Получение мутаций или генная инженерия, ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка, использование их хозяев: ..способы выделения, получения или очистки ДНК или РНК – C12N 15/10

Раздел C ХИМИЯ; МЕТАЛЛУРГИЯ
C12 Биохимия; пиво; алкогольные напитки; вино; уксус; микробиология; энзимология; получение мутаций; генная инженерия
C12N Микроорганизмы или ферменты; их композиции; размножение, консервирование или сохранение микроорганизмов; мутации или генная инженерия; питательные среды
C12N 15/00 Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев
C12N 15/10 ..способы выделения, получения или очистки ДНК или РНК

Патенты в данной категории

ДИСПЛЕЙ НА ПОВЕРХНОСТИ КЛЕТОК ПОЛИПЕПТИДНЫХ ИЗОФОРМ НА ОСНОВЕ ПРОЧИТЫВАНИЯ ТЕРМИНИРУЮЩЕГО КОДОНА

Изобретение относится к области молекулярной биологии и генетической инженерии. Предложен способ селекции эукариотической клетки-хозяина, экспрессирующей желаемый уровень интересующего полипептида, включающий трансфекцию клеток гетерологичной нуклеиновой кислотой, содержащей по меньшей мере одну кассету, содержащую по меньшей мере первый полинуклеотид, кодирующий интересующий полипептид, стоп-кодон, расположенный по направлению экспрессии относительно первого полинуклеотида, второй полинуклеотид, расположенный по направлению экспрессии относительно стоп-кодона, кодирующий иммуноглобулиновый трансмембранный якорный домен, культивирование клеток-хозяев для экспрессии интересующего полипептида так, чтобы по меньшей мере часть рассматриваемого полипептида экспрессировалась в виде слитого полипептида, содержащего иммуноглобулиновый трансмембранный якорный домен, причем такой слитый полипептид экспонируется на поверхности указанной клетки-хозяине, селекцию клетки по наличию или количеству слитого полипептида, экспонируемого на клеточной поверхности. Изобретение может быть использовано в биотехнологии для селекции высокопродуктивных клеточных линий. 6 н. и 9 з.п. ф-лы, 8 табл., 11 пр.

2528858
патент выдан:
опубликован: 20.09.2014
СПОСОБ ПОЛУЧЕНИЯ ПРЕПАРАТИВНЫХ КОЛИЧЕСТВ АНТИГЕНОВ ФЛОЭМНО-ОГРАНИЧЕННЫХ ВИРУСОВ

Изобретение относится к области биохимии, в частности к cпособу получения препаративных количеств вирусного антигена - белка вируса скручивания листьев картофеля (ВСЛК, PLRV), в составе химерных вирусных частиц, имитирующих вирионы ВСЛК, включающий создание рекомбинантной ДНК, содержащей кДНК вируса просветления жилок турнепса (ВПЖТ, TVCV), принадлежащего к тобамовирусам, где кДНК ВПЖТ находится под контролем растительного промотора, на ее конце имеется терминатор транскрипции, а ген белка оболочки ВПЖТ заменен на ген мажорного белка оболочки ВСЛК, включающий создание агробактериального вектора (плазмиды) pCambia 1300, способного встраиваться в геном растения-хозяина и вызывать системную инфекцию, перенос созданной рекомбинантной ДНК в агробактериальный вектор pCambia, трансформацию растения-хозяина Nicotiana benthamian агробактериальным вектором pCambia, размножение химерного вируса, состоящего из РНК вируса, в растении-хозяине Nicotiana benthamian, выделение химерного вируса, содержащего кДНК вируса просветления жилок турнепса (ВПЖТ, TVCV), ген оболочки которого заменен на ген мажорного белка оболочки ВСЛК, из зараженных листьев растения-хозяина Nicotiana benthamian. Раскрыт способ получения антисыворотки к капсидному белку ВСЛК, включающий иммунизацию животных вирусными частицами, полученными указанным способом. Изобретение позволяет получать 2-4 мг вирусной химеры из 11 г зараженных листьев. 2 н. п. ф-лы, 7 ил., 1 табл.

2525136
патент выдан:
опубликован: 10.08.2014
ОДНОЦЕПОЧЕЧНАЯ КОЛЬЦЕВАЯ РНК И СПОСОБ ЕЕ ПОЛУЧЕНИЯ

Изобретение относится к области биохимии, в частности к способу получения одноцепочечной кольцевой РНК. Способ включает синтез смысловой цепи и антисмысловой цепи, содержащих нуклеотидную последовательность с неспаренными нуклеотидами на 5'-конце и 3'-конце, и одновременно лигирование нуклеотида на 5'-конце нуклеотидной последовательности с неспаренными нуклеотидами в смысловой цепи с нуклеотидом на 3'-конце нуклеотидной последовательности с неспаренными нуклеотидами в антисмысловой цепи и, наоборот, с использованием лигазы. Нуклеотидная последовательность с неспаренными нуклеотидами на 5'-конце смысловой цепи и нуклеотидная последовательность с неспаренными нуклеотидами на 3'-конце антисмысловой цепи связаны друг с другом с образованием петли. Нуклеотидная последовательность с неспаренными нуклеотидами на 3'-конце смысловой цепи и нуклеотидная последовательность с неспаренными нуклеотидами на 5'-конце антисмысловой цепи также связаны друг с другом с образованием петли. Смысловая и антисмысловая цепи спарены с образованием стебля. Длина петли составляет 9 нуклеотидов, а длина стебля составляет от 19 до 31 нуклеотида. 2 з.п. ф-лы, 9 ил., 5 пр.

2523596
патент выдан:
опубликован: 20.07.2014
ПРОСТОЙ СПОСОБ ЭКСТРАКЦИИ ИЗ ДРОЖЖЕЙ ВЫСОКОПОЛИМЕРНОЙ РНК

Изобретение относится к фармацевтической промышленности, а именно к способу получения дрожжевого экстракта, содержащего биологически активную высокополимерную РНК. Способ получения дрожжевого экстракта, содержащего биологически активную высокополимерную РНК из сухих пекарских дрожжей Saccharomyces cerevisiae, включающий суспендирование дрожжей в водном растворе олеата натрия, кипячение суспензии при периодическом перемешивании, центрифугирование охлажденного до комнатной температуры лизата, доведение объема дрожжевого экстракта до стандарта дистиллированной водой с последующим выделением из него высокополимерной РНК, добавлением его в мазь или разливом в виалы по 2-4 мл с дальнейшим замораживанием и лиофилизацией при определенных условиях. Вышеописанный способ позволяет увеличить выход высокополимерной РНК. 1 пр., 1 табл.

2522900
патент выдан:
опубликован: 20.07.2014
СПОСОБ ОПРЕДЕЛЕНИЯ УРОВНЯ ТРАНСКРИПЦИИ ГЕНА, КОДИРУЮЩЕГО ХЕМОКИН CCL2 (МСР-1) ЧЕЛОВЕКА И НАБОР ДЛЯ ЕГО ОСУЩЕСТВЛЕНИЯ

Группа изобретений относится к области биотехнологии. Способ определения уровня экспрессии гена МСР1 (CCL2) предусматривает оценку количества его мРНК методом полимеразной цепной реакции (ОТ-ПЦР) с детекцией сигнала в реальном времени в образцах клеток, тканей и биологических жидкостей человека. Разработан набор для количественного определения мРНК МСР1, включающий комбинации олигонуклеотидных праймеров и флюоресцентных зондов для ОТ-ПЦР в реальном времени, для определения количества кДНК гена МСР1 и нормировочных генов RPL32, АСТВ, PII. Использование группы изобретений позволяет уменьшить ошибки вычисления, вносимые при использовании одного нормировочного гена без увеличения числа амплификаций, а также уменьшить ошибки вычислений, возникающие при упрощенном предположении о равенстве эффективности реакций амплификации кДНК MCP1 и нормировачного гена, имеющего место в методе Ct. 2 н.п. ф-лы, 2 ил., 3 табл., 1 пр.

2522801
патент выдан:
опубликован: 20.07.2014
СПОСОБ ИДЕНТИФИКАЦИИ УЛУЧШЕННЫХ ВАРИАНТОВ БЕЛКА

Изобретение относится к способу идентификации улучшенных вариантов белка. Способ включает тестирование множества вариантов белка с единичными заменами в первом тесте первого свойства и во втором тесте второго свойства. Свойству родительского белка присваивается значение 1,0 в каждом тесте. Благоприятное первое или второе свойство обладает значением, превышающим 1,0, и чрезмерно неблагоприятное первое или второе свойство обладает значением менее чем приблизительно 0,80. Указанный родительский белок представляет собой протеазу. Первым свойством является стабильность, вторым свойством является эффективность стирки. Осуществляют идентификацию замены, введение замены в белок для получения варианта белка с множественными заменами. При этом замена не взаимодействует в трехмерной структуре указанного родительского белка, и одна из замен содержит изменение суммарного заряда, равное 0, -1 или -2 по отношению к родительскому ферменту, и, по меньшей мере, одна из замен содержит изменение суммарного заряда, равное +1 или +2 по отношению к родительскому ферменту. Тестируют вариант белка с множественными заменами в первом и втором тесте и идентифицируют указанный вариант белка. Изобретение позволяет получить вариант белка с улучшенной стабильностью и эффективностью стирки. 13 з.п. ф-лы, 6 ил., 6 табл., 7 пр.

2520808
патент выдан:
опубликован: 27.06.2014
ЭЛЕМЕНТЫ РЕКОМБИНАНТНОГО ВЕКТОРА ЭКСПРЕССИИ (REVES) ДЛЯ УСИЛЕНИЯ ЭКСПРЕССИИ РЕКОМБИНАНТНЫХ БЕЛКОВ В КЛЕТКАХ-ХОЗЯЕВАХ

Изобретение относится к биотехнологии и представляет собой выделенную полинуклеотидную молекулу с функцией rEVE, рекомбинантный вектор экспрессии, экспрессионный шаттл-вектор, клетку-хозяина, а также способы с использованием вышеуказанной выделенной полинуклеотидной молекулы. Данная полинуклеотидная молекула с функцией rEVE может быть использована для получения рекомбинантных белков. Данная полинуклеотидная молекула с функцией rEVE содержит рекомбинантный экспрессионный векторный элемент (rEVE), содержащий последовательность нуклеотидных оснований, выбранную из группы, состоящей из последовательности нуклеотидных оснований SEQ ID NO:1, последовательности нуклеотидных оснований SEQ ID NO:2, фрагмента, усиливающего экспрессию, последовательности SEQ ID NO:1, фрагмента, усиливающего экспрессию, последовательности SEQ ID NO:2, последовательности, комплементарной любой последовательности, указанной выше, или их сочетания. Предложенное изобретение позволяет увеличить уровень экспрессии одного или нескольких белков. 8 н. и 26 з.п. ф-лы, 10 ил., 17 табл., 9 пр.

2518340
патент выдан:
опубликован: 10.06.2014
СПОСОБ МУЛЬТИПЛЕКСНОЙ ДЕТЕКЦИИ ПРЕДСТАВИТЕЛЕЙ РОДОВ Aeromonas И Flavobacterium

Изобретение относится к области биотехнологии. Способ мультиплексной детекции представителей родов Aeromonas и Flavobacterium предусматривает постановку ПЦР в один этап с использованием двух пар синтезированных праймеров к участкам гена малой субъединицы рибосомальной РНК (16S rRNA) в режиме реального времени к участку гена малой субъединицы рРНК Aeromonas: А1 - 5'-TTCGGGCCTTGCGCGATTGG-3' и А2 - 5'-CGTGCTGGCAACAAAGGACAG-3', обеспечивающие амплификацию фрагмента размером 920 п.н. с температурой плавления 85,21±0,05°С и к участку гена малой субъединицы рРНК Flavobacterium F1 - 5'-CGATGGATACTAGCTGTTGGG-3' и F2 - 5'-GACGACAACCATGCAGCACC-3',обеспечивающие образование фрагмента размером 242 п.н. с температурой плавления 81,23±0,50°С. При этом используют термоциклеры по программе: предварительная денатурация при температуре 95°С 5 мин, 40 циклов амплификации 95°С - 15 сек, 66°С - 60 сек; анализ результатов детектирования и определения искомых микроорганизмов по наличию или отсутствию специфических пиков амплифицированной ДНК. Способ обеспечивает быстрое, простое, точное выявление представителей родов Aeromonas и Flavobacterium в исследуемом образце. 1 з.п. ф-лы, 3 ил.

2514668
патент выдан:
опубликован: 27.04.2014
СПОСОБ СТАБИЛИЗАЦИИ ТРАНСКРИПЦИИ ХЛОРОПЛАСТНЫХ ГЕНОВ РАПСА В УСЛОВИЯХ ХЛОРИДНОГО ЗАСОЛЕНИЯ

Изобретение относится к области биотехнологии и сельского хозяйства. В способе растения обрабатывают раствором биологически активного вещества, в качестве которого используют 24-эпибрассинолид. При этом через 3 недели культивирования растений рапса на жидкой питательной среде последующие две недели растения подвергают хлоридному засолению 125 мМ с однократным внесением в раствор 24-эпибрассинолида в концентрации 10-8 М в начале засоления. Способ позволяет повысить устойчивость растений рапса к повреждающему действию интенсивного хлоридного засоления и экологическую безопасность производимой продукции. 4 ил., 1 табл., 1 пр.

2514641
патент выдан:
опубликован: 27.04.2014
СПОСОБ ПОЛУЧЕНИЯ НЕПРИРОДНЫХ ИСКУССТВЕННЫХ ОЛИГОНУКЛЕОТИДОВ, ПОТЕНЦИАЛЬНО СПОСОБНЫХ ОБРАЗОВЫВАТЬ НЕСОВЕРШЕННЫЕ G-КВАДРУПЛЕКСЫ

Изобретение относится к области биотехнологии, конкретно к способу получения неприродных искусственных олигонуклеотидов, потенциально способных образовывать стабильные в физиологических и близких к физиологическим условиях неканонические структуры - несовершенные G-квадруплексы (ImGQ), включающие одну нуклеотидную замену в G4 плоскости в G-квадруплексах (GQ). Указанный способ включает использование алгоритма описания нуклеотидных последовательностей в виде определенного набора формул для дальнейшего синтеза выбранных олигонуклеотидов. Изобретение позволяет с помощью биоинформационного анализа получать неприродные искусственные олигонуклеотиды, потенциально способные формировать новую конформацию - несовершенные G-квадруплексы. 4 ил., 2 табл., 2 пр.

2509802
патент выдан:
опубликован: 20.03.2014
ПРОФИЛАКТИЧЕСКАЯ ВАКЦИНА ПРОТИВ ВИЧ, ОСНОВАННАЯ НА ВИЧ-СПЕЦИФИЧЕСКИХ АНТИТЕЛАХ

Настоящее изобретение относится к иммунологии. Предложен способ получения вакцины против ВИЧ-1 с использованием метода обратного панинга на фаг-презентированной библиотеке ВИЧ-1-специфических антител scFv, полученной на основе мРНК В-лимфоцитов больных, инфицированных ВИЧ-1, и обогащенной с помощью панинга на пептидах ВИЧ-1, и индуцируемых систем экспрессии рекомбинантных белков с эукариотическим гликозилированием. Также рассмотрена вакцина против ВИЧ-1 и ее применение для иммунизации неинфицированных людей против заражения и развития ВИЧ-инфекции. Вакцина ВИЧ-1, полученная в соответствии с данным изобретением, обеспечивает возникновение иммунного ответа в организме с образованием ВИЧ-1-специфических антител. 3 н. и 9 з.п. ф-лы, 27 ил., 9 табл., 4 пр.

2505604
патент выдан:
опубликован: 27.01.2014
БЕЛКИ, СВЯЗЫВАЮЩИЕ АНТИГЕН ФАКТОР РОСТА, ПОДОБНЫЙ ГЕПАРИНСВЯЗЫВАЮЩЕМУ ЭПИДЕРМАЛЬНОМУ ФАКТОРУ РОСТА

Изобретение относится к области иммунологии. Предложено антитело, которое специфически связывает гепаринсвязывающий EGF-подобный фактор роста (HB-EGF), и его антигенсвязывающий фрагмент. Рассмотрены молекула нуклеиновой кислоты, экспрессирующий вектор, клетка-хозяин и способ получения антитела или его антигенсвязывающего фрагмента, а также применение антитела или его антигенсвязывающего фрагмента для получения фармацевтической композиции для диагностики, предупреждения или лечения гиперпролиферативного заболевания, способы и наборы для диагностики и для предупреждения или лечения состояния, ассоциированного с экспрессией HB-EGF. Настоящее изобретение может найти дальнейшее применение в терапии заболеваний, опосредованных или связанных с экспрессией HB-EGF. 12 н. и 22 з.п. ф-лы, 43 ил., 28 пр., 12 табл.

2504551
патент выдан:
опубликован: 20.01.2014
СПОСОБ ИДЕНТИФИКАЦИИ АГЕНТА НА ОСНОВЕ ВЫСОКОПРОИЗВОДИТЕЛЬНОГО СКРИНИНГА

Изобретение относится к области биотехнологии и касается способа идентификации агента на основе высокопроизводительного скрининга. Представленный способ включает следующие стадии: подготовку клеток в первом наборе, включающем, по меньшей мере, 96 приемников; добавление агента, по крайней мере, к одному приемнику; инкубирование агента с клетками; лизирование клеток путем добавления буфера, который является гипотоническим или содержит детергент, и содержит ингибитор ДНКазы; удаление РНК из клеточного лизата с помощью РНКазы; центрифугирование первого набора приемников при низкой скорости; перенос супернатанта, содержащего фрагменты ДНК, на второй набор приемников; добавление обнаруживаемого соединения, способного к интеркаляции с фрагментами ДНК, в буфере для детекции, содержащем ингибитор ДНКазы, к, по крайней мере, одному приемнику; измерение количества интеркалированного обнаруживаемого соединения; и сравнение количества интеркалированного обнаруживаемого соединения с контролем для определения разницы, что позволяет идентифицировать указанный агент как модифицирующий агент, если разница превышает заранее установленный предел. Представленное изобретение позволяет обнаружить агенты, которые влияют на образование фрагментов ДНК в клетках, используя высокопроизводительные скрининговые приложения. 9 з.п. ф-лы, 14 ил., 2 табл., 11 пр.

2486247
патент выдан:
опубликован: 27.06.2013
СПОСОБ ВЫДЕЛЕНИЯ ДНК

Изобретение относится к области биохимии. Дезоксирибонуклеиновую кислоту (ДНК) выделяют из биологических объектов на предметах-носителях - марле, бумаге, синтетических тканях. Измельчают биологический объект - костную ткань, роговые ткани. Помещают в пробирку с лизирующим буферным раствором состава 0,1 М Трис-HCl, 0,1 М ЭДТА, 0,1 М NaCl, 0,5% N-лаурилсаркозил Na и протеиназы K, рН 6-7. Получают клеточный лизат и к нему добавляют сорбент магнитных наночастиц оксида железа Fе3О4, модифицированных хитозаном. Смесь перемешивают и инкубируют в течение 25-35 мин. Пробирку помещают на магнитный штатив и разделяют смесь на фракции - сорбент, связанный с ДНК, и надосадочная жидкость. Надосадок удаляют. К осадку приливают элюирующий буферный раствор состава: 10 мМ трис-HCl, рН 7,4; 100 мМ NaCl; 1 мМ ЭДТА и инкубируют. Пробирки помещают на магнитный штатив. Разделяют смесь на фракции - сорбент - осадок и надосадок - ДНК, растворенная в элюирующем буферном растворе. Осадок удаляют. В надосадке остается конечный продукт ДНК. Изобретение позволяет получить ДНК из различных биологических объектов и увеличить выход выделяемой ДНК не менее чем в 1,5 раза. 6 з.п. ф-лы.

2485178
патент выдан:
опубликован: 20.06.2013
СПОСОБ ДИФФЕРЕНЦИАЦИИ ШТАММОВ Helicobacter pylori МЕТОДОМ МУЛЬТИЛОКУСНОГО VNTR-ТИПИРОВАНИЯ

Предлагаемое изобретение относится к области медицинской микробиологии, в частности к молекулярно-генетическому типированию штаммов Helicobacter pylori. Предложен способ дифференциации штаммов H.pylori методом мультилокусного VNTR-типирования, причем при проведении ПЦР используют олигонуклеотидные праймеры на VNTR-содержащие локусы H.pylori - HpA, HpD, HpE и HpF; дифференциацию штаммов H.pylori проводят по числу повторов в амплифицированных фрагментах по каждому VNTR-содержащему локусу H.pylori - HpA, HpD, HpE и HpF, что дает возможность определять генотипы изучаемых штаммов. 1 табл., 3 пр.

2482191
патент выдан:
опубликован: 20.05.2013
СПОСОБ ФЛУОРЕСЦЕНТНОГО МЕЧЕНИЯ кДНК ВИРУСА ГРИППА ТИПА А

Изобретение относится к области молекулярной биологии и вирусологии. Способ предусматривает проведение реакции мультисегментной обратной транскрипции (М-ОТ) вирусной РНК, совмещенной с реакцией амплификации кДНК. Реакции проходят в один этап при помощи одной пары универсальных праймеров, подобранных к высококонсервативным областям, имеющимся во всех вирусных сегментах, в присутствии флуоресцентно меченных нуклеотидов. Матрицей для этой совмещенной реакции служит одноцепочечная РНК вируса гриппа из анализируемых биологических образцов. Качество полученной флуоресцентно меченной кДНК вируса гриппа типа А проверяют методом электрофореза в 1% агарозном геле. Предложенный способ позволяет проводить быстрое получение флуоресцентно меченных амплификатов вирусной кДНК для всех сегментов вирусного генома. Использование данного способа существенно уменьшает время, необходимое для проведения детекциии и субтипирования вируса гриппа А на диагностических биочипах в анализируемых образцах. 2 ил.

2480525
патент выдан:
опубликован: 27.04.2013
СПОСОБ ФОРМИРОВАНИЯ СИСТЕМ МАРКЕРОВ МЕТИЛИРОВАНИЯ ДНК

Изобретение относится к области биотехнологии, а именно к способу формирования систем маркеров метилирования ДНК. Способ включает выделение геномной ДНК, гидролиз метилчувствительным и неметилчувствительным изошизомерами эндонуклеаз рестрикции. Лигируют продукты гидролиза ДНК с универсальными адаптерами из олигонуклеотидов CCGGTCAGAGCTTTGCGAAT и ATTCGCAAAGCTCTGA. Проводят полимеразную цепную реакцию с универсальным флуоресцентно меченым праймером ATTCGCAAAGCTCTGACCGGGN, конъюгированным по 5'-концу с флуоресцентным красителем FAM, с последующим капиллярным электрофорезом, которая приводит к формированию системы маркеров в виде пиков электрофореграммы. Для анализа пиков электрофореграммы используют весь набор маркеров системы в виде полной репрезентации. Предложенное изобретение позволяет повысить воспроизводимость формируемых систем маркеров метилирования ДНК, упростить процедуру характеристики нормальных тканевых метилотипов, сократить время цикла скрининга, обеспечивая высокую производительность метода. 3 ил., 1 пр.

2472859
патент выдан:
опубликован: 20.01.2013
МАЛЫЕ МОЛЕКУЛЫ РНК, ОПОСРЕДУЮЩИЕ ИНТЕРФЕРЕНЦИЮ РНК

Изобретение относится к области молекулярной биологии и биотехнологии и может быть использовано в медицине и в фармацевтической промышленности. Молекула РНК, способная к мишень-специфической интерференции РНК, представляет собой двухцепочечную молекулу РНК размером 23 нуклеотида, имеющую 3'-выступ из 1-5 нуклеотидов. Ее получают объединением двух цепей РНК и используют для получения фармацевтической композиции. При введении в многоклеточный эукариотический организм или в клетку многоклеточного эукариотического организма данная молекула РНК обеспечивает содействие мишень-специфической интерференции РНК и приводит к уменьшению уровня экспрессии гена-мишени или к нокауту гена-мишени. Способ содействия мишень-специфической интерференции РНК с помощью данной молекулы РНК применяют для определения или модуляции функции гена. Клетку, содержащую эндогенную нуклеиновую кислоту-мишень, молекулу РНК, способную к мишень-специфической интерференции РНК, и экзогенную нуклеиновую кислоту-мишень используют в аналитических процедурах. Применение изобретения обеспечивает молчание гена-мишени, опосредованное мишень-специфической интерференцией РНК. 8 н. и 32 з.п. ф-лы, 24 ил., 3 пр.

2470073
патент выдан:
опубликован: 20.12.2012
СПОСОБ ДИАГНОСТИКИ РАКА МОЧЕВОГО ПУЗЫРЯ С ПОМОЩЬЮ ОНКОМАРКЕРА TFDP1 (ВАРИАНТЫ) И НАБОР ДЛЯ ЕГО ОСУЩЕСТВЛЕНИЯ

Сущность изобретения: получение биоматериала и выделение РНК, синтез кДНК на матрице РНК, нормирование концентрации кДНК TFDP1 по контрольному гену, проведение количественной ПЦР-амплификации фрагмента гена TFDP1. Далее определяют количество амплифицированного фрагмента ДНК TFDP1 для образца биоматериала. При концентрации кДНК гена TFDP1 в физиологических жидкостях, превышающей 1,5% концентрации кДНК гена бета-актина АСТВ, диагностируют наличие переходноклеточного рака мочевого пузыря (РМП). Набор для осуществления способа методом ПЦР включает два праймера с определенной последовательностью при молярном соотношении 1:1. Способ-вариант предусматривает проведение диагностики методом ИФА. Получают образцы мочи и крови пациента, выделяют смесь белковых компонентов мочи и крови, проводят ИФА с моноклональными антителами, и/или поликлональными антителами, и/или их фрагментами против рекомбинантного белка TFDP1 и/или его уникальных фрагментов длиной свыше 8 аминокислот. Диагностируют РМП при концентрации белка TFDP1 в исследуемых образцах, превышающей 5-кратную концентрацию белка TFDP1 в контроле. Способ (вариант) позволяет с достоверностью диагностировать рак мочевого пузыря, в том числе на ранней стадии прогрессии опухолевой трансформации. 3 н.п. ф-лы, 4 табл., 3 ил.

2463354
патент выдан:
опубликован: 10.10.2012
УЛУЧШЕННАЯ НАПРАВЛЕННАЯ ЗАМЕНА НУКЛЕОТИДОВ МОДИФИЦИРОВАННЫМИ ОЛИГОНУКЛЕОТИДАМИ LNA

Изобретение относится к области молекулярной биологии и может быть использовано для направленной модификации последовательности дуплексной ДНК (днДНК). Предложен донорный олигонуклеотид, последовательность которого по всей ее длине комплементарна подлежащей изменению последовательности акцепторной ДНК, за исключением одного нуклеотида, формирующего с изменяемой последовательностью днДНК ошибочное спаривание, определяющее характер предполагаемой замены. При этом олигонуклеотид по изобретению содержит два модифицированных нуклеотида, которые представляют собой LNA и располагаются на расстоянии одного нуклеотида по обе стороны от точки ошибочного спаривания. Описан способ эффективного изменения последовательности днДНК с использованием нового олигонуклеотида, раскрыты условия и средства, необходимые для его осуществления. 4 н. и 10 з.п. ф-лы, 3 ил., 1 пр.

2463350
патент выдан:
опубликован: 10.10.2012
СПОСОБ ОБНАРУЖЕНИЯ НЕЙТРОФИЛЬНЫХ ВНЕКЛЕТОЧНЫХ ЛОВУШЕК В МУКОЗАЛЬНЫХ СЕКРЕТАХ

Способ обнаружения нейтрофильных внеклеточных ловушек в мукозальных секретах предусматривает окрашивание 0,1 мл нативного препарата 0,1 мл равнокомпонентной смесью синьки Эванса в концентрации 1:8000 и красителя Sytox Green в концентрации 1:500, инкубацию в течение 5 минут в темноте. С помощью люминесцентной микроскопии с использованием фильтров, обеспечивающих возбуждающий свет с длиной волны не более 490 нм и эмиссию с длиной волны 520 нм, обнаруживают нейтрофильные внеклеточные ловушки, живые бактериальные клетки, апоптозные бактериальные клетки, мертвые бактериальные клетки зеленого цвета. Оценивают число нейтрофильных внеклеточных ловушек (%), содержащих бактерии в 100 подсчитанных ловушках. Способ позволяет визуализировать хроматин, определить жизнеспособность клеток и ускорить проведение исследования. 2 табл., 3 пр.

2463349
патент выдан:
опубликован: 10.10.2012
СОЕДИНЕНИЕ, СОДЕРЖАЩЕЕ КОДИРУЮЩИЙ ОЛИГОНУКЛЕОТИД, СПОСОБ ЕГО ПОЛУЧЕНИЯ, БИБЛИОТЕКА СОЕДИНЕНИЙ, СПОСОБ ЕЕ ПОЛУЧЕНИЯ, СПОСОБ ИДЕНТИФИКАЦИИ СОЕДИНЕНИЯ, СВЯЗЫВАЮЩЕГОСЯ С БИОЛОГИЧЕСКОЙ МИШЕНЬЮ (ВАРИАНТЫ)

Изобретение относится к области биологической химии. Предложен способ синтеза библиотек молекул, содержащих олигонуклеотидную метку. Полученные библиотеки молекул могут быть использованы для идентификации соединений, связывающихся с определенной биологической мишенью. 6 н. и 126 з.п. ф-лы, 13 ил., 6 табл., 10 пр.

2459869
патент выдан:
опубликован: 27.08.2012
СПОСОБ КЛОНИРОВАНИЯ КОГНАТНЫХ АНТИТЕЛ

Изобретение относится к области биотехнологии и молекулярной генетики. Способ относится к процедуре сцепления когнатных пар кодирующих последовательностей VH и VL из популяции клеток, обогащенных специфическими поверхностными антигенными маркерами. Процедура сцепления включает мультиплексную процедуру молекулярной амплификации, способную сцеплять представляющие интерес нуклеотидные последовательности в особой полимеразной цепной реакции (мультиплексной PCR). Этот способ особенно эффективен для создания библиотек когнатных пар, а также комбинаторных библиотек, кодирующих последовательностей вариабельных областей из иммуноглобулинов. 24 з.п. ф-лы, 7 ил., 6 табл., 3 пр.

2459868
патент выдан:
опубликован: 27.08.2012
СПОСОБ ВЫЯВЛЕНИЯ ЭКСПРЕССИРУЮЩИХСЯ ГЕНОВ ПАТОГЕННЫХ БУРКХОЛЬДЕРИЙ МЕТОДОМ ДИФФЕРЕНЦИАЛЬНОГО ДИСПЛЕЯ

Изобретение раскрывает способ выявления экспрессирующихся генетических детерминант патогенных микроорганизмов рода Burkholderia с использованием реакций обратной транскрипции и сопряженной амплификации (ОТ-ПЦР) для их последующего структурно-функционального анализа. Способ включает этапы выращивания бактериальной культуры до ранней логарифмической фазы роста, выделения и очистки РНК методом нуклеосорбции из обработанной мертиолятом натрия бульонной культуры, удаления примесей ДНК обработкой ДНКазой, синтеза кДНК в присутствии ингибитора рибонуклеаз и праймера, специфичного последовательностям сайтов связывания с рибосомой мРНК прокариот, реамплификации кДНК с тем же праймером для накопления и использования ее в качестве матрицы в ген-специфической ПНР, выделения и определения нуклеотидной последовательности ампликонов. Способ позволяет оценить влияние адаптационных изменений клеток при изменении условий внешней среды на выраженность важнейших биологических характеристик микроорганизмов - вирулентность и устойчивость к антимикробным препаратам - с высокой степенью чувствительности при различных условиях внешней среды. 3 ил., 3 пр.

2458140
патент выдан:
опубликован: 10.08.2012
СПОСОБ И НАБОР ДЛЯ ПОЛУЧЕНИЯ ОБРАЗЦА ДЛЯ ПРИМЕНЕНИЯ В АМПЛИФИКАЦИИ НУКЛЕИНОВОЙ КИСЛОТЫ

Изобретение относится к области биотехнологии, а именно к способу получения образца для амплификации нуклеиновой кислоты и к набору для получения образца для амплификации нуклеиновой кислоты. Способ включает стадию экстракции, на которой к биологическому образцу добавляют реагент для экстракции нуклеиновой кислоты с получением экстракта нуклеиновой кислоты. Проводят стадию очистки, на которой экстракт нуклеиновой кислоты взаимодействует с протонированным цеолитом с получением образца нуклеиновой кислоты для амплификации. Цеолит отделяют от образца нуклеиновой кислоты для амплификации. Предложенное изобретение позволяет получить образец нуклеиновой кислоты для амплификации, с которым можно осуществлять высокочувствительную детекцию нуклеиновой кислоты. 2 н. и 9 з.п. ф-лы, 11 ил., 1 табл., 7 пр.

2453600
патент выдан:
опубликован: 20.06.2012
СПОСОБ ПОЛУЧЕНИЯ РЕКОМБИНАНТНОЙ ВАКЦИНЫ

Изобретение относится к области биотехнологии, генной инженерии и иммунологии. Способ получения рекомбинантной вакцины предусматривает создание химерных белков или ДНК, экспрессирующих гены этих химерных белков, состоящих из трех или более функциональных частей. Эти части являются действующим веществом вакцины и представлены антигеном патогенного микроорганизма, лигандом для TLR-рецепторов и лигандами для рецепторов, проводящих сигнал через ITAM-мотив. Химерные белки напрямую используют в качестве вакцины для иммунизации человека и животных. Для вакцин, представляющих собой ДНК, кодирующую химерный белок, в качестве носителя используют рекомбинантные аденовирусные частицы и/или плазмидную ДНК. Изобретение предназначено для вакцинации при проведении профилактических мероприятий по борьбе с инфекционными заболеваниями. 29 ил.

2444570
патент выдан:
опубликован: 10.03.2012
СПОСОБ ОДНОМОМЕНТНОГО ОПРЕДЕЛЕНИЯ ДЛИНЫ ТЕЛОМЕР И КОЛИЧЕСТВА ДЕЛЕНИЙ ПОПУЛЯЦИИ ПРОЛИФЕРИРУЮЩИХ КЛЕТОК IN VITRO

Изобретение относится к области биотехнологии, а именно к способу измерения длины теломер в клетках. Способ включает измерение длины теломер методом flow-FISH в клетках, дифференцированных по количеству совершенных делений с помощью витального красителя без предварительного выделения пролиферирующих клеток, с использованием кросслинкера аминогрупп Bis(sulfosuccinimidyl)suberat (BS3). Предложенное изобретение позволяет одномоментно определять длину теломер в клетках с известным количеством совершенных делений. 3 ил.

2443777
патент выдан:
опубликован: 27.02.2012
СПОСОБ ПОЛУЧЕНИЯ РИБОНУКЛЕИНОВОЙ КИСЛОТЫ

Изобретение относится к медицине, а именно к молекулярной генетике, и может найти применение в диагностике и терапии бактериальных и вирусных инфекций. Предложен способ получения рибонуклеиновой кислоты (РНК). Способ заключается в том, что к 1 части водного раствора, содержащего 1 мг/мл плазмидной ДНК, добавляют 10 частей воды и 1 часть суспензии, содержащей 4 г/мл суперпарамагнитных частиц магнетита. Затем в полученный раствор добавляют 1 часть буферного раствора с рН 7,5, 2 части 0,005 М раствора рибонуклеотидтрифосфатов, 2 части 0,1 М раствора дитиотреитола, 1 часть раствора, содержащего 2 мг/мл бычьего сывороточного альбумина, 1 часть раствора, содержащего 10 единиц ингибитора РНКазы и 1 часть раствора, содержащего 10 единиц РНК-полимеразы бактериофага Т3, или Т7, или SP6. Полученную смесь инкубируют не менее 1 часа при температуре +37°С и помещают в магнитное поле напряженностью не менее 0,2 Тл на 1-3 минуты. После этого декантируют водную фазу, которая содержит искомую РНК. Полученная таким образом РНК обладает высоким качеством и пригодна для молекулярно-биологических исследований структуры и функций генов, а также в медицинской практике для диагностических и терапевтических целей. 1 з.п. ф-лы, 1 ил.

2439156
патент выдан:
опубликован: 10.01.2012
НУКЛЕОТИДНАЯ ПОСЛЕДОВАТЕЛЬНОСТЬ, КОДИРУЮЩАЯ ИММУНОГЕННЫЙ ПОЛИПЕПТИД LcrV(G113), ВЫЗЫВАЮЩИЙ ЗАЩИТНЫЙ ИММУННЫЙ ОТВЕТ ПРОТИВ Yersinia pestis; РЕКОМБИНАНТНАЯ ПЛАЗМИДНАЯ ДНК pETV-I-3455, КОДИРУЮЩАЯ ИММУНОГЕННЫЙ ПОЛИПЕПТИД LcrV(G113); РЕКОМБИНАНТНЫЙ ШТАММ Escherichia coli BL21(DE3)/pETV-I-3455 - ПРОДУЦЕНТ ИММУНОГЕННОГО ПОЛИПЕПТИДА LcrV(G113); ПОЛИПЕПТИД LcrV(G113) И СПОСОБ ЕГО ПОЛУЧЕНИЯ

В изобретении раскрыта нуклеотидная последовательность (фиг.2), кодирующая иммуногенный полипептид LcrV(G113), на основе которой сконструирована рекомбинантная плазмидная ДНК pETV-I-3455, имеющая размер 6538 п.н., кодирующая иммуногенный полипептид LcrV(G113). Плазмида состоит из репликона плазмиды pBR322, гена -лактамазы, определяющего устойчивость к ампициллину, Т7-промотора, 1ас-оператора, fl-репликона и фрагмента ДНК, фланкированного сайтами для рестриктаз Ndel и HindIII, кодирующего синтез белка LcrV(G113), начинающегося с инициирующего кодона ATG. Описан рекомбинантный штамм бактерий Е. coli BL21(DE3)/pETV-I-3455 - продуцент иммуногенного полипептида LcrV(G113) с аминокислотной последовательностью, представленной на фиг.3, где триптофан в позиции 113 (W113) заменен на глицин. Раскрыт способ получения указанного полипептида путем культивирования штамма Е. coli BL21(DE3)/pETV-I-3455. Клетки разрушают в буферном растворе ультразвуком и выделяют полипептид последовательно гель-проникающей хроматографией с использованием носителя TSK HW-40, анионообменной и гидрофобной хроматографией. Изобретение позволяет получить продукт с высокой иммуногенной и протективной активностью. 5 н.п. ф-лы, 8 ил., 2 табл.

2439155
патент выдан:
опубликован: 10.01.2012
АМФИФИЛЬНАЯ ВЫСОКОПОЛИМЕРНАЯ РНК ИЗ ПЕКАРСКИХ ДРОЖЖЕЙ

Изобретение относится к биотехнологии. Описан препарат амфифильной высокополимерной дрожжевой РНК, стимулирующий лейкоцитарную реакцию и первичный гуморальный иммунный ответ. Препарат получен из дрожжей Saccharomyces cerevisiae экстракцией кипящей водой, содержащей оттитрованную NaOH олеиновую кислоту в течение 40 минут при температуре 99-102°С, с добавлением по мере упаривания кипящей воды до 0,3 л и NaOH через 10, 20 и 30 минут после начала экстракции. Предложенный препарат стимулирует лейкоцитарную реакцию и первичный гуморальный иммунный ответ.

2430968
патент выдан:
опубликован: 10.10.2011
Наверх