Кд). 4 табл., 1 пр.

опубликован: 20.08.2014

Изобретение относится к биотехнологии, в частности к получению питательных сред для культивирования возбудителя листериоза. Питательная среда содержит ферментативный гидролизат бобов сои, ферментативный гидролизат из активированной эмбрионально-яичной массы перепелов, натрий хлористый, калий фосфорнокислый 2-замещенный 3-водный, натрий фосфорнокислый 2-замещенный 12-водный, агар микробиологический и дистиллированную воду в заданном соотношении компонентов. Изобретение позволяет упростить питательную среду для культивирования возбудителя листериоза. 3 пр.

опубликован: 20.08.2014