ПАТЕНТНЫЙ ПОИСК В РФ
НОВЫЕ ПАТЕНТЫ, ЗАЯВКИ НА ПАТЕНТ
БИБЛИОТЕКА ПАТЕНТОВ НА ИЗОБРЕТЕНИЯ

способы лечения висцеральной боли путем введения антител-антагонистов, направленных против пептида, связанного с геном кальцитонина

Классы МПК:A61K39/395 антитела; иммуноглобулины; иммунные сыворотки, например антилимфоцитные сыворотки
C07K16/26 против гормонов
A61P9/08 вазодилататоры для широких показаний
A61P29/00 Анальгетики нецентрального действия, жаропонижающие или противовоспалительные средства, например противоревматические средства; нестероидные противовоспалительные средства (НПВС)
Автор(ы):, , ,
Патентообладатель(и):Лэйбрис Байолоджикс, Инк. (US)
Приоритеты:
подача заявки:
2010-08-23
публикация патента:

Предложенная группа изобретений относится к области медицины. Предложен способ лечения висцеральной боли и/или одного или более чем одного симптома висцеральной боли, включающий введение терапевтически эффективного количества антитела-антагониста против пептида, связанного с геном кальцитонина (CGRP), индивиду, страдающему от висцеральной боли, или индивиду с риском висцеральной боли, где антитело-антагонист против CGRP изготовлено для периферического введения. Предложена также фармацевтическая композиция, содержащая антитело-антагонист против CGRP и фармацевтически приемлемый носитель, изготовленная для периферического введения. Предложенная группа изобретений обеспечивает эффективное лечение висцеральной боли без использования опиатов. 2 н. и 16 з.п. ф-лы, 3 ил., 2 табл., 3 пр.

Рисунки к патенту РФ 2535074

способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Изобретение относится к способу лечения и/или предотвращения висцеральной боли и/или симптомов висцеральной боли с использованием антитела против CGRP и к антителу против CGRP для использования в предотвращении и/или лечении висцеральной боли и/или симптомов висцеральной боли.

ПРЕДШЕСТВУЮЩИЙ УРОВЕНЬ ТЕХНИКИ

Висцеральная боль является ведущей причиной визитов пациентов в клинику, тем не менее, эффективное лечение висцеральной боли ограничено. Клинически лечение висцеральной боли затруднительно и часто требует использования опиатоз. Несмотря на их широкое применение, тяжелые дозолимитирующие нежелательные эффекты опиатов часто приводят к снижению их эффективности. Кроме того, опиаты связаны с риском злоупотребления и физической зависимости и приводят к запору и другим нежелательным побочным эффектам, что во многих случаях противопоказано и снижает качество жизни.

Висцеральная боль связана с внутренними органами, включающими внутренние органы организма. Эти органы включают, например, сердце, легкие, репродуктивные органы, мочевой пузырь, мочеточники, органы пищеварительной системы, печень, поджелудочную железу, селезенку и почки. Висцеральная боль может возникать при множестве состояний, таких как, например, панкреатит, роды, хирургические вмешательства на органах брюшной полости, связанные с кишечной непроходимостью, цистит, менструация или дисменорея. Сходным образом, висцеральной болью можно считать почечную боль, эпигастральную боль, плевральную боль и болезненные желчные колики, боль при аппендиците. Загрудинные боль или давление, обусловленные ранним инфарктом миокарда, также являются висцеральными. К висцеральной боли могут приводить заболевания желудка, двенадцатиперстной кишки или толстой кишки. Распространенные расстройства желудочно-кишечного тракта (ЖКТ), приводящие к висцеральной боли, включают функциональное расстройство кишечника (ФРК) и воспалительное заболевание кишечника (ВЗК). Эти расстройства ЖКТ включают широкий спектр болезненных состояний, эффективность лечения которых в настоящее время ограничена, включающих, относительно ФРК, гастроэзофагеальный рефлюкс, диспепсию, синдром раздраженного кишечника (СРК) и синдром функциональной абдоминальной боли (СФАБ), и, относительно ВЗК, болезнь Крона, илеит и неспецифический язвенный колит, каждое из которых регулярно приводит к висцеральной боли.

СРК поражает 10-20% взрослых и подростков во всем мире (Longstreth et al., 2006, Gastroenterology 130(5):1480-91). Основной причиной обращения этих пациентов к врачу является хроническая висцеральная боль, обусловленная, как полагают, повышенной висцеральной чувствительностью (Aziz, 2006, Gastroenterology 131(2):661-4). Показано, что у пациентов с СРК снижен порог висцеральной чувствительности к растяжению толстой и прямой кишки, и это сильно коррелирует с симптомами висцеральной боли (Delafoy et al, 2006, Gut 55(7):940-5). Колит, индуцированный у крыс растяжением толстой и прямой кишки после введения тринитробензолсульфокислоты (TNBS), представляет собой животную модель, используемую многими исследователями для изучения механизмов висцеральной гиперчувствительности (Gay et al, 2006, Neuroimmunomodulation 23;13(2):114-121; Delafoy et al, 2006; Adam et al., 2006, Pain 123(1-2):179-86).

Интерстициальный цистит (ИЦ) представляет собой синдром боли в мочевом пузыре, клиническими признаками которого являются неотложные позывы к мочеиспусканию, частое мочеиспускание и хроническая тазовая боль. Клинические исследования показывают, что в это вовлечена гиперчувствительность висцеральных сенсорных афферентных нервов, при которой ощущение наполнения мочевого пузыря возникает при меньших, чем в норме, объемах, и восприятие наполнения мочевого пузыря становится болезненным. У пациентов с ИЦ показаны увеличение количества нервных окончаний в подслизистом слое мочевого пузыря и признаки нейрогенного воспаления. Гистопатология ИЦ позволяет предполагать вовлечение в патологический процесс висцеральных афферентных нервов.

Висцеральная боль может возникать в ответ на, например, воспаление, растяжение или повышенное давление. Она не всегда вызвана повреждением внутренних органов. Кроме того, висцеральная боль является диффузной, может иррадиировать в другие области и может быть связана с другими вегетативными и двигательными рефлексами (например, тошнотой, напряжением мышц поясницы при почечной колике) (Lancet 1999, 353, 2145-48).

CGRP (пептид, связанный с геном кальцитонина) представляет собой нейропептид из 37 аминокислот, принадлежащий к семейству пептидов, включающему кальцитонин, адреномедуллин и амилин. У людей существуют две формы CGRP (способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP и способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP), обладающие сходными активностями. Они отличаются тремя аминокислотами и по-разному распределены. Отличия активностей могут также быть обусловлены по меньшей мере двумя подтипами рецепторов CGRP. CGRP является нейромедиатором в центральной нервной системе, и показано, что он действует как сильный вазодилататор на периферии, где нейрональные процессы, включающие CGRP, тесно связаны с кровеносными сосудами. CGRP-опосредованная вазодилатация также связана с нейрогенным воспалением в качестве части цепи событий, приводящих к выходу плазмы из сосудов и расширению микрососудов и происходящих при мигрени.

Показано, что спинальное введение селективных антагонистов CGRP, имеющих небольшие молекулы, полезно при лечении состояний с невропатической и ноцицептивной болью (Adwanikar et al, Pain, 2007, 132(1-2):53-66), позволяя предположить, что устранение сигнализации, связанной с эндогенным CGRP, в спинном мозге оказывает антиноцицептивный эффект. В сообщениях установлено, что блокада CGRP-сигнализации эффективна при устранении висцеральной гиперчувствительности (VH) путем системного введения CGRP 8-37, антагониста рецепторов CGRP (Delafoy et al., 2006; Plourde et al., 1997, Am J Physiol. 273(1 Pt 1):G191-6; Julia and Bueno, 1997, Am J Physiol. 272(1 Pt 1):G141-6). Однако CGRP 8-37 имеет очень короткий период полувыведения in vivo и по этой причине неприменим в качестве лекарственного средства. Таким образом, существует насущная медицинская необходимость в установлении новых лекарственных средств для лечения и предотвращения висцеральной боли.

В данной заявке присутствуют ссылки на различные публикации (включая патенты и заявки на патенты). Содержание этих публикаций полностью включено сюда посредством ссылки.

КРАТКОЕ ИЗЛОЖЕНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

Согласно настоящему изобретению предложен способ предотвращения и/или лечения висцеральной боли и/или симптомов висцеральной боли у индивида, включающий введение терапевтически эффективного количества антитела-антагониста против CGRP индивиду, страдающему от висцеральной боли, или индивиду с риском висцеральной боли.

В некоторых воплощениях антитело-антагонист против CGRP вводят периферически. В других воплощениях антитело-антагонист против CGRP вводят перорально, сублингвально, ингаляцией, трансдермально, подкожно, внутривенно, внутриартериально, интраартикулярно, периартикулярно, местно и/или внутримышечно.

В некоторых воплощениях висцеральная боль связана с функциональным расстройством кишечника (ФРК). ФРК может представлять собой гастроэзофагеальный рефлюкс, диспепсию, синдром раздраженного кишечника (СРК) и синдром функциональной абдоминальной боли (СФАБ). В некоторых воплощениях висцеральная боль связана с воспалительным заболеванием кишечника (ВЗК). ВЗК может представлять собой болезнь Крона, илеит или неспецифический язвенный колит. В некоторых воплощениях висцеральная боль связана с почечной коликой, дисменореей, циститом, менструацией, родами, менопаузой, простатитом или панкреатитом. В некоторых воплощениях висцеральная боль связана с интерстициальным циститом (ИЦ).

В некоторых воплощениях антитело-антагонист против CGRP связывается с CGRP; блокирует связывание CGRP с его рецептором; блокирует или ослабляет активацию рецепторов CGRP; ингибирует, блокирует, подавляет или снижает биологическую активность CGRP; усиливает клиренс CGRP и/или ингибирует синтез, образование или высвобождение CGRP.

В некоторых воплощениях антитело-антагонист против CGRP представляет собой человеческое антитело или гуманизированное антитело. В некоторых воплощениях антитело-антагонист против CGRP представляет собой моноклональное антитело. В некоторых воплощениях антитело-антагонист против CGRP может связываться с CGRP с КD 50 нМ или менее (как измерено поверхностным плазменным резонансом при 37°С) и/или имеет период полувыведения in vivo по меньшей мере 7 суток.

В некоторых воплощениях антитело-антагонист против CGRP специфично связывается с С-концевой областью CGRP. В некоторых воплощениях антитело-антагонист против CGRP специфично распознает эпитоп, определенный последовательностью GSKAF (SEQ ID NO:39). В некоторых воплощениях антитело-антагонист против CGRP содержит вариабельный домен тяжелой цепи (VH ), аминокислотная последовательность которого по меньшей мере на 90% идентична SEQ ID N0:1 или 19.

В некоторых воплощениях антитело-антагонист против CGRP содержит вариабельный домен легкой цепи (VL), аминокислотная последовательность которого по меньшей мере на 90% идентична SEQ ID NO:2 или 20. В некоторых воплощениях антитело-антагонист против CGRP дополнительно содержит домен VH, аминокислотная последовательность которого по меньшей мере на 90% идентична SEQ ID NO:1 или 19. В других воплощениях антитело против CGRP содержит по меньшей мере один гипервариабельный участок (CDR), выбранный из группы, состоящей из: (а) гипервариабельного участка 1 тяжелой цепи (CDR H1), как изложено в SEQ ID NO:3, 21, 33, 34, 36 или 37; (6) гипервариабельного участка 2 тяжелой цепи (CDR H2), как изложено в SEQ ID NO:4, 22, 35 или 38; (в) гипервариабельного участка 3 тяжелой цепи (CDR Н3), как изложено в SEQ ID NO:5 или 23; (г) гипервариабельного участка 1 легкой цепи (CDR L1), как изложено в SEQ ID NO:6 или 24; (д) гипервариабельного участка 2 легкой цепи (CDR L2), как изложено в SEQ ID NO:7 или 25; и (е) гипервариабельного участка 3 легкой цепи (CDR L3), как изложено в SEQ ID NO:8 или 26; и (ж) вариантов L1, L2 и H2.

В некоторых воплощениях антитело против CGRP содержит полноразмерную аминокислотную последовательность тяжелой цепи антитела G1, показанную в SEQ ID NO:11, с С-концевым лизином или без него. В некоторых воплощениях антитело против CGRP содержит полноразмерную аминокислотную последовательность легкой цепи антитела G1, показанную в SEQ ID NO:12. В некоторых воплощениях антитело против CGRP содержит полноразмерную аминокислотную последовательность тяжелой цепи антитела G1, показанную в SEQ ID NO:11, с С-концевым лизином или без него; и полноразмерную аминокислотную последовательность легкой цепи антитела G1, показанную в SEQ ID NO:12.

В некоторых воплощениях антитело против CGRP содержит полноразмерную аминокислотную последовательность тяжелой цепи антитела G2, показанную в SEQ ID NO:29, с С-концевым лизином или без него. В некоторых воплощениях антитело против CGRP содержит полноразмерную аминокислотную последовательность легкой цепи антитела G2, показанную в SEQ ID NO:30. В некоторых воплощениях антитело против CGRP содержит полноразмерную аминокислотную последовательность тяжелой цепи антитела G2, показанную в SEQ ID NO:29; и полноразмерную аминокислотную последовательность легкой цепи антитела G2, показанную в SEQ ID NO:30.

В некоторых воплощениях антитело-антагонист против CGRP содержит домен VH, аминокислотная последовательность которого по меньшей мере на 90% идентична SEQ ID NO:1, и домен VL , аминокислотная последовательность которого по меньшей мере на 90% идентична SEQ ID NO:2. В некоторых воплощениях антитело-антагонист против CGRP содержит тяжелую цепь, полученную с использованием вектора экспрессии с регистрационным номером в Американской коллекции типовых культур (АТСС) РТА-6867. В некоторых воплощениях антитело-антагонист против CGRP содержит легкую цепь, полученную с использованием вектора экспрессии с регистрационным номером в АТСС РТА-6866. В некоторых воплощениях антитело-антагонист против CGRP получено с использованием векторов экспрессии с регистрационными номерами в АТСС РТА-6867 и РТА-6866.

В некоторых воплощениях антитело-антагонист против CGRP вводят подкожной или внутривенной инъекцией один, два, три или четыре раза в месяц. В некоторых воплощениях антитело-антагонист против CGRP вводят в концентрации 5-100 мг/мл. В некоторых воплощениях антитело-антагонист против CGRP вводят в концентрации 1-100 мг/кг массы тела/

В некоторых воплощениях антитело-антагонист против CGRP не приводит к связанному с центральной нервной системой (ЦНС) расстройству координации движений или внимания. В некоторых воплощениях антитело-антагонист против CGRP не вводят центрально, спинально или интратекально. В некоторых воплощениях антитело-антагонист против CGRP не является центрально, спинально или интратекально проникающей молекулой.

В некоторых воплощениях антитело-антагонист против CGRP вводят раздельно, последовательно или одновременно в комбинации с одним или более чем одним дополнительным фармакологически активным соединением. В некоторых воплощениях одно или более чем одно дополнительное фармакологически активное соединение выбрано из: опиоидного анальгетика, например морфина, героина, гидроморфона, оксиморфона, леворфанола, леваллорфана, метадона, меперидина, фентанила, кокаина, кодеина, дигидрокодеина, оксикодона, гидрокодона, пропоксифена, налмефена, налорфина, налоксона, налтрексона, бупренорфина, буторфанола, налбуфина или пентазоцина; нестероидного противовоспалительного лекарственного средства (НПВС), например аспирина, диклофенака, дифлунизала, этодолака, фенбуфена, фенопрофена, флуфенизала, флурбипрофена, ибупрофена, индометацина, кетопрофена, кеторолака, меклофенамовой кислоты, мефенамовой кислоты, набуметона, напроксена, оксапрозина, фенилбутазона, пироксикама, сулиндака, толметина или зомепирака либо их фармацевтически приемлемой соли; барбитуратного седативного средства, например амобарбитала, апробарбитала, бутабарбитала, бутабитала, мефобарбитала, метарбитала, метогекситала, пентобарбитала, фенобарбитала, секобарбитала, талбутала, тиамилала или тиопентала либо их фармацевтически приемлемой соли; бензодиазепина, обладающего седативным действием, например хлордиазепоксида, клоразепата, диазепама, флуразепама, лоразепама, оксазепама, темазепама или триазолама либо их фармацевтически приемлемой соли; Н1-антагониста, обладающего седативным действием, например дифенгидрамина, пириламина, прометазина, хлорфенирамина или хлорциклизина либо их фармацевтически приемлемой соли; седативного средства, такого как глутетимид, мепробамат, метэквалон или дихлоралфеназон или их фармацевтически приемлемая соль; средства, расслабляющего скелетные мышцы, например баклофена, карисопродола, хлорзоксазона, циклобензаприна, метокарбамола или орфренадина либо их фармацевтически приемлемой соли; антагониста рецепторов N-метил-D-аспартата (NMDA), например декстрометорфана ((+)-3-гидрокси-N-метилморфинана) или его метаболита декстрорфана ((+)-3-гидрокси-N-метилморфинана), кетамина, мемантина, пирролохинолинхинона или цис-4-(фосфонометил)-2-пиперидинкарбоновой кислоты либо их фармацевтически приемлемой соли; альфа-адренергического средства, например доксазозина, тамсулозина, клонидина или 4-амино-6,7-диметокси-2-(5-метансульфонамидо-1,2,3,4-тетрагидроизохинол-2-ил)-5-(2-пиридил)-хиназолина; трициклического антидепрессанта, например дезипрамина, имипрамина, амитриптилина или нортриптилина; противосудорожного средства, например карбамазепина или вальпроага; антагониста тахикинина (NK), в частности антагониста NK-3, NK-2 или NK-1, например (способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 R,9R)-7-[3,5-бис(трифторметил)бензил]-8,9,10,11-тетрагидро-9-метил-5-(4-метилфенил)-7Н-[1,4]диазоцино[2,1 -g][1,7]нафтиридин-6-13-диона (ТАК-637), 5-[[(2R,3S)-2-[(1R)-1-[3,5-бис(трифгорметил)фенил]этокси-3-(4-фторфенил)-4-морфолинил]метил]-1,2-дигидро-3Н-1,2,4-триазол-3-она (МК-869), ланепитанта, дапитанта или 3-[[2-метокси-5-(трифторметокси)фенил]метиламино]-2-фенилпиперидина (2S,3S); антагониста мускариновых рецепторов, например оксибутина, толтеродина, пропиверина, хлорида тропсия или дарифенацина, ингибитора циклооксигеназы-2 (ЦОГ-2), например целекоксиба, рофекоксиба или вальдекоксиба; неселективного ингибитора ЦОГ (предпочтительно с защитным действием на ЖКТ), например нитрофлурбипрофена (НСТ-1026); анальгетика, являющегося производным анилина, в частности парацетамола; нейролептика, такого как дроперидол; агониста (например, резинфератоксина) или антагониста (например, капсазепина) ваниллоидных рецепторов; бета-адренергического средства, такого как пропранолол; местного анестетика, такого как мексилетин; кортикостероида, такого как дексаметазон; агониста или антагониста серотониновых рецепторов; холинергического (никотинового) анальгетика; Tramadol®; ингибитора фосфодиэстеразы-5 (ФДЭ-5), такого как силденафил, варденафил или таладафил; альфа-2-дельта-лиганда, такого как габапентин или прегабалин; и каннабиноида.

Согласно настоящему изобретению также предложено применение антитела-антагониста против CGRP для изготовления лекарственного средства для предотвращения и/или лечения висцеральной боли и/или симптомов висцеральной боли. В некоторых воплощениях лекарственное средство изготовлено для периферического введения. В некоторых воплощениях антитело-антагонист против CGRP оказывает при введении периферическое действие.

Согласно настоящему изобретению также предложена фармацевтическая композиция для лечения и/или предотвращения висцеральной боли и/или симптомов висцеральной боли у индивида, содержащая антитело-антагонист против CGRP и фармацевтически приемлемый носитель. В некоторых воплощениях композиция изготовлена для периферического введения.

Согласно настоящему изобретению также предложен набор, включающий фармацевтическую композицию для лечения и/или предотвращения висцеральной боли и/или симптомов висцеральной боли у индивида и инструкции для периферического введения терапевтически эффективного количества указанной фармацевтической композиции индивиду для лечения и/или предотвращения висцеральной боли и/или симптомов висцеральной боли.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

На Фиг.1А и 1Б показана модель висцеральной боли. (А) Антитело 4901 («4901») или контроль PBS («наполнитель») внутривенно вводили животным, получившим инъекции тринитробензолсульфокислоты (TNBS) после лапаротомии. Висцеральный болевой порог у животных исследовали с использованием баллонного растяжения. Болевой порог указан в мм рт. ст. (ось y). «Симуляция» означает, что после лапаротомии вместо TNBS животным вводили контрольный раствор (30% этанол). (Б) Антагонист рецепторов CGRP CGRP 8-37 или контроль PBS («наполнитель») внутривенно вводили животным, получившим TNBS после лапаротомии. Как в (А), висцеральный болевой порог у животных исследовали с использованием баллонного растяжения, и болевой порог указан в мм рт. ст. (ось y).

На Фиг. 2 показана модель висцеральной боли. Животным внутривенно вводили антитело 4901 («4901») или контроль PBS («наполнитель»). Моторику мочевого пузыря, измеряемую как число сокращений (ось у), определяли через 1 ч, 3 ч и 5 ч после индуцированного терпентином воспаления мочевого пузыря.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Согласно изобретению, раскрытому здесь, предложены способы лечения и/или предотвращения висцеральной боли у индивида путем введения индивиду терапевтически эффективного количества антитела-антагониста против CGRP.

Согласно изобретению, раскрытому здесь, также предложены антитела-антагонисты против CGRP и полипептиды, имеющие происхождение из G1 или его вариантов, показанных в Таблице 6 WO 2007/054809, полностью включенной сюда посредством ссылки. Согласно изобретению также предложены способы изготовления и применения этих антител и полипептидов.

Общие методики

При практическом использовании настоящего изобретения будут применять, если не указано иное, обычные методики молекулярной биологии (включая рекомбинантные методики), микробиологии, клеточной биологии, биохимии и иммунологии, входящие в компетенцию специалистов в данной области техники. Такие методики подробно описаны в литературе, такой как Molecular Cloning: A Laboratory Manual, second edition (Sambrook et ai., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (M.J.Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (J.E.Cellis, ed., 1998) Academic Press; Animal Cell Culture (R.I.Freshney, ed., 1987); Introduction to Cell and Tissue Culture (J.P.Mather and P.E.Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A.Doyle, J.B.Griffiths, and D.G.Newell, eds., 1993-1998) J.Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (D.M.Weir and C.C.Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (J.M.Miller and M.P.Calos, eds., 1987); Current Protocols in Molecular Biology (F.M. Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction, (Mullis et al., eds., 1994); Current Protocols in Immunology (J.E.Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (C.A.Janeway and P.Travers, 1997); Antibodies (P.Finch, 1997); Antibodies: a practical approach (D.Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P.Shepherd and C.Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E.Harlow and D.Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M.Zanetti and J.D.Capra, eds., Harwood Academic Publishers, 1995).

Определения

«Антитело» представляет собой молекулу иммуноглобулина, способную специфично связываться с мишенью, такой как углевод, полинуклеотид, липид, полипептид и так далее, через по меньшей мере один сайт распознавания антигена, расположенный в вариабельной области молекулы иммуноглобулина. При использовании здесь этот термин включает не только интактные поликлональные или моноклональные антитела, но также их фрагменты (такие как Fab, Fab', F(ab')2, Fv), одноцепочечные фрагменты (ScFv), их мутантные варианты, слитые белки, содержащие часть антитела (такую как однодоменные антитела)? и любую другую модифицированную форму молекулы иммуноглобулина, содержащую сайт распознавания антигена. Антитело включает антитело любого класса, такого как IgG, IgA или IgM (или их подклассы), и нет необходимости в том, чтобы антитело представляло собой антитело какого-либо определенного класса. В зависимости от аминокислотной последовательности константного домена тяжелых цепей иммуноглобулины могут быть отнесены к различным классам. Существует пять основных классов иммуноглобулинов: IgA, IgD, IgE, IgG и IgM, и некоторые из них могут быть разделены далее на подклассы (изотипы), например IgG1, IgG2, IgG3, IgG4, IgA1 и IgA2. Константные домены тяжелых цепей, соответствующие различным классам иммуноглобулинов, называют альфа, дельта, эпсилон, гамма и мю, соответственно. Структуры субъединиц и трехмерные конфигурации различных классов иммуноглобулинов хорошо известны.

При использовании здесь «моноклональное антитело» относится к антителу, полученному из совокупности по существу однородных антител, то есть отдельные антитела, составляющие совокупность, идентичны, за исключением возможных естественных мутаций, которые могут присутствовать в небольших количествах. Моноклональные антитела высокоспецифичны и направлены против одного антигенного сайта. Кроме того, в отличие от препаратов поликлональных антител, которые обычно включают различные антитела, направленные против различных детерминант (эпитопов), каждое моноклональное антитело направлено против одной детерминанты на антигене. Модификатор «моноклональный» указывает на то, что антитело было получено из по существу однородной совокупности антител, и его не следует толковать как требующего получения антитела каким-либо определенным способом. Например, моноклональные антитела для использования в настоящем изобретении могут быть получены гибридомным способом, впервые описанным Kohler and Milstein, 1975, Nature, 256:495, или могут быть получены способами рекомбинантных ДНК, такими как описанные в патенте США № 4816567. Например, моноклональные антитела могут также быть выделены из фаговых библиотек, полученных с применением методик, описанных в McCafferty et al., 1990, Nature, 348:552-554.

При использовании здесь «гуманизированные» антитела относятся к формам антител от источника, не являющегося человеком (например, мыши), которые представляют собой определенные химерные иммуноглобулины, цепи иммуноглобулинов или их фрагменты (такие как Fv, Fab, Fab', F(ab')2 или другие антиген-связывающие подпоследовательности антител), содержащие минимальную последовательность, имеющую происхождение из иммуноглобулина от источника, не являющегося человеком. Большей частью гуманизированные антитела представляют собой человеческие иммуноглобулины (антитела-реципиенты), в которых остатки гипервариабельного участка (CDR) реципиента заменены остатками CDR вида, не являющегося человеком (антитела-донора), такого как мышь, крыса или кролик, имеющего желаемую специфичность, аффинность и биологическую активность. В некоторых случаях остатки каркасной области (FR) человеческого иммуноглобулина заменены соответствующими остатками от источника, не являющегося человеком. Кроме того, гуманизированное антитело может содержать остатки, не входящие ни в антитело-реципиент, ни во вносимые последовательности CDR или каркасных областей, но включенные для дополнительного улучшения и оптимизации свойств антитела. В целом, гуманизированное антитело будет содержать по существу все из по меньшей мере одного и обычно двух вариабельных доменов (например, вариабельного домена тяжелой цепи и вариабельного домена легкой цепи), где все или по существу все CDR-участки соответствуют CDR-участкам иммуноглобулина от источника, не являющегося человеком, и все или по существу все FR-области представляют собой FR-области консенсусной последовательности человеческого иммуноглобулина. В оптимальном случае гуманизированное антитело также будет содержать по меньшей мере часть константной области или домена иммуноглобулина (Fc), обычно константной области или домена человеческого иммуноглобулина. Антитела могут иметь Fc-области, модифицированные, как описано в WO 99/58572. Другие формы гуманизированных антител имеют один или более чем один CDR (один, два, три, четыре, пять, шесть), измененные относительно исходного антитела, которые также называют одним или более чем одним CDR, «имеющим происхождение» из одного или более чем одного CDR исходного антитела.

При использовании здесь «человеческое антитело» означает антитело, имеющее аминокислотную последовательность, соответствующую аминокислотной последовательности антитела, образованного у человека и/или полученного с применением любой из методик получения человеческих антител, известных в данной области техники или раскрытых здесь. Это определение человеческого антитела включает антитела, содержащие по меньшей мере один полипептид человеческой тяжелой цепи или по меньшей мере один полипептид человеческой легкой цепи. Одним таким примером является антитело, содержащее полипептиды мышиной легкой цепи и человеческой тяжелой цепи. Человеческие антитела могут быть получены с применением множества методик, известных в данной области техники. В одном воплощении человеческое антитело выбрано из фаговой библиотеки, экспрессирующей человеческие антитела (Vaughan et al., 1996, Nature Biotechnology, 14:309-314; Sheets et al., 1998, PNAS, (USA) 95:6157-6162; Hoogenboom and Winter, 1991, J. Mol. Biol., 227:381; Marks et ai,, 1991, J. Mol. Biol., 222:581). Человеческие антитела могут также быть получены путем введения локусов человеческих иммуноглобулинов в трансгенных животных, например мышей, у которых собственные гены иммуноглобулинов были частично или полностью инактивированы. Этот способ описан в патентах США № 5545807; 5545806; 5569825; 5625126; 5633425 и 5661016. Альтернативно, человеческое антитело может быть получено иммортализацией человеческих В-лимфоцитов, продуцирующих антитело, направленное против антигена-мишени (такие В-лимфоциты могут быть получены от индивида или могут быть иммунизированы in vitro). См., например, Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R, Liss, p. 77, 1985; Boerner et al., 1991, J. Immunol., 147 (1):86-95; и патент США № 5750373.

При использовании здесь термин «пептид, связанный с геном кальцитонина» и «CGRP» относятся к любой форме пептида, связанного с геном кальцитонина, и его вариантам, сохраняющим, по меньшей мере частично, активность CGRP. Например, CGRP может представлять собой способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP или способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP. При использовании здесь CGRP включает нативную последовательность CGRP всех видов млекопитающих, например человека, собаки, кошки, лошади и коровы.

При использовании здесь «антитело-антагонист против CGRP» (взаимозаменяемо называемое «антителом против CGRP») относится к антителу, способному связываться с CGRP и ингибировать биологическую активность CGRP и/или последующий(ие) метаболический(ие) путь (пути), опосредованный(ые) CGRP-сигнализацией. Антитело-антагонист против CGRP включает антитела, блокирующие, антагонизирующие, подавляющие или снижающие (включая значительное снижение) биологическую активность CGRP, включая последующие метаболические пути, опосредованные CGRP-сигнализацией, такой как связывание с рецепторами и/или индукция клеточного ответа на CGRP. В целях настоящего изобретения однозначно подразумевают, что термин «антитело-антагонист против CGRP» охватывает все вышеуказанные термины, названия и функциональные состояния и свойства, по существу устраняющие, снижающие или нейтрализующие CGRP самого по себе, биологическую активность CGRP (включая, без ограничения, его способность опосредовать любой аспект висцеральной боли) или последствия его биологической активности в любой значимой степени. В некоторых воплощениях антитело-антагонист против CGRP связывается с CGRP и предотвращает связывание CGRP с рецептором CGRP. В других воплощениях антитело против CGRP связывается с CGRP и предотвращает активацию рецептора CGRP. Здесь приведены примеры антител-антагонистов против CGRP.

При использовании здесь термины «G1» и «антитело G1» использованы взаимозаменяемо для обозначения антитела, полученного с использованием векторов экспрессии, имеющих депозитарные номера АТСС-РТА-6867 и АТСС-РТА-6866. Аминокислотные последовательности вариабельных областей тяжелой цепи и легкой цепи показаны в SEQ ID NO:1 и 2. CDR-участки антитела G1 (включая CDR по Chothia и Kabat) схематично показаны на Фиг.5 WO 2007/054809, содержание которой полностью включено сюда посредством ссылки. Полинуклеотиды, кодирующие вариабельные области тяжелой и легкой цепи, показаны в SEQ ID NO:9 и 10. Свойства антитела G1 описаны в Примерах WO 2007/054809.

При использовании здесь термины «G2» и «антитело G2» использованы взаимозаменяемо для обозначения мышиного моноклонального антитела против крысиного CGRP, как описано в Wong НС et al. Hybridoma 12:93-106, 1993. Аминокислотные последовательности вариабельных областей тяжелой цепи и легкой цепи показаны в SEQ ID NO:19 и 20. Полинуклеотиды, кодирующие вариабельные области тяжелой и легкой цепи, показаны в SEQ ID NO:27 и 28. CDR-участки антитела G2 приведены в SEQ ID NO:21-26.

Термины «полипептид», «олигопептид», «пептид» и «белок» использованы здесь взаимозаменяемо для обозначения цепей аминокислот любой длины, предпочтительно относительно коротких (например, 10-100 аминокислот). Цепь может быть линейной или разветвленной, она может содержать модифицированные аминокислоты и/или может быть прервана компонентами, не являющимися аминокислотами. Термины также охватывают цепь аминокислот, модифицированную естественным образом или в результате вмешательства; например, образованием дисульфидных связей, гликозилированием, липидизацией, ацетилированием, фосфорилированием или любой другой манипуляцией или модификацией, такой как конъюгация с компонентом-меткой. Определение также включает, например, полипептиды, содержащие один или более чем один аналог аминокислот (включая, например, искусственные аминокислоты и так далее), а также другие модификации, известные в данной области техники. Подразумевают, что полипептиды могут иметь форму отдельных цепей или связанных цепей.

Как известно в данной области техники, «полинуклеотид» или «нуклеиновая кислота», как они взаимозаменяемо использованы здесь, относятся к цепям нуклеотидов любой длины и включают ДНК и РНК. Нуклеотиды могут представлять собой дезоксирибонуклеотиды, рибонуклеотиды, модифицированные нуклеотиды или основания и/или их аналоги или любой субстрат, который может быть включен в цепь ДНК- или РНК-полимеразой. Полинуклеотид может содержать модифицированные нуклеотиды, такие как метилированные нуклеотиды и их аналоги. В случае присутствия модифицированных нуклеотидов модификация структуры нуклеотидов может быть проведена до или после сборки цепи. Последовательность нуклеотидов может быть прервана компонентами, не являющимися нуклеотидами. Полинуклеотид может быть дополнительно модифицирован после полимеризации, как, например, конъюгацией с компонентом-меткой. Другие типы модификаций включают, например, «копирование», замещение одного или более чем одного встречающегося в природе нуклеотида аналогом, межнуклеотидные модификации, такие как, например, модификации с незаряженными связями (например, метилфосфонаты, фосфотриэфиры, фосфоамидаты, карбаматы и так далее) и с заряженными связями (например, фосфоротиоаты, фосфородитиоаты и так далее), модификации, включающие боковые группировки, такие как, например, белки (например, нуклеазы, токсины, антитела, сигнальные пептиды, поли-L-лизин и так далее), модификации с интеркаляторами (например, акридином, псораленом и так далее), модификации, включающие хелаторы (например, металлы, радиоактивные металлы, бор, окислительные металлы и так далее), модификации, включающие алкилирующие агенты, модификации с модифицированными связями (например, альфа-аномерные нуклеиновые кислоты и так далее), а также немодифицированные формы полинуклеотида (полинуклеотидов). Кроме того, любая из гидроксильных групп, обычно присутствующих в сахарах, может быть заменена, например, фосфонатными группами, фосфатными группами, защищена стандартными защитными группами или активирована для образования дополнительных связей с дополнительными нуклеотидами или может быть конъюгирована с твердыми подложками. 5'- и 3'-концевые ОН-группы могут быть фосфорилированы или замещены аминами или органическими кэпирующими группировками из 1-20 атомов углерода. Другие гидроксильные группы могут также быть дериватизированы с использованием стандартных защитных групп. Полинуклеотиды могут также содержать аналоги рибозы или дезоксирибозы, в целом известные в данной области техники, включая, например, 2'-O-метил-, 2'-O-аллил-, 2'-фтор- или 2'-азидорибозу, карбоциклические аналоги сахаров, альфа- или бета-аномерные сахара, эпимерные сахара, такие как арабиноза, ксилозы или ликсозы, пиранозные сахара, фуранозные сахара, седогептулозы, ациклические аналоги и аналоги нуклеозидов без оснований, такие как метилрибозид. Одна или более чем одна фосфодиэфирная связь может быть заменена альтернативными связывающими группами. Эти альтернативные связывающие группы включают, без ограничения, воплощения, где фосфат заменен на P(O)S («тиоат»), P(S)S («дитиоат»), (O)NR 2 («амидат»), P(O)R, P(O)OR', СО или СН 2 («формацеталь»), где каждый R или R' независимо представляет собой Н или замещенный или незамещенный алкил (1-20 С), возможно содержащий простую эфирную связь (-O-), арил, алкенил, циклоалкил, циклоалкенил или аралкил. Нет необходимости в том, чтобы все связи в полинуклеотиде были идентичными. Предшествующее описание применимо ко всем полинуклеотидам, названным здесь, включая РНК и ДНК.

«Вариабельная область» антитела относится к вариабельной области легкой цепи антитела или вариабельной области тяжелой цепи антитела, самим по себе или в комбинации. Каждая вариабельная область тяжелой и легкой цепи состоит из четырех каркасных областей (FR), соединенных тремя областями, определяющими комплементарность (CDR), также известными как гипервариабельные участки. В каждой цепи FR удерживают CDR вместе в непосредственной близости, и эти CDR вместе с CDR другой цепи вовлечены в образование антиген-связывающего сайта антител. Существует по меньшей мере две методики определения CDR: (1) способ, основанный на межвидовой вариабельности последовательности (то есть Kabat et al. Sequences of Proteins of Immunological Interest, (5th ed., 1991, National Institutes of Health, Bethesda MD)); и (2) способ, основанный на кристаллографических исследованиях комплексов антиген-антитело (Al-lazikani etal (1997) J. Moiec. Biol. 273:927-948)). При использовании здесь CDR может относиться к CDR, определенным любым способом или комбинацией обоих способов.

«Константная область» антитела относится к константной области легкой цепи антитела или константной области тяжелой цепи антитела, самим по себе или в комбинации.

При использовании здесь «иммунологически специфичное» связывание антител относится к антиген-специфичному связывающему взаимодействию, происходящему между антиген-связывающим сайтом антитела и определенным антигеном, распознаваемым этим антителом (то есть антитело взаимодействует с белком в ELISA или другом иммунологическом анализе и не взаимодействует выявляемым образом с неродственными белками).

Эпитоп, «избирательно связывающийся» или «специфично связывающийся» (использованы здесь взаимозаменяемо) с антителом или полипептидом, является термином, хорошо известным в данной области техники, и способы определения такого специфичного или избирательного связывания также хорошо известны в данной области техники. Говорят, что молекула демонстрирует «специфичное связывание» или «избирательное связывание», если она взаимодействует или связывается с определенными клеткой или веществом чаще, быстрее, на более продолжительный период времени и/или с большей аффинностью, чем с альтернативными клетками или веществами. Антитело «специфично связывается» или «избирательно связывается» с мишенью, если оно связывается с ней с большей аффинностью, авидностью, быстрее и/или на более продолжительный период времени, чем с другими веществами. Например, антитело специфично или избирательно связывающееся с эпитопом CGRP, представляет собой антитело, связывающееся с этим эпитопом с большей аффинностью, авидностью, быстрее и/или на более продолжительный период времени, чем с другими эпитопами CGRP или эпитопами антигенов, не являющихся CGRP. При использовании этого определения также подразумевают, что, например, антитело (или группировка, или эпитоп), специфично или избирательно связывающееся с первой мишенью, может специфично или избирательно связываться со второй мишенью или не связываться, специфично или избирательно, со второй мишенью. Как таковое, «специфичное связывание» или «избирательное связывание» необязательно подразумевает (хотя оно может включать) исключительное связывание. Обычно, но не обязательно, ссылка на связывание означает избирательное связывание.

При использовании здесь «по существу чистый» относится к веществу, степень чистоты которого составляет по меньшей мере 50% (то есть свободному от загрязнений), более предпочтительно по меньшей мере 90%, более предпочтительно по меньшей мере 95%, более предпочтительно по меньшей мере 98%, более предпочтительно по меньшей мере 99%.

«Клетка-хозяин» включает отдельную клетку или культуру клеток, которые могут являться или являются реципиентом вектора (векторов) для введения полинуклеотидных вставок. Клетки-хозяева включают потомство одной клетки-хозяина, и это потомство необязательно полностью может быть идентично (по морфологии или по хромосомному набору ДНК) исходной родительской клетке ввиду природных, случайных или преднамеренных мутаций. Клетка-хозяин включает клетки, трансфицированные полинуклеотидом (полинуклеотидами) по данному изобретению.

Термин «Fc-область» использован для обозначения С-концевой области тяжелой цепи иммуноглобулина. «Fc-область» может представлять собой нативную последовательность Fc-области или вариант Fc-области. Несмотря на то, что границы Fc-области тяжелой цепи иммуноглобулина могут варьироваться, Fc-область тяжелой цепи человеческого IgG обычно определена отрезком от аминокислотного остатка в положении Cys226 или от Рго230 до С-конца тяжелой цепи. Нумерация остатков Fc-области соответствует нумерации EU index по Kabat. Kabat et al., Sequences of Proteins of Imunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md., 1991. Fc-область иммуноглобулина обычно содержит два константных домена, СН2 и СН3.

При использовании здесь «Fc-рецептор» и «FcR» использованы для описания рецептора, связывающегося с Fc-областью антитела. Предпочтительным FcR является нативная последовательность человеческого FcR. Более того, предпочтительным FcR является FcR, связывающийся с антителом IgG (гамма-рецептор) и включающий рецепторы подклассов Fcспособы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 RI, Fcспособы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 RII и Fcспособы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 RIII, включая аллельные варианты этих рецепторов и варианты этих рецепторов, образованные при альтернативном сплайсинге. Рецепторы Fcспособы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 RII включают Fcспособы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 RIIA («активирующий рецептор») и Fcспособы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 RIIB («ингибирующий рецептор»), имеющие сходные аминокислотные последовательности, отличающиеся главным образом их цитоплазматическими доменами. Обзор FcR приведен в Ravetch and Kinet, 1991, Ann. Rev. Immunol., 9:457-92; Capel et al., 1994, Immunomethods, 4:25-34; и de Haas et al., 1995, J. Lab. Clin. Med., 126:330-41. «FcR» также включает неонатальный рецептор FcRn, обеспечивающий перенос материнских IgG плоду (Guyer et al., 1976, J. Immunol., 117:587; и Kirn etal., 1994, J. Immunol., 24:249).

«Комплемент-зависимая цитотоксичность» и «CDC» относятся к лизису мишени в присутствии комплемента. Инициацию пути активации комплемента обеспечивает связывание первого компонента системы комплемента (C1q) с молекулой (например, антителом) в комплексе с когнатным антигеном. Для оценки активации комплемента может быть проведен анализ CDC, например, как описано в Gazzano-Santoro et al., J. Immunol. Methods, 202:163 (1996).

«Функциональная Fc-область» выполняет по меньшей мере одну эффекторную функцию нативной последовательности Fc-области. Типичные «эффекторные функции» включают связывание C1q; комплемент-зависимую цитотоксичность (CDC); связывание с Fc-рецептором; антитело-зависимую клеточно-опосредованную цитотоксичность (ADCC); фагоцитоз; понижающую регуляцию поверхностных клеточных рецепторов (например, B-клеточного рецептора; BCR) и так далее. Для таких эффекторных функций обычно необходима комбинация Fc-области со связывающим доменом (например, вариабельным доменом антитела), и их можно оценить с применением различных анализов, известных в данной области техники для оценки таких эффекторных функций антител.

«Нативная последовательность Fc-области» включает аминокислотную последовательность, идентичную аминокислотной последовательности Fc-области, обнаруженной в природе. «Вариант Fc-области» включает аминокислотную последовательность, отличающуюся от аминокислотной последовательности нативной последовательности Fc-области по меньшей мере одной аминокислотной модификацией, но сохраняющую по меньшей мере одну эффекторную функцию нативной последовательности Fc-области. Предпочтительно, вариант Fc-области имеет по меньшей мере одну аминокислотную замену по сравнению с нативной последовательностью Fc-области или с Fc-областью исходного полипептида, например, от приблизительно одной до приблизительно десяти аминокислотных замен и предпочтительно от приблизительно одной до приблизительно пяти аминокислотных замен в нативной последовательности Fc-области или Fc-области исходного полипептида. Предпочтительно, здесь последовательность варианта Fc-области будет по меньшей мере на приблизительно 80% идентична нативной последовательности Fc-области и/или Fc-области исходного полипептида и наиболее предпочтительно по меньшей мере на приблизительно 90% идентична нативной последовательности Fc-области и/или Fc-области исходного полипептида, более предпочтительно по меньшей мере на приблизительно 95%, по меньшей мере на приблизительно 96%, по меньшей мере на приблизительно 97%, по меньшей мере на приблизительно 98%, по меньшей мере на приблизительно 99% идентична нативной последовательности Fc-области и/или Fc-области исходного полипептида.

При использовании здесь «антитело-зависимая клеточно-опосредованная цитотоксичность» и «ADCC» относятся к клеточно-опосредованной реакции, при которой неспецифические цитотоксические клетки, экспрессирующие Fc-рецепторы (FcR) (например, натуральные клетки-киллеры (МК-клетки), нейтрофилы и макрофаги), распознают связанное антитело на клетке-мишени и затем приводят к лизису клетки-мишени. ADCC-активность рассматриваемой молекулы может быть оценена с применением анализа ADCC in vitro, такого как анализ, описанный в патенте США № 5500362 или 5821337. Эффекторные клетки, применимые для таких анализов, включают мононуклеарные клетки периферической крови (РВМС) и МК-клетки. Альтернативно или дополнительно, ADCC-активность рассматриваемой молекулы может быть оценена in vivo, например, на животной модели, такой как модель, раскрытая в Clynes et al., 1998, PNAS (USA), 95:652-656.

При использовании здесь «лечение» представляет собой способ получения полезных или желаемых клинических результатов. В целях данного изобретения полезные или желаемые клинические результаты включают, без ограничения, одно или более из следующего: облегчение любого аспекта висцеральной боли, включая уменьшение тяжести, снижение интенсивности боли и других связанных с ней симптомов, снижение частоты рецидивов, улучшение качества жизни индивидов, страдающих от висцеральной боли, и снижение дозы других лекарственных средств, необходимых для лечения висцеральной боли. Другие связанные с болью симптомы включают, без ограничения, спазмы, продолжительные боли, диффузную боль, давление, ощущение переполнения, ощущение сдавливания, тошноту, рвоту и чувствительность к свету, звуку и/или движению.

«Снижение заболеваемости» висцеральной болью означает любое уменьшение тяжести (которое может включать уменьшение потребности в и/или уменьшение количества (например, воздействия) других лекарственных средств и/или способов лечения, обычно применяемых для лечения данного состояния, включая, например, опиаты (например, оксикодон, морфин, буторфанол, налбуфин и так далее)), продолжительности и/или частоты. Специалистам в данной области техники ясно, что ответ индивидов на лечение может варьироваться, и, по существу, например, «способ снижения заболеваемости висцеральной болью у индивида» означает введение антитела-антагониста против CGRP, основанное на разумном ожидании, что такое введение может, вероятно, привести к такому снижению заболеваемости у данного конкретного индивида.

«Снижение интенсивности» висцеральной боли и/или симптома, связанного с висцеральной болью, означает уменьшение или ослабление одного или более чем одного симптома висцеральной боли и/или симптома, связанного с висцеральной болью по сравнению с отсутствием введения антитела-антагониста против CGRP. «Снижение интенсивности» также включает укорочение или уменьшение продолжительности симптома.

«Облегчение» висцеральной боли и/или симптома, связанного с висцеральной болью, означает уменьшение степени выраженности одного или более чем одного нежелательного клинического проявления висцеральной боли у индивида или группы индивидов, получающих лечение антителом-антагонистом против CGRP по изобретению.

При использовании здесь «контроль висцеральной боли» относится к сохранению или уменьшению тяжести или продолжительности одного или более чем одного симптома висцеральной боли или частоты висцеральной боли по сравнению с уровнем до лечения. Например, продолжительность или тяжесть висцеральной боли или частота висцеральной боли у индивида могут быть уменьшены по меньшей мере на приблизительно 10%, 20%, 30%, 40%, 50%, 60% или 70% по сравнению с уровнем до лечения.

При использовании здесь «задержка» развития висцеральной боли означает задержку, сдерживание, замедление, торможение, стабилизацию и/или отсрочку прогрессирования висцеральной боли. Длительность этой задержки может варьироваться в зависимости от анамнеза заболевания и/или индивидов, получающих лечение. Как очевидно специалисту в данной области техники, достаточная или существенная задержка может в действительности охватывать предотвращение, в случае чего у индивида не происходит развития висцеральной боли. Способ, обеспечивающий «задержку» развития симптома, представляет собой способ, уменьшающий вероятность развития симптома в данный период времени и/или уменьшающий степень выраженности симптомов в данный период времени по сравнению с отсутствием применения способа. Такие сравнения обычно основаны на клинических исследованиях, где число субъектов достаточно для демонстрации статистически значимых различий между субъектами, получающими лечение и не получающими лечение.

«Развитие» или «прогрессирование» висцеральной боли означает начальные проявления и/или последующее прогрессирование расстройства. Развитие висцеральной боли можно выявлять и оценивать с применением стандартных клинических методик, хорошо известных в данной области техники. Однако развитие также относится к прогрессированию, которое может быть невыявляемым. В целях данного изобретения развитие или прогрессирование относятся к биологическому течению симптомов. «Развитие» включает возникновение, рецидив и начало. При использовании здесь «начало» или «возникновение» висцеральной боли включает первичное появление и/или рецидив.

«Биологический образец» охватывает множество типов образцов, которые получены от индивида и могут быть использованы в анализе для диагностики или мониторинга. Это определение охватывает кровь и другие жидкие образцы биологического происхождения, образцы мягких тканей, такие как биопсийный образец, или тканевые культуры, или клетки, имеющие происхождение из них, и их потомство. Данное определение также включает образцы, с которыми после их получения были проведены какие-либо манипуляции, такие как обработка реагентами, солюбилизация или выделение определенных компонентов, таких как белки или полинуклеотиды, или заключение в полутвердую или твердую матрицу в целях приготовления срезов. Термин «биологический образец» охватывает клинический образец и также включает клетки в культуре, супернатанты клеток, лизаты клеток, сыворотку, плазму, биологическую жидкость и образцы тканей.

При использовании здесь «эффективная доза» или «эффективное количество» лекарственного средства, соединения или фармацевтической композиции представляет собой количество, достаточное для получения полезных или желаемых результатов. Для профилактического применения полезные или желаемые результаты включают такие результаты, как устранение или снижение риска, уменьшение тяжести или задержка начала заболевания, включая биохимические, гистологические и/или поведенческие симптомы заболевания, его осложнения и промежуточные патологические фенотипы, возникающие при развитии заболевания. Для терапевтического применения полезные или желаемые результаты включают клинические результаты, такие как снижение интенсивности боли, уменьшение продолжительности или частоты приступов висцеральной боли и снижение интенсивности одного или более чем одного симптома, являющегося результатом висцеральной боли (биохимического, гистологического и/или поведенческого), включая ее осложнения и промежуточные патологические фенотипы, возникающие при развитии боли, повышение качества жизни индивидов, страдающих от боли, снижение дозы других лекарственных средств, необходимых для лечения боли, усиление эффекта другого лекарственного средства и/или задержка прогрессирования боли у пациентов. Эффективная доза может быть введена одним или более чем одним введением. В целях данного изобретения эффективная доза лекарственного средства, соединения или фармацевтической композиции представляет собой количество, достаточное для проведения профилактического или терапевтического лечения, непосредственно или косвенно. В клиническом контексте подразумевают, что эффективная доза лекарственного средства, соединения или фармацевтической композиции может быть достигнута или может не быть достигнута в сочетании с другими лекарственным средством, соединением или фармацевтической композицией. Таким образом, «эффективную дозу» можно рассматривать в контексте введения одного или более чем одного терапевтического агента, и можно считать, что один агент вводят в эффективном количестве, если в сочетании с одним или более чем одним другим агентом это приводит к возможности достижения или достижению желаемого результата.

«Индивид» или «субъект» представляет собой млекопитающее, более предпочтительно человека. Млекопитающие также включают, без ограничения, сельскохозяйственных животных, спортивных животных, домашних животных, приматов, лошадей, собак, кошек, мышей и крыс.

При использовании здесь «вектор» означает конструкцию, позволяющую доставлять и предпочтительно экспрессировать один или более чем один интересующий ген или одну или более чем одну интересующую последовательность в клетке-хозяине. Примеры векторов включают, без ограничения, вирусные векторы, векторы экспрессии из депротеинизированной ДНК или РНК, плазмидные, космидные или фаговые векторы, ДНК- или РНК-векторы экспрессии, связанные с катионными конденсирующими агентами, ДНК- или РНК-векторы экспрессии, инкапсулированные в липосомы, и определенные эукариотические клетки, такие как клетки-продуценты.

При использовании здесь «последовательность контроля экспрессии» означает последовательность нуклеиновой кислоты, которая управляет транскрипцией нуклеиновой кислоты. Последовательность контроля экспрессии может представлять собой промотор, такой как конститутивный или индуцибельный промотор, или энхансер. Последовательность контроля экспрессии функционально связана с транскрибируемой последовательностью нуклеиновой кислоты.

При использовании здесь «фармацевтически приемлемый носитель» или «фармацевтически приемлемый эксципиент» включает любое вещество, которое в комбинации с активным ингредиентом позволяет сохранять биологическую активность данного ингредиента и не взаимодействует с иммунной системой субъекта. Примеры включают, без ограничения, любые из стандартных фармацевтических носителей, такие как забуференный фосфатом физиологический раствор, вода, эмульсии, такие как эмульсия типа «масло в воде», и различные типы смачивающих агентов. Предпочтительными разбавителями для аэрозольного или парентерального введения являются забуференный фосфатом физиологический раствор или обычный (0,9%) физиологический раствор. Композиции, содержащие такие носители, изготавливают хорошо известными обычными способами (см., например, Remington's Pharmaceutical Sciences, 18th edition, A. Gennaro, ed., Mack Publishing Co., Easton, PA, 1990; и Remington, The Science and Practice of Pharmacy 20th Ed. Mack Publishing, 2000).

При использовании здесь подразумевают, что термин «kon» относится к константе скорости ассоциации антитела с антигеном.

При использовании здесь подразумевают, что термин «koff» относится к константе скорости диссоциации антитела из комплекса антитело/антиген.

При использовании здесь подразумевают, что термин «КD» относится к равновесной константе диссоциации взаимодействия антитело-антиген.

Способы предотвращения или лечения висцеральной боли

Здесь раскрыты способы предотвращения и/или лечения висцеральной боли и/или симптомов висцеральной боли и лекарственное средство для предотвращения и/или лечения висцеральной боли и/или одного или более чем одного симптома висцеральной боли у индивида.

В некоторых воплощениях согласно изобретению предложен способ предотвращения и/или лечения висцеральной боли и/или одного или более чем одного симптома висцеральной боли у индивида, включающий периферическое введение индивиду эффективного количества антитела-антагониста против CGRP.

В других воплощениях согласно изобретению предложен способ снижения интенсивности, контролирования, снижения заболеваемости или задержки развития или прогрессирования висцеральной боли и/или одного или более чем одного симптома висцеральной боли у индивида, включающий периферическое введение индивиду эффективного количества антитела-антагониста против CGRP.

В некоторых воплощениях согласно изобретению предложено применение антитела-антагониста против CGRP для изготовления лекарственного средства для предотвращения и/или лечения висцеральной боли и/или одного или более чем одного симптома висцеральной боли, где лекарственное средство изготавливают для периферического введения или где лекарственное средство вводят периферически.

В других воплощениях согласно изобретению предложено антитело-антагонист против CGRP для применения в предотвращении и/или лечении висцеральной боли и/или симптомов висцеральной боли, где указанное антитело получают для периферического введения или где указанное антитело вводят периферически.

В других воплощениях согласно изобретению предложено применение антитела-антагониста против CGRP для изготовления лекарственного средства для снижения интенсивности, контролирования, снижения заболеваемости или задержки развития или прогрессирования висцеральной боли и/или симптомов висцеральной боли, где лекарственное средство изготавливают для периферического введения или где лекарственное средство вводят периферически.

В некоторых воплощениях индивид предпочтительно представляет собой млекопитающее, например домашнее животное, такое как лошадь, кошка или собака, либо сельскохозяйственное животное, такое как овца, корова или свинья. Наиболее предпочтительно, млекопитающее представляет собой человека.

В некоторых воплощениях лекарственное средство и/или антитело-антагонист против CGRP изготовлены для перорального, сублингвального, трансбуккального, местного, ректального, ингаляционного, трансдермального, подкожного, внутривенного, внутриартериального, внутримышечного, интракардиального, внутрикостного, внутрикожного, внутрибрюшинного, трансмукозального, вагинального введения, введения в стекловидное тело, интраартикулярного, периартикулярного, центрального, местного или накожного введения.

В некоторых воплощениях лекарственное средство изготовлено для периферического введения до, и/или во время, и/или после развития висцеральной боли.

В некоторых воплощениях антитело-антагонист против CGRP оказывает при введении периферическое действие. В некоторых воплощениях антитело-антагонист против CGRP не вводят центрально, спинально или интратекально.

В некоторых воплощениях висцеральная боль связана с и/или обусловлена заболеванием, таким как, например, функциональное расстройство кишечника (ФРК) или воспалительное заболевание кишечника (ВЗК). В воплощениях, где висцеральная боль связана с ФРК, ФРК может представлять собой, например, без ограничения, гастроэзофагеальный рефлюкс, диспепсию, синдром раздраженного кишечника (СРК) или синдром функциональной абдоминальной боли (СФАБ). Наиболее предпочтительно заболевание представляет собой СРК. В воплощениях, где висцеральная боль связана с ВЗК, ВЗК может представлять собой, например, без ограничения, болезнь Крона, илеит или неспецифический язвенный колит. Другие типы висцеральной боли включают боль, связанную с, например, раком, почечной коликой, дисменореей, циститом, включая интерстициальный цистит (ИЦ), хирургическими вмешательствами, связанными с кишечной непроходимостью, менструацией, родами, менопаузой, переломом кости, дивертикулитом, перитонитом, перикардитом, гепатитом, аппендицитом, колитом, холециститом, эндометриозом, хроническим и/или острым панкреатитом, инфарктом миокарда, почечной болью, плевральной болью, простатитом, тазовой болью и травмой органа.

В некоторых воплощениях способы и применения по изобретению могут быть предназначены для снижения интенсивности висцеральной боли и/или одного или более чем одного симптома, связанного с висцеральной болью, у индивида с ФРК, ВЗК или ИЦ.

Диагностика или оценка висцеральной боли хорошо известна в данной области техники. Оценка может быть проведена на основании методик, известных в данной области техники, таких как описание боли пациентом с использованием различных шкал для оценки боли. См., например, Katz et al., Surg Clin North Am., 1999, 79(2):231-52; Caraceni et al. J Pain Symptom Manage, 2002, 23(3):239-55. Например, для оценки боли и оценки ответа на лечение могут быть использованы вербальная описательная шкала (verbal descriptor scale (VDS)), визуальная аналоговая шкала (visual analog scale (VAS)), шкала для оценки боли больницы им. Принца Генри (Prince Henry Hospital Pain Scale (PHHPS)), цифровая рейтинговая шкала (numeric rating scale (NRS)) и шкала для оценки боли выбором картинок с разными выражениями лица (Faces Pain Scale) и их варианты. Также существуют широко применяемые шкалы для оценки течения заболевания, такие как показатель тяжести функционального расстройства кишечника (Functional Bowel Disorder Severity Index (FBDSI)) (Drossman et al., 1995, Digestive Diseases and Sciences 40(5):986-995) и система оценки тяжести СРК (IBS Severity Scoring System) (Francis et al., 1997, Aliment Pharmacol Ther., 11(2):395-402). Такие шкалы могут быть использованы для оценки ответа на лечение.

В некоторых воплощениях снижение интенсивности, контролирование, снижение заболеваемости или задержку развития или прогрессирования боли, связанной с ФРК, и/или симптомов боли, связанной с ФРК, оценивают одним или более из FBDSI, VDS, VAS, PHHPS, NRS и шкалы для оценки боли выбором картинок с разными выражениями лица. В другом воплощении снижение интенсивности, контролирование, снижение заболеваемости или задержку развития или прогрессирования боли, связанной с СРК, и/или симптомов боли, связанной с СРК, оценивают одним или более из системы оценки тяжести СРК, VDS, VAS, PHHPS, NRS и шкалы для оценки боли выбором картинок с разными выражениями лица.

В некоторых воплощениях снижение интенсивности, контролирование, снижение заболеваемости или задержку развития или прогрессирования боли, связанной с ИЦ, и/или симптомов боли, связанной с ИЦ, оценивают одним или более из VDS, VAS, PHHPS, NRS и шкалы для оценки боли выбором картинок с разными выражениями лица.

Антитела-антагонисты против CGRP

В некоторых воплощениях антитело-антагонист против CGRP связывается с CGRP. Предпочтительно, антитело-антагонист против CGRP связывается с CGRP и ингибирует способность CGRP связываться с рецептором CGRP. В некоторых воплощениях антитело-антагонист против CGRP связывается как с человеческим CGRP, так и с CGRP грызуна, предпочтительно человеческим и крысиным CGRP. Более предпочтительно, антитело связывается с человеческим CGRP. В предпочтительных воплощениях антитело-антагонист против CGRP связывается с человеческим способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP или с человеческим способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP и/или способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP. Наиболее предпочтительно, антитело-антагонист против CGRP представляет собой антитело, демонстрирующее любое одно или более из следующих функциональных свойств: (а) связывается с CGRP; (б) блокирует связывание CGRP с его рецептором (рецепторами); (в) блокирует или снижает активацию рецепторов CGRP, включая активацию с образованием циклического аденозинмонофосфата (цАМФ); (г) ингибирует, блокирует, подавляет или снижает биологическую активность CGRP, включая последующие метаболические пути, опосредованные CGRP-сигнализацией, такой как связывание рецепторов и/или индукция клеточного ответа на CGRP; (д) обеспечивает предотвращение, снижение интенсивности или лечение любого аспекта висцеральной боли; (е) увеличивает клиренс CGRP; и (ж) ингибирует (снижает) синтез, образование или высвобождение CGRP.

В некоторых воплощениях антитело-антагонист против CGRP связывается с фрагментом CGRP, более предпочтительно с фрагментом CGRP и с полноразмерным CGRP. Предпочтительно, антитело-антагонист против CGRP связывается с С-концевыми областью или фрагментом CGRP. С-концевые область или фрагмент CGRP предпочтительно включают аминокислоты 19-37, или 25-37, или 29-37, или, альтернативно, аминокислоты 30-37, или, также альтернативно, аминокислоты 31-37 CGRP. В другом воплощении С-концевые область или фрагмент CGRP предпочтительно включают аминокислоты 32-37, наиболее предпочтительно аминокислоты 33-37 CGRP. Предпочтительно, CGRP представляет собой способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP или способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP, более предпочтительно человеческий CGRP или CGRP грызуна, более предпочтительно человеческий или крысиный CGRP, более предпочтительно человеческий CGRP, более предпочтительно человеческий способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP или способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP, наиболее предпочтительно человеческий способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP.

В некоторых воплощениях антитело-антагонист против CGRP специфично связывается с аминокислотной последовательностью GSKAF (SEO ID NO:39). Предпочтительно, последовательность GSKAF (SEQ ID NO:39) CGRP представляет собой эпитоп, с которым связывается антитело-антагонист против CGRP.

В некоторых воплощениях предложено антитело-антагонист против CGRP, специфично связывающееся с эпитопом, определенным аминокислотами с G33 по F37 CGRP. Антитело-антагонист против CGRP может специфично связываться с эпитопом, определенным аминокислотной последовательностью GSKAF (SEQ ID NO:39). В некоторых воплощениях согласно настоящему изобретению предложено применение такого антитела в применениях и способах, определенных в различных аспектах настоящего изобретения.

В некоторых воплощениях антитело-антагонист против CGRP ингибирует или предотвращает активацию рецептора CGRP. Предпочтительно, антитело против CGRP имеет среднюю ингибирующую концентрацию (IC50) от приблизительно 0,0001 (0,1 нМ) до приблизительно 500 мкМ. В некоторых предпочтительных воплощениях IC50 составляет от приблизительно 0,0001 мкМ до приблизительно 250 мкМ, 100 мкМ, 50 мкМ, 10 мкМ, 1 мкМ, 500 нМ, 250 нМ, 100 нМ, 50 нМ, 20 нМ, 15 нМ, 10 нМ, 5 нМ, 1 нМ или 0,5 нМ, как измерено в анализе связывания in vitro. В некоторых более предпочтительных воплощениях IC50 составляет менее приблизительно 500 пМ, или приблизительно 100 пМ, или приблизительно 50 пМ, как измерено в анализе связывания in vitro. В другом более предпочтительном воплощении IC50 составляет приблизительно 1,2 нМ или 31 нМ.

В некоторых воплощениях используемое антитело-антагонист против CGRP способно конкурировать с антителом, описанным выше, за связывание с CGRP, или с фрагментом CGRP, или с фрагментом CGRP и с полноразмерным CGRP, предпочтительно с С-концевыми областью или фрагментом CGRP. В предпочтительных воплощениях С-концевые область или фрагмент CGRP включают аминокислоты 19-37, 25-37, 29-37, 30-37 или 31-37 CGRP. В другом воплощении С-концевые область или фрагмент CGRP предпочтительно включают аминокислоты 32-37, наиболее предпочтительно 33-37 CGRP.

В некоторых воплощениях антитело-антагонист против CGRP связывается с CGRP, областью CGRP или фрагментом CGRP с аффинностью связывания (KD) от приблизительно 0,00001 мкМ (0,01 нМ) до приблизительно 500 мкМ. В некоторых воплощениях аффинность связывания (KD) составляет от приблизительно 0,00001 мкМ до приблизительно 250 мкМ, 100 мкМ, 50 мкМ, 10 мкМ, 1 мкМ, 500 нМ, 250 нМ, 100 нМ, 50 нМ, 20 нМ, 15 нМ, 10 нМ, 5 нМ, 1 нМ, 0,5 нМ, 1 нМ, 0,05 нМ или 0,01 нМ, как измерено в анализе связывания in vitro. В некоторых воплощениях аффинность связывания (KD) составляет менее приблизительно 500 пМ, или 100 пМ, 50 пМ или 10 пМ, как измерено в анализе связывания in vitro. В других более предпочтительных воплощениях аффинность связывания (KD) составляет приблизительно 0,04 нМ или 16 нМ.

Антитело-антагонист против CGRP, используемое в настоящем изобретении, может быть выбрано из группы, включающей моноклональные антитела, поликлональные антитела, фрагменты антител (например, Fab, Fab', F(ab')2, Fv, Fc, ScFv и так далее), химерные антитела, биспецифичные антитела, гетероконъюгатные антитела, одноцепочечные (ScFv) антитела, их мутантные варианты, слитые белки, содержащие часть антитела (такую как однодоменное антитело), гуманизированные антитела и любую другую модифицированную форму молекулы иммуноглобулина, содержащую сайт распознавания антигена желаемой специфичности, включая гликозилированные варианты антител, варианты аминокислотной последовательности антител и ковалентно модифицированные антитела. Антитело-антагонист против CGRP может иметь происхождение из мыши, крысы, человека или любого другого источника (включая химерные или гуманизированные антитела). В некоторых воплощениях антитело-антагонист против CGRP может быть гуманизированным, но более предпочтительно является человеческим. В некоторых воплощениях антитело-антагонист против CGRP является выделенным. В некоторых воплощениях антитело-антагонист против CGRP является по существу чистым. Там, где антитело-антагонист против CGRP представляет собой фрагмент антитела, такой фрагмент предпочтительно сохраняет функциональные свойства исходного антитела, то есть связывание с CGRP и/или антагонистическую активность в отношении CGRP, как описано в функциональных свойствах, приведенных выше.

Примеры антител-антагонистов против CGRP известны в данной области техники. Поэтому согласно предпочтительному воплощению настоящего изобретения антитело-антагонист против CGRP, используемое в настоящем изобретении, предпочтительно представляет собой антитело против CGRP, раскрытое, в общих чертах или конкретно, в любых из (1) WO 2007/054809, (2) WO 2007/076336, (3) Tan et al., Clin. Sci. (Lond). 89:565-73, 1995, (4) Sigma (Missouri, US), серийный номер продукта С7113 (клон #4901), (5) PIourde et al., Peptides 14:1225-1229, 1993, или содержащее или состоящее из:

а) фрагмента указанного антитела (например, Fab, Fab', F(ab')2, Fv, Fc, ScFv и так далее);

б) легкой цепи указанного антитела;

в) тяжелой цепи указанного антитела;

г) одной или более чем одной вариабельной области легкой цепи и/или тяжелой цепи указанного антитела;

д) одного или более чем одного CDR (одного, двух, трех, четырех, пяти или шести CDR) указанного антитела;

е) CDR H3 тяжелой цепи указанного антитела;

ж) CDR L3 легкой цепи указанного антитела;

з) трех CDR легкой цепи указанного антитела;

и) трех CDR тяжелой цепи указанного антитела;

к) трех CDR легкой цепи и трех CDR тяжелой цепи указанного антитела;

л) любого одного или более из (а)-(к).

В некоторых воплощениях антитело-антагонист против CGRP представляет собой антитело G2 или антитело G1. Согласно наиболее предпочтительному воплощению настоящего изобретения используемое антитело-антагонист против CGRP представляет собой антитело G1 против CGRP, как конкретно раскрыто в РСТ-публикации заявки на патент № WO 2007/054809, или антитело, содержащее его варианты, показанные в Таблице 6 WO 2007/054809, также включая антитела, функционально эквивалентные G1, то есть содержащие консервативные замены аминокислотных остатков или одну или более чем одну аминокислотную делецию или вставку, не оказывающие существенного влияния на их функциональные свойства, например, связывание с CGRP или антагонистическую активность в отношении CGRP, и варианты с повышенными или сниженными активностью и/или связыванием. При использовании здесь термины «G1» и «антитело G1» использованы взаимозаменяемо для обозначения антитела, полученного с использованием векторов экспрессии, имеющих депозитарные номера АТСС РТА-6867 и АТСС РТА-6866, как раскрыто в заявке WO 2007/054809. Функциональные свойства антитела G1 описаны в РСТ-заявках на патенты № PCT/IB2009/050849 и PCT/IB2009/050852, поданных 3 марта 2009 г. и полностью включенных сюда посредством ссылки.

Согласно другому воплощению настоящего изобретения антитело-антагонист против CGRP содержит или состоит из полипептида, выбранного из:

(а) антитела G1 или его вариантов, показанных в Таблице 6 WO 2007/054809; (б) фрагмента или области антитела G1 или его вариантов, показанных в Таблице 6 WO 2007/054809; (в) легкой цепи антитела G1 или его вариантов, показанных в Таблице 6 WO 2007/054809; (г) тяжелой цепи антитела G1 или его вариантов, показанных в Таблице 6 WO 2007/054809; (д) одной или более чем одной вариабельной области легкой цепи и/или тяжелой цепи антитела G1 или его вариантов, показанных в Таблице 6 WO 2007/054809; (е) одного или более чем одного CDR (одного, двух, трех, четырех, пяти или шести CDR) антитела G1 или его вариантов, показанных в Таблице 6 WO 2007/054809; (ж) CDR Н3 тяжелой цепи антитела G1 или его вариантов, показанных в Таблице 6 WO 2007/054809; (з) CDR L3 легкой цепи антитела G1 или его вариантов, показанных в Таблице 6 WO 2007/054809; (и) трех CDR легкой цепи антитела G1 или его вариантов, показанных в Таблице 6 WO 2007/054809; (к) трех CDR тяжелой цепи антитела G1 или его вариантов, показанных в Таблице 6 WO 2007/054809; (л) трех CDR легкой цепи и/или трех CDR тяжелой цепи антитела G1 или его вариантов, показанных в Таблице 6 WO 2007/054809; и (м) антитела, содержащего любое из (б)-(л). Согласно изобретению также предложены полипептиды, содержащие любое одно или более из указанного выше. В некоторых воплощениях по меньшей мере один, два, три, четыре, пять или шесть CDR по меньшей мере на приблизительно 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичны по меньшей мере одному, двум, трем, четырем, пяти или шести CDR G1 или его вариантов, показанных в Таблице 6 WO 2007/054809. Определение CDR-участков входит в компетенцию специалиста в данной области техники. Подразумевают, что в некоторых воплощениях CDR могут представлять собой комбинацию CDR по Kabat и Chothia. В некоторых воплощениях CDR представляют собой CDR по Kabat. В других воплощениях CDR представляют собой CDR по Chothia.

Антитело-антагонист против CGRP предпочтительно содержит или состоит из фрагмента или области антитела G1 (например, Fab, Fab', F(ab') 2, Fv, Fc, ScFv и так далее) или его вариантов, показанных в Таблице 6 WO 2007/054809. Предпочтительно, указанный фрагмент или область обладает функциональными свойствами антитела-антагониста против CGRP, такими как, например, связывающая активность в отношении CGRP и/или антагонистическая активность в отношении CGRP, и содержит или состоит из одного или более из: (1) легкой цепи; (2) тяжелой цепи; (3) фрагмента, содержащего одну или более чем одну вариабельную область легкой цепи и/или тяжелой цепи; и (4) одного или более чем одного CDR легкой цепи и/или тяжелой цепи антитела G1.

В некоторых воплощениях антитело-антагонист против CGRP содержит вариабельную область легкой цепи (LCVR), содержащую пептид с последовательностью, выбранной из группы, состоящей из SEQ ID NO:28-32, и/или вариабельную область тяжелой цепи (HCVR), содержащую пептид с последовательностью, выбранной из группы, состоящей из SEQ ID NO:34-38, согласно заявке на патент WO 2007/076336.

Более предпочтительно, антитело-антагонист против CGRP содержит полипептид L.CVR с SEQ ID NO, как показано в Таблице 1 заявки на патент WO 2007/076336, и дополнительно содержит полипептид HCVR с SED ID NO, как показано в Таблице 1 заявки на патент WO 2007/076336.

Согласно другому воплощению изобретения используемое антитело-антагонист против CGRP содержит CDR легкой цепи (CDRL), выбранный из группы, состоящей из SEQ ID NO:8-13, и/или CUR тяжелой цепи (CDRH), выбранный из группы, состоящей из SEQ ID NO:14-22 заявки на патент WO 2007/076336.

Способы получения и выделения антител-антагонистов против CGRP из заявки WO 2007/076336 и данные, демонстрирующие их связывание с CGRP и антагонистические свойства в отношении CGRP, описаны в заявке WO 2007/076336.

В некоторых воплощениях антитело-антагонист против CGRP для использования в настоящем изобретении содержит домен VH, аминокислотная последовательность которого по меньшей мере на приблизительно 85%, по меньшей мере на приблизительно 86%, по меньшей мере на приблизительно 87%, по меньшей мере на приблизительно 88%, по меньшей мере на приблизительно 89%, по меньшей мере на приблизительно 90%, по меньшей мере на приблизительно 91%, по меньшей мере на приблизительно 92%, по меньшей мере на приблизительно 93%, по меньшей мере на приблизительно 94%, по меньшей мере на приблизительно 95%, по меньшей мере на приблизительно 96%, по меньшей мере на приблизительно 97%, по меньшей мере на приблизительно 98%, по меньшей мере на приблизительно 99% или 100% идентична SEQ ID NO:1 или SEQ ID NO:19, представленным здесь.

В некоторых воплощениях антитело-антагонист против CGRP содержит домен VL, аминокислотная последовательность которого по меньшей мере на приблизительно 85%, по меньшей мере на приблизительно 86%, по меньшей мере на приблизительно 87%, по меньшей мере на приблизительно 88%, по меньшей мере на приблизительно 89%, по меньшей мере на приблизительно 90%, по меньшей мере на приблизительно 91%, по меньшей мере на приблизительно 92%, по меньшей мере на приблизительно 93%, по меньшей мере на приблизительно 94%, по меньшей мере на приблизительно 95%, по меньшей мере на приблизительно 96%, по меньшей мере на приблизительно 97%, по меньшей мере на приблизительно 98%, по меньшей мере на приблизительно 99% или 100% идентична SEQ ID NO:2 или SEQ ID NO:20, представленным здесь.

В некоторых воплощениях антитело-антагонист против CGRP содержит домен VH и домен VL , аминокислотные последовательности которых по меньшей мере на приблизительно 85%, по меньшей мере на приблизительно 86%, по меньшей мере на приблизительно 87%, по меньшей мере на приблизительно 88%, по меньшей мере на приблизительно 89%, по меньшей мере на приблизительно 90%, по меньшей мере на приблизительно 91%, по меньшей мере на приблизительно 92%, по меньшей мере на приблизительно 93%, по меньшей мере на приблизительно 94%, по меньшей мере на приблизительно 95%, по меньшей мере на приблизительно 96%, по меньшей мере на приблизительно 97%, по меньшей мере на приблизительно 98%, по меньшей мере на приблизительно 99% или 100% идентичны представленным здесь SEQ ID NO:1 и 2, соответственно, или SEQ ID NO:19 и 20, соответственно.

В некоторых воплощениях антитело-антагонист против CGRP содержит домен VH, аминокислотная последовательность которого по меньшей мере на 90% идентична SEQ ID NO:1, и домен VL, аминокислотная последовательность которого по меньшей мере на 90% идентична SEQ ID NO:2, представленным здесь.

Альтернативно, антитело-антагонист против CGRP может содержать домен VH , аминокислотная последовательность которого по меньшей мере на 90% идентична SEQ ID NO:19, и домен VL, аминокислотная последовательность которого по меньшей мере на 90% идентична SEQ ID NO:20, представленным здесь.

В некоторых воплощениях антитело-антагонист против CGRP содержит по меньшей мере один CDR, выбранный из группы, состоящей из: (a) CDR H1, как изложено в SEQ ID NO:3, 21, 33, 34, 36 или 37; (б) CDR H2, как изложено в SEQ ID NO:4, 22, 35 или 38; (в) CDR Н3, как изложено в SEQ ID NO:5 или 23; (г) CDR L1, как изложено в SEQ ID NO:6 или 24; (д) CDR L2, как изложено в SEQ ID NO:7 или 25; (е) CDR L3, как изложено в SEQ ID NO:8 или 26; и (ж) вариантов CDR L1, CDR L2 и CDR H2, как показано в Таблице 6 WO 2007/054809.

В некоторых воплощениях константная область тяжелой цепи антитела-антагониста против CGRP может представлять собой константную область любого типа, такого как IgG, IgM, IgD, IgA и IgE; и любого изотипа, такого как IgG1, IgG2, IgG3 и IgG4.

В некоторых воплощениях антитело-антагонист против CGRP содержит тяжелую цепь, полученную с использованием вектора экспрессии с регистрационным номером в АТСС РТА-6867. Более предпочтительно, антитело-антагонист против CGRP содержит легкую цепь, полученную с использованием вектора экспрессии с регистрационным номером в АТСС РТА-6866. В некоторых воплощениях антитело-антагонист против CGRP содержит полноразмерную аминокислотную последовательность тяжелой цепи антитела G1 (включая модифицированный IgG2, как описано здесь), показанную в SEQ ID NO:11, с С-концевым лизином или без него. Антитело-антагонист против CGRP также включает антитело без концевого лизина тяжелой цепи, поскольку обычно у части антител происходит его потеря в процессе их получения. В некоторых воплощениях антитело-антагонист против CGRP содержит полноразмерную аминокислотную последовательность легкой цепи антитела G1, показанную в SEQ ID NO:12. В. некоторых воплощениях антитело-антагонист против CGRP содержит полноразмерную аминокислотную последовательность тяжелой цепи антитела G2, показанную в SEQ ID NO:29. В некоторых воплощениях антитело-антагонист против CGRP содержит полноразмерную аминокислотную последовательность легкой цепи антитела G2, показанную в SEQ ID N0:30. В некоторых воплощениях антитело-антагонист против CGRP получено с использованием векторов экспрессии с регистрационными номерами в АТСС РТА-6867 и РТА-6866.

В некоторых воплощениях антитело-антагонист против CGRP для использования в настоящем изобретении представляет собой антитело G1 или антитело G2, определенное здесь. В предпочтительных воплощениях антитело-антагонист против CGRP для использования в настоящем изобретении представляет собой антитело G1 или его антиген-связывающий фрагмент.

Согласно другим воплощениям изобретения антитело-антагонист против CGRP содержит модифицированную константную область, как, например, описано в WO 2007/054809. Предпочтительно, модифицированная константная область иммунологически инертна, включая частичную иммунологическую инертность, таким образом, что она не приводит к комплемент-опосредованному лизису, не стимулирует антитело-зависимую клеточно-опосредованную цитотоксичность (ADCC), не активирует микроглию. Предпочтительно, одна или более из этих активностей модифицированной константной области снижена. Наиболее предпочтительно, константная область модифицирована, как описано в Eur. J. Immunol., 1999, 29:2613-2624; РСТ-заявке № PCT/GB99/01441; и/или заявке на патент Великобритании № 8809951.8. В некоторых воплощениях антитело-антагонист против CGRP содержит константную область тяжелой цепи человеческого lgG2, содержащую следующие мутации: А330, Р331 на S330, S331 (нумерация аминокислот относительно последовательности lgG2 дикого типа). Eur. J. Immunol., 1999, 29:2613-2624.

Способы получения и выделения антител-антагонистов против CGRP из заявки WO 2007/054809 и данные, демонстрирующие их связывание с CGRP и антагонистические свойства в отношении CGRP, описаны в заявке WO 2007/054809. Последовательности SEQ ID NO:1-14 указанной заявки представлены здесь как SEQ ID NO:1-14, соответственно.

Доза и введение

В некоторых воплощениях антитело-антагонист против CGRP вводят периферически, например, от приблизительно одного раза до приблизительно 7 раз в неделю, более предпочтительно от приблизительно одного раза до приблизительно четырех раз в месяц, более предпочтительно от приблизительно одного раза до приблизительно шести раз в 6 месяцев, более предпочтительно от приблизительно одного раза до приблизительно двенадцати раз в год. Предпочтительно, антитело-антагонист против CGRP вводят периферически с периодичностью, выбранной из: приблизительно одного раза в сутки, одного раза в двое, трое, четверо, пятеро или шестеро суток, одного раза в неделю, одного раза в две недели, одного раза в три недели, одного раза в месяц, одного раза в два месяца, одного раза в три месяца, одного раза в четыре месяца, одного раза в пять месяцев, одного раза в шесть месяцев, одного раза в семь месяцев, одного раза в восемь месяцев, одного раза в девять месяцев, одного раза в десять месяцев, одного раза в одиннадцать месяцев или одного раза в год. Согласно предпочтительным воплощениям антитело-антагонист против CGRP вводят способом введения, выбранным из одного или более из перорального, сублингвального, трансбуккального, местного, ректального, ингаляционного, трансдермального, подкожного, внутривенного, внутриартериального или внутримышечного, интракардиального, внутрикостного, внутрикожного, внутрибрюшинного, трансмукозального, вагинального введения, введения в стекловидное тело, накожного, интраартикулярного, периартикулярного или местного введения.

Согласно другому воплощению настоящего изобретения лекарственное средство изготовлено для периферического введения от приблизительно одного раза до приблизительно 7 раз а неделю, более предпочтительно от приблизительно одного раза до приблизительно четырех раз в месяц, более предпочтительно от приблизительно одного раза до приблизительно шести раз в 6 месяцев, более предпочтительно от приблизительно одного раза до приблизительно двенадцати раз в год. Предпочтительно, лекарственное средство изготовлено для периферического введения с периодичностью, выбранной из: приблизительно одного раза в сутки, одного раза в двое, трое, четверо, пятеро или шестеро суток, одного раза в неделю, одного раза в две недели, одного раза в три недели, одного раза в месяц, одного раза в два месяца, одного раза в три месяца, одного раза в четыре месяца, одного раза в пять месяцев, одного раза в шесть месяцев, одного раза в семь месяцев, одного раза в восемь месяцев, одного раза в девять месяцев, одного раза в десять месяцев, одного раза в одиннадцать месяцев или одного раза в год. Согласно предпочтительным воплощениям лекарственное средство изготовлено для периферического введения способом введения, выбранным из одного или более из перорального, сублингвального, трансбуккального, местного, ректального, ингаляционного, трансдермального, подкожного, внутривенного, внутриартериального или внутримышечного, интракардиального, внутрикостного, внутрикожного, внутрибрюшинного, трансмукозального, вагинального введения, введения в стекловидное тело, накожного, интраартикулярного, периартикулярного или местного введения.

Согласно другому воплощению настоящего изобретения концентрация антитела составляет от приблизительно 0,1 до приблизительно 200 мг/мл, предпочтительно приблизительно 0,5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 или 200 мг/мл +/- погрешность 10%, наиболее предпочтительно приблизительно 50 мг/мл.

Согласно другому воплощению настоящего изобретения лекарственное средство изготовлено для периферического введения при концентрации антитела от 0,1 до 200 мг/кг массы тела, предпочтительно приблизительно 0,5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 или 200 мг/кг массы тела +/- погрешность 10%, наиболее предпочтительно приблизительно 10 мг/кг.

Согласно предпочтительному воплощению настоящего изобретения антитело-антагонист против CGRP имеет период полувыведения in vivo более приблизительно 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 62, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208 или 210 суток +/- 1 сутки, более предпочтительно более приблизительно 7, 8, 9, 10, 11 или 12 месяцев.

Предпочтительно, антитело-антагонист против CGRP имеет период полувыведения in vivo более 6 суток.

Согласно другому предпочтительному воплощению настоящего изобретения лекарственное средство и/или антитело-антагонист против CGRP не влияет на центральную нервную систему и/или когнитивное расстройство. Предпочтительно, лекарственное средство и/или антитело-антагонист против CGRP не приводит к любому одному или более из следующего; амнезии, спутанности сознания, деперсонализации, гипестезии, патологического мышления, тризма, головокружения, акатизии, апатии, атаксии, периоральной парестезии, стимуляции ЦНС, эмоциональной лабильности, эйфории, галлюцинаций, агрессивности, гиперестезии, гиперкинезии, гипотонии, расстройства координации, повышения либидо, маниакальной реакции, миоклонуса, невралгии, невропатии, психоза, эпилептического припадка, патологической речи, ступора, суицидного мышления, головокружения, сонливости, бессонницы, тревоги, тремора, депрессии или парестезии. Наиболее предпочтительно, лекарственное средство и/или антитело-антагонист против CGRP не приводит к расстройству координации движений или внимания.

Согласно другому воплощению настоящего изобретения лекарственное средство и/или антитело-антагонист против CGRP не приводит к нарушению функций дыхательной системы, печени, почек или желудочно-кишечного тракта.

Согласно другому воплощению настоящего изобретения лекарственное средство и/или антитело-антагонист против CGRP не влияет на физическую и/или психологическую зависимость. Предпочтительно, лекарственное средство и/или антитело-антагонист против CGRP не демонстрирует аффинности к опиатным, бензодиазепиновым, фенциклидиновым (РСР) рецепторам или рецепторам N-метил-D-аспарагиновой кислоты (NMDA), или не является стимулятором ЦНС, или не оказывает никакого седативного или эйфорического эффекта.

В некоторых воплощениях антитело-антагонист против CGRP при введении обеспечивает снижение интенсивности, контролирование, снижение заболеваемости или задержку развития или прогрессирования центрального восприятия боли.

В других воплощениях эффект антитела-антагониста против CGRP равен и/или превосходит эффекты НПВС и/или опиатов в тех же моделях висцеральной боли. В одном воплощении антитело-антагонист против CGRP эффективно в лечении индивидов с рефракторной болью.

Согласно другим воплощениям настоящего изобретения предложено применение или способ по любому другому аспекту изобретения, где антитело-антагонист против CGRP вводят раздельно, последовательно или одновременно в комбинации с одним или более чем одним другим фармакологически активным соединением или агентом, предпочтительно соединением или агентом, полезным для лечения висцеральной боли. Предпочтительно, дополнительный(ые) агент(ы) выбран/выбраны из одного или более из:

1) опиоидного анальгетика, например морфина, героина, гидроморфона, оксиморфона, леворфанола, леваллорфана, метадона, меперидина, фентанила, кокаина, кодеина, дигидрокодеина, оксикодона, гидрокодона, пропоксифена, налмефена, налорфина, налоксона, налтрексона, бупренорфина, буторфанола, налбуфина или пентазоцина;

2) нестероидного противовоспалительного лекарственного средства (НПВС), например аспирина, диклофенака, дифлунизала, этодолака, фенбуфена, фенопрсфена, флуфенизала, флурбипрофена, ибупрофена, индометацина, кетопрофена, кеторолака, меклофенамовой кислоты, мефенамовой кислоты, набуметона, напроксена, оксапрозина, фенилбутазона, пироксикама, сулиндака, толметина или зомепирака, ингибиторов циклооксигеназы-2 (ЦОГ-2), целекоксиба, рофекоксиба, мелоксикама, JTE-522, L-745337, NS398 или их фармацевтически приемлемой соли;

3) барбитуратного седативного средства, например амобарбитала, апробарбитала, бутабарбитала, бутабитала, мефобарбитала, метарбитала, метогекситала, пентобарбитала, фенобарбитала, секобарбитала, талбутала, тиамилала или тиопентала либо их фармацевтически приемлемой соли;

4) бензодиазепина, обладающего седативным действием, например хлордиазепоксида, клоразепата, диазепама, флуразепама, лоразепама, оксазепама, темазепама или триазолама либо их фармацевтически приемлемой соли;

5) Hi-антагониста, обладающего седативным действием, например дифенгидрамина, пириламина, прометазина, хлорфенирамина или хлорциклизина либо их фармацевтически приемлемой соли;

6) седативного средства, такого как глутетимид, мепробамат, метаквалон или дихлоралфеназон либо их фармацевтически приемлемая соль;

7) средства, расслабляющего скелетные мышцы, например баклофена, карисопродола, хлорзоксазона, циклобензаприна, метокарбамола или орфенадрина либо их фармацевтически приемлемой соли;

8) антагониста NMDA-рецепторов, например декстрометорфана ((+)-3-гидрокси-М-метилморфинана) или его метаболита декстрорфана ((+)-3-гидрокси-М-метилморфинана), кетамина, мемантина, пирролохинолинхинона или цис-4-(фосфонометил)-2-пиперидинкарбоновой кислоты либо их фармацевтически приемлемой соли;

9) альфа-адренергического средства, например доксазозина, тамсулозина, клонидина или 4-амино-6,7-диметокси-2-(5-метансульфонамидо-1,2,3,4-тетрагидроизохинол-2-ил)-5-(2-пиридил)-хиназолина;

10) трициклического антидепрессанта, например дезипрамина, имцпрамина, амитриптилина или нортриптилина;

11) противосудорожного средства, например карбамазепина или вальпроата;

12) антагониста тахикинина (NK), в частности антагониста NK-3, NK-2 или NK-1, например (способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 R,9R)-7-[3,5-бис(трифторметил)бензил]-8,9,10,11-ге7рагидро-9-метил-5-(4-метилфенил)-7Н-[1,4]диазоцино[2,1-д][1,7]нафтиридин-6-13-диона (ТАК-637), 5-[[(2Р,38)-2-[(1R)-1-[3,5-бис(трифторметил)фенил]этокси-3-(4-фторфенил)-4-морфолинил]метил]-1,2-дигидро-3Н-1,2,4-триазол-3-она (МК-869), ланепитанта, дапитанта или 3-[[2-метокси-5-(трифторметокси)фенил]метиламино]-2-фенилпиперидина (2S,3S);

13) антагониста мускариновых рецепторов, например оксибутина, толтеродина, пропиверина, хлорида тропсия или дарифенацина;

14) ингибитора ЦОГ-2, например целекоксиба, рофекоксиба или вальдекоксиба;

15) неселективного ингибитора ЦОГ (предпочтительно с защитным действием на ЖКТ), например нитрофлурбипрофена (НСТ-1026);

16) анальгетика, являющегося производным анилина, в частности парацетамола;

17) нейролептика, такого как дроперидол;

18) агониста (например резинфератоксина) или антагониста (например капсазепина) ваниллоидных рецепторов;

19) бета-адренергического средства, такого как пропранолол;

20) местного анестетика, такого как мексилетин;

21) кортикостероида, такого как дексаметазон;

22) агониста или антагониста серотониновых рецепторов;

23) холинергического (никотинового) анальгетика;

24) трамадола;

25) ингибитора ФДЭ-V, такого как силденафил, варденафил или таладафил;

26) альфа-2-дельта-лиганда, такого как габапентин или прегабалин;

27) каннабиноида; и

28) антидепрессанта, такого как амитриптилин (Elavil®), тразодон (Desyrel®) и имипрамин (Tofranil®), или противосудорожных средств, таких как фенитоин (Dilantin®) или карбамазепин (Tegretol®).

Согласно другому аспекту настоящего изобретения предложена фармацевтическая композиция для предотвращения и/или лечения висцеральной боли и/или симптомов висцеральной боли или для снижения интенсивности, контролирования, снижения заболеваемости или задержки развития или прогрессирования висцеральной боли и/или симптомов висцеральной боли у индивида, содержащая антитело-антагонист против CGRP и фармацевтически приемлемый носитель и/или эксципиент, изготовленная для периферического введения.

Наборы

Согласно другому аспекту настоящего изобретения предложен набор, включающий фармацевтическую композицию, как определено выше, и инструкции по периферическому введению эффективного количества указанной фармацевтической композиции индивиду для предотвращения и/или лечения висцеральной боли и/или симптомов висцеральной боли или для снижения интенсивности, контролирования, снижения заболеваемости или задержки развития или прогрессирования висцеральной боли и/или симптомов висцеральной боли.

Набор может включать один или более чем один контейнер, содержащий антитело-антагонист или полипептид против CGRP, описанные здесь, и инструкции по применению в соответствии с любым из способов и применений по изобретению. Набор может дополнительно включать описание выбора индивида, подходящего для лечения, на основании установления наличия висцеральной боли или риска возникновения висцеральной боли у индивида.

Инструкции по периферическому введению фармацевтической композиции могут включать информацию о дозе, схеме введения и путях введения для предполагаемого лечения.

С необходимыми поправками, предпочтительные признаки каждого аспекта изобретения применимы в равной степени к каждому другому аспекту.

ПРИМЕРЫ

Следующие примеры приведены исключительно в иллюстративных целях, и подразумевают, что они никоим образом не ограничивают объем настоящего изобретения. Действительно, на основании представленного выше описания специалистам в данной области техники будут очевидны различные модификации изобретения, входящие в объем прилагаемой формулы изобретения, помимо модификаций, показанных и описанных здесь.

Пример 1: Модель висцеральной боли

В этом примере показан эффект введения антитела-антагониста против CGRP в модели висцеральной боли.

Показано, что у пациентов с СРК снижен порог висцеральной чувствительности к растяжению толстой и прямой кишки, и что это сильно коррелирует с симптомами висцеральной боли (Delafoy et al., 2006). Растяжение толстой и прямой кишки после TNBS-индуцированного колита у крыс представляет собой животную модель, используемую многими исследователями для изучения механизмов висцеральной гиперчувствительности (Gay et al, 2006, Delafoy et al., 2006, Adam et al., 2006). В данном примере модель TNBS-колита у крыс использовали для оценки эффекта антитела против CGRP, блокирующего функциональную активность CGRP. В этой модели, как в исследованиях СРК у людей, висцеральный болевой порог измеряют по ответу на баллонное растяжение толстой кишки.

В течение ночи перед операцией крыс не кормили и затем проводили им анестезию кетамином (80 мг/мл)/ксилазином (12 мг/мл) в дозе 1 мл/кг. Проводили лапаротомию и раствор TNBS (50 мг в концентрации 1,5 мл/кг в 30% этаноле, «группа введения TNBS») или 30% раствор этанола («группа симуляции») вводили в проксимальную часть толстой кишки на 1 см дистальнее слепой кишки. Группу симуляции использовали в качестве контроля без колита. На пятые сутки после операции группу введения TNBS разделяли на две группы. Одной группе внутривенно вводили моноклональное антитело-антагонист против CGRP 4901 (имеющееся в продаже от Sigma (Missouri, US), номер продукта С7113 (клон #4901)) в концентрации 10 мг/кг. Другой группе вводили наполнитель (PBS, 0,01% Tween 20) в качестве отрицательного контроля.

Перед седьмыми сутками после операции крыс снова не кормили в течение ночи и затем у крыс, которым вводили TNBS, с потерей массы тела не более 11% определяли висцеральный болевой порог с использованием баллонного растяжения. В дистальную часть толстой кишки вводили латексный баллон размером 5 см, соединенный с катетером, располагая основание баллона а 5 см от анального отверстия. Для предотвращения смещения баллона катетер фиксировали к хвосту лентой. После периода адаптации продолжительностью 30 минут баллон надували последовательно от 5 мм рт. ст. до 80 мм рт. ст. с интервалами 30 секунд. Баллонное растяжение прекращали по достижении порогового давления, при котором животные принимали типичную для висцеральной боли у грызунов позу, известную как альфа-поза (повторяющиеся волны сокращения косых мышц с поджатием задних лап), и это давление записывали как висцеральный болевой порог.

У крыс, которым проводили процедуру симуляции, порог составлял 36,8 +/- 2,6 (N = 5, среднее +/- стандартная ошибка) на 7 сутки после операции (Фиг. 1А). У крыс, которым вводили TNBS и, на 5 сутки, антитело 4901 (10 мг/кг), порог составлял 32,3 +/- 4,1 (N=9) на 7 сутки, что статистически значимо отличалось (однофакторный дисперсионный анализ с апостериорным критерием множественного сравнения Даннета) от порога на 7 сутки у крыс, которым вводили TNBS и, на 5 сутки, наполнитель (21,0 +/- 3,0, N=10) (Фиг.1А). Эффект антитела 4901 был сопоставим с эффектом антагониста рецепторов CGRP CGRP 8-37 (Фиг. 1Б). Этот результат продемонстрировал, что антитело-антагонист против CGRP эффективно и значимо сближало висцеральный болевой порог с порогом группы симуляции, то есть реверсировало боль в модели висцеральной боли.

Пример 2: Анализ взаимодействия и анализ связывания

Анализ взаимодействия проводили при 25°С и при 37°С на системе Biacore 3000способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 , оборудованной покрытыми стрептавидином (SA) сенсорными чипами (Biacore AB, Uppsala, Sweden), с использованием стандартных буферов Biacore для проведения анализов (HBS-P или HBS-EP). N-LC-биотинилированные человеческие и крысиные способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 - и способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP иммобилизовали в отдельных проточных ячейках в низких концентрациях (обычно 100 единиц ответа) с образованием реакционных поверхностей, в то время как необработанную проточную ячейку использовали в качестве контрольного канала. Получали очищенные Fab-фрагменты антител G1 и G2. Обычно Fab-фрагменты получали в форме двукратных серийных разведении с максимальной концентрацией 0,5 мкМ и вносили в течение 1 минуты со скоростью 100 мкп/мин при времени диссоциации до двух часов. Поверхности восстанавливали смесью 50% об./об. этанола и 25 мМ NaOH для Fab-фрагмента G1 и 2:1 об./об. буфера Pierce Gentle Eiution Buffer/4 M NaCl для Fab-фрагмента G2. Внесения Fab-фрагментов повторяли для демонстрации воспроизводимости анализа. Ответы связывания сравнивали с двумя контролями с использованием программного обеспечения BiaEvaluation v. 4.0, и они в целом соответствовали простой модели связывания. Аффинность получали как отношение кинетических констант скорости (KD=koff/kon).

Результаты для антитела G1 показаны в Таблице 1 ниже. Антитело G1 связывается с человеческими способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 - и способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP со сходной и высокой аффинностью (KD=163 и 155 пМ, соответственно, при анализе «бок о бок» на одном и том же чипе при 37°С и времени диссоциации 20 минут). Последовательности человеческого CGRP и CGRP яванского макака идентичны; следовательно, данные о связывании с человеческим CGRP также применимы для CGRP яванского макака. G1 также связывается с крысиными CGRP, но с разной аффинностью в отношении способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 - и способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -изоформ (KD=2,57 нМ и <150 пМ, соответственно, при 37°С).

Таблица 1
KD антитела G1, измеренная при 25°С и 37°С, против человеческих и крысиных CGRP
N-биотин-CGRP на чипеТемпература (°С) kon (1/(М×с)) koff (1/c)T1/2 (ч)KD (нМ)
Человеческий способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP/способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP яванского макака25 1,86×1057,80×10 -624,68 0,042
Человеческий способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP/способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -375,87×10 53,63×10-5 5,300,063
CGRP яванского макака способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074
Человеческий способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP/способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP яванского макака37 4,51×105<6,98×10 -52,76<0,155
Крысиный способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP25 5,08×1046,18×10 -53,121,22
Крысиный способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP37 1,55×1053,99×10 -40,482,57
Крысиный способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP37 5,16×105<7,85×10 -52,450,152

Диссоциация Fab-фрагментов G1 от человеческих способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 - и способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP происходит очень медленно. Точное измерение скорости диссоциации как таковой (koff) невозможно без мониторинга фазы диссоциации в течение очень длительного времени. Согласно основному эмпирическому правилу, для определения точной скорости диссоциации необходимо снижение ответа связывания за время диссоциации на по меньшей мере 5%. Однако мониторингу диссоциации в течение длительного времени на Biacore препятствует базовый дрейф показателей, представляющий особенно серьезную проблему при работе с низкими концентрациями молекул на поверхности, что необходимо для кинетических анализов. В данном исследовании фазу диссоциации наблюдали в течение двух часов для способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP, но лишь в течение 20 минут для способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP. В результате скорости диссоциации для способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP не могут быть определены с такой же точностью, как скорости диссоциации для способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP. Тем не менее, при анализе «бок о бок» на одном и том же чипе в идентичных условиях при времени диссоциации 20 минут кинетика связывания G1 с человеческим способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP/способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP яванского макака, человеческим способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP/способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP яванского макака и крысиным способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP была практически одинаковой (KD=150 пМ при 37°С).

Результаты для антитела G2 показаны в Таблице 2 ниже. Антитело G2 связывается с крысиным способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP с большей аффинностью (KD=0,9 нМ при 25°С), чем с человеческими способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 - и способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP (Кспособы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 =19 нМ и 20 нМ, соответственно, при 25°С). Связывание G2 с крысиным способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP в данном анализе не исследовали, но в анализе с обратной ориентацией с крысиным способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP G2 продемонстрировало связывающие свойства, сопоставимые со связывающими свойствами в отношении человеческих способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 - и способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP (данные не показаны).

Таблица 2
KD антитела G2, измеренная при 25°С и 37°С, против человеческих и крысиных CGRP
N-биотин-CGRP на чипеТемпература (°С) kon (1/(M×c)) koff (1/c)Tl/2 (мин)KD (нМ)
Крысиный способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP25 2,31×1052,14×10 -453,98 0,9
Крысиный способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP37 5,0×1051,7×10 -36,803,4
Человеческий способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP25 6,03×1041,15×10 -310,05 19,1
Человеческий способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP37 9,3×1043,9×10 -32,9641,9
Человеческий способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP25 8,14×1041,62×10 -37,1319,9

Анализ связывания проводили для измерения IC50 антитела G1 против CGRP при блокаде связывания человеческого способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP с CGRP1-рецептором. Мембраны (25 мкг) клеток SK-N-MC инкубировали в течение 90 минут при 25°С в инкубационном буфере (50 мМ трис-HCl, рН 7,4, 5 мМ MgCl2, 0,1% бычьего сывороточного альбумина (BSA)), содержащем 10 пМ человеческого способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP, меченного 125I, и различные концентрации антитела против CGRP (0,015 нМ - 33 нМ), в общем объеме 1 мл. Инкубацию завершали фильтрацией через стеклянный микроволоконный фильтр (GF/B, 1 мкм), заблокированный 0,5% полиэтиленимином. Связанную с белками радиоактивность определяли на счетчике гамма-излучения. Строили кривые доза-ответ и значения Ki определяли с использованием уравнения: Ki=IC50/(1+([лиганд]/K D); где равновесная константа диссоциации KD при связывании человеческого способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP с CGRP1-рецептором на клетках SK-N-MC составляла 8 пМ. Для сравнения полученного значения IC50 (относительно молекул IgG) с аффинностью (KD), определенной на Biacore, его корректировали с учетом числа сайтов связывания (умножением на 2, поскольку на Biacore анализировали Fab-фрагменты). Наблюдаемая IC50 (1,8 нМ) была в 23 раза больше КD, наблюдаемой на Biacore (42 пМ) при той же температуре. Это несоответствие отражает возможный недостаток чувствительности анализа связывания.

Пример 3: Модель висцеральной боли

В этом примере показан эффект введения антитела-антагониста против CGRP в модели висцеральной боли.

В данном примере модель интерстициального цистита у крыс использовали для оценки эффекта антитела против CGRP, блокирующего функциональную активность CGRP. В этой модели висцеральную гиперчувствительность измеряли по моторике мочевого пузыря в ответ на его раздражение терпентиновым маслом.

Во время цистометрии самок крыс держали под непрерывной уретановой анестезией. Поддерживали температуру тела 37°С с использованием ректального зонда, термостатически соединенного с грелкой с контролируемой температурой. Одной группе крыс (n=7) внутривенно вводили моноклональное антитело-антагонист против CGRP 4901 (имеющееся в продаже от Sigrna (Missouri, US), номер продукта С7113 (клон #4901)) в концентрации 10 мг/кг. Другой группе (n=7) вводили наполнитель (PBS, 0,01% Tween 20) в качестве отрицательного контроля.

Через двадцать четыре часа после введения 4901 или наполнителя крысам проводили анестезию и трансуретральную катетеризацию мочевого пузыря трубкой РЕ50 (наружный диаметр 1 мм), что позволяло наполнять мочевой пузырь обычным физиологическим раствором со скоростью 0,05 мл/мин (с использованием шприцевого насоса). Проксимальнее мочевого пузыря на трубке было расположено Т-образное соединение, позволявшее проводить мониторинг давления в мочевом пузыре датчиком давления. Для определения моторики мочевого пузыря мониторинг давления и сокращений проводили на протяжении интервала продолжительностью 14 минут (общий объем 0,84 мл). После получения исходной цистометрограммы проводили раздражение мочевого пузыря введением 0,5 мл 50% терпентинового масла на 1 час. Затем мочевой пузырь дренировали и последующие анализы моторики мочевого пузыря проводили непосредственно после (через 1 ч) введения терпентинового масла, через 3 ч и 5 ч после введения терпентинового масла.

У крыс, которым вводили антитело 4901 (10 мг/кг) за 24 часа перед проведением цистометрографии, было меньше сокращений мочевого пузыря во всех временных точках при измерении в сравнении с крысами, которым вводили наполнитель (Фиг.2). Этот результат продемонстрировал, что антитело-антагонист против CGRP эффективно снижало моторику мочевого пузыря в ответ на раздражение терпентиновым маслом, то есть реверсировало боль в модели висцеральной боли.

Депонирование биологического материала

Следующие материалы были депонированы в Американской коллекции типовых культур, 10801 University Boulevard, Manassas, Virginia 20110-2209, USA (ATCC).

Материал № антителаРегистрационный номер в АТССДата депонирования
pDb.CGRP.hFcGIТяжелая цепь G1РТА-6867 15 июля 2005 г.
pEb.CGRP.hKGI Легкая цепь G1РТА-6866 15 июля 2005 г.

Вектор pEb.CGRP.hKGI представляет собой полинуклеотид, кодирующий вариабельную область легкой цепи и константную область легкой цепи-каппа G1; и вектор pDb.CGRP.hFcGI представляет собой полинуклеотид, кодирующий вариабельную область тяжелой цепи G1 и константную область тяжелой цепи lgG2, содержащую следующие мутации: А330Р331 на S330S331 (нумерация аминокислот относительно последовательности lgG2 дикого типа; см. Eur. J. immunol., 1999, 29:2613-2624).

Эти депонирования были проведены в соответствии с положениями Будапештского договора о международном признании депонирования микроорганизмов для целей патентной процедуры и принятыми на их основании нормативными документами (Будапештский договор). Это обеспечивает поддержание жизнеспособности депонированной культуры в течение 30 лет с даты депонирования. ATCC обеспечит доступ к депонированным культурам и материалам согласно условиям Будапештского договора и в соответствии с соглашением между Rinat Neuroscience Corp. и ATCC, обеспечивающим постоянный и неограниченный свободный доступ к потомству депонированной культуры после выдачи соответствующего патента США или после опубликования любой соответствующей заявки на патент США или на патент другого государства, вне зависимости от того, какое из этих условий будет выполнено раньше, и обеспечивает доступ к потомству для лица, право которого на доступ определено комиссаром по патентам и товарным знакам США согласно статье 122 раздела 35 Свода законов США (35 USC Section 122) и соответствующим ей нормативным актам, регулирующим деятельность комиссаров (включая статью 1.14 раздела 37 Свода федеральных нормативных актов (37 CFR Section 1.14) с особой ссылкой на публикацию 886 OG 638 в Официальном бюллетене Патентного ведомства США).

Правопреемник настоящей заявки согласен, что если депонированные культуры или материалы погибнут либо будут утрачены или разрушены при культивировании в подходящих условиях, они будут немедленно заменены другими образцами такой же культуры или материала по уведомлении. Доступность депонированного материала не следует рассматривать как лицензию на практическое использование изобретения в нарушение прав, предоставленных органами власти любых государств согласно их патентным законам.

Ниже приведены последовательности антител, применимые в различных воплощениях, раскрытых здесь.

Последовательности антител

Аминокислотная последовательность вариабельной области тяжелой цепи антитела G1 (SEQ ID NO:1)

EVQLVESGGGLVQPGGSLRLSCAASGFTFSNYWISWVRQAPGKGLEWVAEIRSESDA SATHYAEAVKGRFTISRDNAKNSLYLQMNSLRAEDTAVYYCLAYFDYGLAIQNYWGQG TLVTVSS

Аминокислотная последовательность вариабельной области легкой цепи антитела G1 (SEQ ID NO:2)

ElVLTQSPATLSLSPGERATLSCKASKRVTTYVSWYQQKPGQAPRLLIYGASNRYLGIP ARFSGSGSGTDFTLTISSLEPEDFAVYYCSQSYNYPYTFGQGTKLEIK

CDR H1 антитела G1 (удлиненный CDR) (SEQ ID NO:3)

GFTFSNYWIS

CDR H2 антитела G1 (удлиненный CDR, такой же, как CDR по Kabat) (SEQ ID NO:4)

EIRSESDASATHYAEAVKG

CDR Н3 антитела G1 (SEQ ID NO:5)

YFDYGLAIQNY

CDR L1 антитела G1 (SEQ ID NO:6)

KASKRVTTYVS

CDR 12 антитела G1 (SEQ ID NO:7)

GASNRYL

CDR 13 антитела G1 (SEQ ID NO:8)

SQSYNYPYT

Нуклеотидная последовательность вариабельной области тяжелой цепи антитела G1 (SEQ ID NO:9)

GAAGTTCAGCTGGTTGAATCCGGTGGTGGTCTGGTTCAGCCAGGTGGTTCC

CTGCGTCTGTCCTGCGCTGCTTCCGGTTTCACCTTCTCCAACTACTGGATCT

CCTGGGTTCGTCAGGCTCCTGGTAAAGGTCTGGAATGGGTTGCTGAAATCC

GTTCCGAATCCGACGCGTCCGCTACCCATTACGCTGAAGCTGTTAAAGGTC

GTTTCACCATCTCCCGTGACAACGCTAAGAACTCCCTGTACCTGCAGATGAA

CTCCCTGCGTGCTGAAGACACCGCTGTTTACTACTGCCTGGCTTACTTTGAC

TACGGTCTGGCTATCCAGAACTACTGGGGTCAGGGTACCCTGGTTACCGTT

TCCTCC

Нуклеотидная последовательность вариабельной области легкой цепи антитела G1 (SEQ ID NO:10)

GAAATCGTTCTGACCCAGTCCCCGGCTACCCTGTCCCTGTCCCCAGGTGAA

CGTGCTACCCTGTCCTGCAAAGCTTCCAAACGGGTTACCACCTACGTTTCCT

GGTACCAGCAGAAACCCGGTCAGGCTCCTCGTCTGCTGATCTACGGTGCTT

CCAACCGTTACCTCGGTATCCCAGCTCGTTTCTCCGGTTCCGGTTCCGG1A

CCGACTTCACCCTGACCATCTCCTCCCTGGAACCCGAAGACTTCGCTGTTTA

CTACTGCAGTCAGTCCTACAACTACCCCTACACCTTCGGTCAGGGTACCAAA

CTGGAAATCAAA

Полноразмерная аминокислотная последовательность тяжелой цепи антитела G1 (включая модифицированный lgG2, как описано здесь) (SEQ ID NO:11)

EVQLVESGGGLVQPGGSLRLSCAASGFTFSNYWISWVRQAPGKGLEWVAEIR

SESDASATHYAEAVKGRFTISRDNAKNSLYLQMNSLRAEDTAVYYCLAYFDYGL

AIQNYWGQGTLVTVSSASTKGPSVFPLAPCSRSTSESTAALGCLVKDYFPEPVT

VSWNSGALTSGVHTFPAVLQSSGLYSLSSWTVPSSNFGTQTYTCNVDHKPSN

TKVDKWERKCCVECPPCPAPPVAGPSVFLFPPKPKDTLMISRTPEVTCWVDV

SHEDPEVQFNWVVDGVEVHNAKTKPREEQFNSTFRWSVLTWHQDWLNGKE

YKCKVSNKGLPSSIEKTISKTKGQPREPQVYTLPPSREEMTKNQVSLTCLVKGF

YPSDIAVEWESNGQPENNYKT7PPMLDSDGSFFLYSKLTVDKSRWQQGNVFS

CSVMHEALHNHYTQKSLSLSPGK

Полноразмерная аминокислотная последовательность легкой цепи антитела G1 (SEQ ID NO:12)

EIVLTQSPATLSLSPGERATLSCKASKRVTTYVSWYQQKPGQAPRLUYGASNR YLGIPARFSGSGSGTDFTLTISSLEPEDFAVYYCSQSYNYPYTFGQGTKLEIKRT VAAPSVFIFPPSDEQLKSGTASWCLLNNFYPREAKVQWKVDNALQSGNSQES VTEQDSKDSTYSLSSTLTLSKADYEKHKVYACEVTHQGLSSPVTKSFNRGEC

Полноразмерная нуклеотидная последовательность тяжелой цепи антитела G1 (включая модифицированный lgG2, как описано здесь) (SEQ ID NO:13)

GAAGTTCAGCTGGTTGAATCCGGTGGTGGTCTGGTTCAGCCAGGTGGTTCC

CTGCGTCTGTCCTGCGCTGCTTCCGGTTTCACCTTCTCCAACTACTGGATCT

CCTGGGTTCGTCAGGCTCCTGGTAAAGGTCTGGAATGGGTTGCTGAAATCC

GTTCCGAATCCGACGCGTCCGCTACCCATTACGCTGAAGCTGTTAAAGGTC

G1TTCACCATCTCCCGTGACAACGCTAAGAACTCCCTGTACCTGCAGATGAA

CTCCCTGCGTGCTGAAGACACCGCTGTTTACTACTGCCTGGCTTACTTTGAC

TACGGTCTGGCTATCCAGAACTACTGGGGTCAGGGTACCCTGGTTACCGTT

TCCTCCGCCTCCACCAAGGGCCCATCTGTCTTCCCACTGGCCCCATGCTCC

CGCAGCACCTCCGAGAGCACAGCCGCCCTGGGCTGCCTGGTCAAGGACTA

CTTCCCAGAACCTGTGACCGTGTCCTGGAACTCTGGCGCTCTGACCAGCGG

CGTGCACACCTTCCCAGCTGTCCTGCAGTCCTCAGGTCTCTACTCCCTCAG

CAGCGTGGTGACCGTGCCATCCAGCAACTTCGGCACCCAGACCTACACCT

GCAACGTAGATCACAAGCCAAGCAACACCAAGGTCGACAAGACCGTGGAG

AGAAAGTGTTGTGTGGAGTGTCCACCTTGTCCAGCCCCTCCAGTGGCCGGA

CCATCCGTGTTCCTGTTCCCTCCAAAGCCAAAGGACACCCTGATGATCTCCA

GAACCCCAGAGGTGACCTGTGTGGTGGTGGACGTGTCCCACGAGGACCCA

GAGGTGCAGTTCAACTGGTATGTGGACGGAGTGGAGGTGCACAACGCCAA

GACCAAGCCAAGAGAGGAGCAGTTCAACTCCACCTTCAGAGTGGTGAGCGT

GCTGACCGTGGTGCACCAGGACTGGCTGAACGGAAAGGAGTATAAGTGTA

AGGTGTCCAACAAGGGACTGCCATCCAGCATCGAGAAGACCATCTCCAAGA

CCAAGGGACAGCCAAGAGAGCCACAGGTGTATACCCTGCCCCCATCCAGA

GAGGAGATGACCAAGAACCAGGTGTCCCTGACCTGTCTGGTGAAGGGATTC

TATCCATCCGACATCGCCGTGGAGTGGGAGTCCAACGGACAGCCAGAGAA

CAACTATAAGACCACCCCTCCAATGCTGGACTCCGACGGATCCTTCTTCCTG

TATTCCAAGCTGACCGTGGACAAGTCCAGATGGCAGCAGGGAAACGTGTTC

TCTTGTTCCGTGATGCACGAGGCCCTGCACAACCACTATACCCAGAAGAGC

CTGTCCCTGTCTCCAGGAAAGTAA

Полноразмерная нуклеотидная последовательность легкой цепи антитела G1 (SEQ ID NO:14)

GAAATCGTTCTGACCCAGTCCCCGGCTACCCTGTCCCTGTCCCCAGGTGAA

CGTGCTACCCTGTCCTGCAAAGCTTCCAAACGGGTTACCACCTACGTTTCCT

GGTACCAGCAGAAACCCGGTCAGGCTCCTCGTCTGCTGATCTACGGTGCTT

CCAACCGTTACCTCGGTATCCCAGCTCGTTTCTCCGGTTCCGGTTCCGGTA

CCGACTTCACCCTGACCATCTCCTCCCTGGAACCCGAAGACTTCGCTGTTTA

CTACTGCAGTCAGTCCTACAACTACCCCTACACCTTCGGTCAGGGTACCAA

ACTGGAAATCAAACGCACTGTGGCTGCACCATCTGTCTTCATCTTCCCTCCA

TCTGATGAGCAGTTGAAATCCGGAACTGCCTCTGTTGTGTGCCTGCTGAATA

ACTTCTATCCGCGCGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCC

AATCCGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGC

ACCTACAGCCTCAGCAGCACCCTGACCCTGAGCAAAGCAGACTACGAGAAA

CACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGAGTTCTCCAGTC

ACAAAGAGCTTCAACCGCGGTGAGTGCTAA

Сравнение аминокислотных последовательностей человеческого и крысиного CGRP (человеческого способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP (SEQ ID NO:15); человеческого способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP (SEQ ID NO:16): крысиного способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP (SEQ ID NO:17) и крысиного способы лечения висцеральной боли путем введения антител-антагонистов,   направленных против пептида, связанного с геном кальцитонина, патент № 2535074 -CGRP (SEQ ID NO:18))

NH2-ACDTATCVTHRLAGLLSRSGGVVKNNFVPTNVGSKAF-CONH 2 (SEQ ID

NO:15)

NH 2-ACNTATCVTHRLAGLLSRSGGMVKSNFVPTNVGSKAF-CONH2 (SEQ ID

NO:16)

NH2 -SCNTATCVTHRLAGLLSRSGGVVKDNFVPTNVGSEAF-CONH2 (SEQ ID

NO:17)

NH2-SCNTATCVTHRLAGLLSRSGGVVKDNFVPTNVGSKAF-CONH 2 (SEQ ID

NO:18)

Аминокислотная последовательность вариабельной области тяжелой цепи антитела G2 (SEQ IP NO:19)

EVQLQQSGPELVKPGASVKMSCKASGYTFTSSVMHWVKQKPGQGLEWIGYIN

PYNDGTKYNEKFKGKATLTSDKSSSTAYMELSSLTSEDSAVYYCAKGGNDGY

WGQGTTLTVSS

Аминокислотная последовательность вариабельной области легкой цепи антитела G2 (SEQ ID NO:20)

EIVLTQSPTTMAASPGEKITITCSASSSISSIYLHWYQQKPGFSPKVLIYRASNLA SGVPARFSGSGSGTSYSLTIGTMEAEDVATYYCQQGSTIPFTFGSGTKLEIK

CDR H1 антитела G2 (CDR no Kabat) (SEQ ID NO:21)

SSVMH

CDR H2 антитела G2 (удлиненный CDR) (SEQ ID NO:22)

YINPYNDGTKYNEKFKG

CDR Н3 антитела G2 (SEQ ID NO:23)

GGNDGY

CDR L1 антитела G2 (SEQ ID NO:24)

SASSSISSIYLH

CDR L2 антитела G2 (SEQ ID NO:25)

RASNLAS

CDR L3 антитела G2 (SEQ ID NO:26)

QQGSTIPFT

Нуклеотидная последовательность вариабельной области тяжелой цепи антитела G2 (SEQ ID NO:27)

GAGGTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTAAAGCCTGGGGCTTC

AGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTCACTAGCTCTGTTATG

CACTGGGTGAAGCAGAAGCCTGGGCAGGGCCTTGAGTGGATTGGATATATT

AATCCTTACAATGATGGTACTAAGTACAATGAGAAGTTCAAAGGCAAGGCCA

CACTGACTTCAGACAAATCCTCCAGCACAGCCTACATGGAACTCAGCAGCC

TGACCTCTGAGGACTCTGCGGTCTATTACTGTGCAAAAGGGGGTAACGATG

GCTACTGGGGCCAAGGCACTACTCTCACAGTCTCCTCA

Нуклеотидная последовательность вариабельной области легкой цепи антитела G2 (SEQ ID NO:28)

GAAATTGTGCTCACCCAGTCTCCAACCACCATGGCTGCATCTCCCGGGGAG

AAGATCACTATCACCTGTAGTGCCAGCTCAAGTATAAGTTCCATTTACTTGC

ATTGGTATCAGCAGAAGCCAGGATTCTCCCCTAAAGTCTTGATTTATAGGGC

ATCCAATCTGGCTTCTGGAGTCCCAGCTCGCTTCAGTGGCAGTGGGTCTGG

GACCTCTTACTCTCTCACAATTGGCACCATGGAGGCTGAAGATGTTGCCACT

TACTACTGCCAGCAGGGTAGTACTATACCATTCACGTTCGGCTCGGGGACA

AAGTTGGAAATAAAA

Полноразмерная аминокислотная последовательность тяжелой цепи антителаG2 (не включая Fc-домен) (SEQ IP NO:29)

EVQLQQSGPELVKFGASVKMSCKASGYTFTSSVMHWVKQKP(3QGLEWIQYIN

PYNDGTKYNEKFKGKATLTSDKSSSTAYMELSSSLTSEDSAVYYCAKGGNDGY

WGQGTTLTVSSAKTTPPSVYPLAPGSAAQTNSMVTLGCLVKGYFPEPVTVTWN

SGSLSSGVHTFPAVLQSDLYTLSSSVTVPSSTWPSETVTCNVAHPASSTKVDK

KIVPRD

Полноразмерная аминокислотная последовательность легкой цепи антитела G2 (SEQ ID NO:30)

E1VLTQSPTTMAASPGEKITITCSASSSISSIYLHWYQQKPGFSPKVLIYRASNLA SGVPARFSGSGSGTSYSLTIGTMEAEDVATYYCQQGSTIPFTFGSGTKLE1KRA DAAPTVS1FPPSSEQLTSGGASVVCFLNNFYPRD1NVKWKIDGSERQNGVLNS WTDQDSKDSTYSMSSTLTLTKDEYERHNSYTCEATHKTSTSPIVKSFNRNEC

Полноразмерная нуклеотидная последовательность тяжелой цепи антитела G2 (не включая Fc-домен) (SEQ ID NO:31)

GAGGTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTAAAGCCTGGGGCTTC

AGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTCACTAGCTCTGTTATG

CACTGGGTGAAGCAGAAGCCTGGGCAGGGCCTTGAGTGGATTGGATATATT

AATCCTTACAATGATGGTACTAAGTACAATGAGAAGTTCAAAGGCAAGGCCA

CACTGACTTCAGACAAATCCTCCAGCACAGCCTACATGGAACTCAGCAGCC

TGACCTCTGAGGACTCTGCGGTCTATTACTGTGCAAAAGGGGGTAACGATG

GCTACTGGGGCCAAGGCACTACTCTCACAGTCTCCTCAGCCAAAACGACAC

CCCCATCTGTCTATCCACTGGCCCCTGGATCTGCTRCCCAAACTAACTCCAT

GGTGACCCTGGGATGCCTGGTCAAGGGCTATTTCCCTGAGCCAGTGACAGT

GACCTGGAACTCTGGATCCCTGTCCAGCGGTGTGCACACCTTCCCAGCTGT

CCTGCAGTCTGACCTCTACACTCTGAGCAGCTCAGTGACTGTCCCCTCCAG

CACCTGGCCCAGCGAGACCGTCACCTGCAACGTTGCCCACCCGGCCAGCA

GCACCAAGGTGGACAAGAAAATTGTGCCCAGGGAT

Полноразмерная нуклеотидная последовательность легкой цепи антитела G2 (SEQ ID NO:32)

GAAATTGTGCTCACCCAGTCTCCAACCACCATGGCTGCATCTCCCGGGGAG

AAGATCACTATCACCTGTAGTGCCAGCTCAAGTATAAGTTCCATTTACTTGC

ATTGGTATCAGCAGAAGCCAGGATTCTCCCCTAAAGTCTTGATTTATAGGGC

ATCCAATCTGGCTTCTGGAGTCCCAGCTCGCTTCAGTGGCAGTGGGTCTGG

GACCTCTTACTCTCTCACAATTGGCACCATGGAGGCTGAAGATGTTGCCACT

TACTACTGCCAGCAGGGTAGTACTATACCATTCACGTTCGGCTCGGGGACA

AAGTTGGAAATAAAACGGGCTGATGCTGCACCAACTGTATCCATCTTCCCAC

CATCCAGTGAGCAGTTAACATCTGGAGGTGCCTCAGTCGTGTGCTTCTTGA

ACAACTTCTACCCCAGAGACATCAATGTCAAGTGGAAGATTGATGGCAGTG

AACGACAAAATGGTGTCCTGAACAGTTGGACTGATCAGGACAGCAAAGACA

GCACCTACAGCATGAGCAGCACCCTCACATTGACCAAGGACGAGTATGAAC

GACATAACAGCTATACCTGTGAGGCCACTCACAAGACATCAACTTCACCCAT

CGTCAAGAGCTTCAACAGGAATGAGTGTTAA

CDR H1 антитела G1 (CDR no Chothia) (SEQ ID NO:33)

GFTFSNY

CDR H1 антитела G1 (CDR по Kabat) (SEQ ID NO:34)

NYWIS

CDR H2 антитела G1 (CDR no Chothia) (SEQ ID NO:35)

RSESUASA

CDR H1 антитела G2 (удлиненный CDR) (SEQ ID NO:36)

GYTFTSSVMH

CDR H1 антитела G2 (CDR no Chothia) (SEQ ID NO:37)

GYTFTSS CDR H2 антитела G2 (CDR no Chothia) (SEQ ID NO:38)

NPYNDG

Несмотря на то, что раскрытое изобретение было описано со ссылкой на различные применения, способы, наборы и композиции, следует понимать, что различные изменения и модификации могут быть проведены без отступления от раскрытого здесь изобретения и приведенной ниже формулы изобретения. Описанные выше примеры приведены для лучшей иллюстрации раскрытого изобретения, и подразумевают, что они не ограничивают объем изобретения, представленного здесь. Несмотря на то, что настоящее изобретение было описано посредством этих типичных воплощений, специалист в данной области техники будет ясна возможность множества вариаций и модификаций этих типичных воплощений без чрезмерных экспериментов. Все такие вариации и модификации входят в объем настоящего изобретения.

Заголовки разделов, использованные здесь, приведены лишь в организационных целях, и их не следует толковать как каким-либо образом ограничивающие описываемый объект изобретения. Следует понимать, что перед температурами, концентрациями, промежутками времени и так далее, указанными в настоящем изобретении, подразумевают «приблизительно», то есть незначительные и несущественные отклонения от указанных значений входят в объем настоящего изобретения. В данной заявке использование единственного числа включает множественное, если специально не указано иное. Кроме того, подразумевают, что термины «включать», «включает», «включающий», «содержать», «содержит» и «содержащий» не являются ограничивающими. Следует понимать, что как предшествующее общее описание, так и следующее за ним подробное описание приведены лишь в качестве примеров и пояснений и не ограничивают изобретение.

Все ссылки, приведенные здесь, включая патенты, заявки на патенты, публикации, руководства и тому подобное и приведенные в них ссылки, полностью включены сюда посредством ссылки. В случае, если один или более из включенных литературных источников и подобных материалов отличается от данной заявки или противоречит ей, включая, без ограничения, определенные термины, использование терминов, описанные методики или тому подобное, предпочтительны варианты, приведенные в данной заявке.

В предшествующем описании и Примерах подробно описаны конкретные воплощения изобретения в наилучшей, с точки зрения авторов изобретения, форме. Тем не менее, следует понимать, что, независимо от подробности приведенных выше описаний и примеров, возможны многие варианты практического использования изобретения, и изобретение следует рассматривать согласно прилагаемой формуле изобретения и любым ее эквивалентам.

ФОРМУЛА ИЗОБРЕТЕНИЯ

1. Способ лечения висцеральной боли и/или одного или более чем одного симптома висцеральной боли у индивида, включающий введение терапевтически эффективного количества антитела-антагониста против пептида, связанного с геном кальцитонина (CGRP), индивиду, страдающему от висцеральной боли, или индивиду с риском висцеральной боли, где антитело-антагонист против CGRP изготовлено для периферического введения.

2. Способ по п.1, где висцеральная боль связана с функциональным расстройством кишечника (ФРК).

3. Способ по п.2, где ФРК выбрано из группы, состоящей из гастроэзофагеального рефлюкса, диспепсии, синдрома раздраженного кишечника (СРК) и синдрома функциональной абдоминальной боли (СФАБ).

4. Способ по п.1, где висцеральная боль связана с воспалительным заболеванием кишечника (ВЗК).

5. Способ по п.4, где ВЗК выбрано из группы, состоящей из болезни Крона, илеита и неспецифического язвенного колита.

6. Способ по п.1, где висцеральная боль связана с почечной коликой, дисменореей, циститом, менструацией, родами, менопаузой, простатитом или панкреатитом.

7. Способ по п.6, где висцеральная боль связана с интерстициальным циститом (ИЦ).

8. Способ по п.1, где антитело-антагонист против CGRP связывается с CGRP с KD 50 нМ или менее (как измерено поверхностным плазменным резонансом при 37°C) и/или имеет период полувыведения in vivo по меньшей мере 7 суток.

9. Способ по п.1, где антитело-антагонист против CGRP специфично связывается с C-концевой областью CGRP.

10. Способ по п.9, где антитело-антагонист против CGRP специфично распознает эпитоп, определенный последовательностью GSKAF (SEQ ID NO: 39).

11. Способ по п.1, где антитело против CGRP содержит вариабельный домен тяжелой цепи (VH), имеющий аминокислотную последовательность, показанную в SEQ ID NO:1 или 19.

12. Способ по п.1, где антитело против CGRP содержит вариабельный домен легкой цепи (VL), имеющий аминокислотную последовательность, показанную в SEQ ID NO:2 или 20.

13. Способ по п.1, где антитело против CGRP содержит по меньшей мере один гипервариабельный участок (CDR), выбранный из группы, состоящей из:

а) гипервариабельного участка 1 тяжелой цепи (CDR H1), как изложено в SEQ ID NO:3, 21, 33, 34, 36 или 37;

б) гипервариабельного участка 2 тяжелой цепи (CDR H2), как изложено в SEQ ID NO:4, 22, 35 или 38;

в) гипервариабельного участка 3 тяжелой цепи (CDR H3), как изложено в SEQ ID NO:5 или 23;

г) гипервариабельного участка 1 легкой цепи (CDR L1), как изложено в SEQ ID NO:6 или 24;

д) гипервариабельного участка 2 легкой цепи (CDR L2), как изложено в SEQ ID NO:7 или 25; и

е) гипервариабельного участка 3 легкой цепи (CDR L3), как изложено в SEQ ID NO:8 или 26.

14. Способ по п.1, где антитело против CGRP содержит домен VH, имеющий аминокислотную последовательность, показанную в SEQ ID NO:1, и домен VL, имеющий аминокислотную последовательность, показанную в SEQ ID NO:2.

15. Способ по п.1, где антитело против CGRP получено с использованием векторов экспрессии с регистрационными номерами в Американской коллекции типовых культур (АТСС) РТА-6867 и/или РТА-6866.

16. Способ по п.1, где антитело против CGRP содержит:

полноразмерную аминокислотную последовательность тяжелой цепи антитела G1, показанную в SEQ ID NO:11, с C-концевым лизином или без него; и

полноразмерную аминокислотную последовательность легкой цепи антитела G1, показанную в SEQ ID NO:12.

17. Способ по п.1, где антитело против CGRP содержит:

полноразмерную аминокислотную последовательность тяжелой цепи антитела G2, показанную в SEQ ID NO:29; и

полноразмерную аминокислотную последовательность легкой цепи антитела G2, показанную в SEQ ID NO:30.

18. Фармацевтическая композиция для лечения и/или предотвращения висцеральной боли и/или симптомов висцеральной боли у индивида, содержащая антитело-антагонист против CGRP и фармацевтически приемлемый носитель, изготовленная для периферического введения.


Скачать патент РФ Официальная публикация
патента РФ № 2535074

patent-2535074.pdf
Патентный поиск по классам МПК-8:

Класс A61K39/395 антитела; иммуноглобулины; иммунные сыворотки, например антилимфоцитные сыворотки

Патенты РФ в классе A61K39/395:
лекарственное средство для лечения патологического синдрома и способ лечения острых и хронических заболеваний дыхательноый системы и синдрома кашля -  патент 2529783 (27.09.2014)
лечение опухолей с помощью антитела к vegf -  патент 2528884 (20.09.2014)
антитела, узнающие углеводсодержащий эпитоп на cd43 и сеа, экспрессируемых на раковых клетках и способы их применения -  патент 2528738 (20.09.2014)
антитела против альфа5-бета 1 и их применение -  патент 2528736 (20.09.2014)
антагонисты pcsk9 -  патент 2528735 (20.09.2014)
способ лечения больных с синдромом диспепсии в сочетании с избыточной массой тела -  патент 2528641 (20.09.2014)
средство для лечения аутоиммунных заболеваний -  патент 2528337 (10.09.2014)
фармацевтическая композиция и способ лечения острых и хронических заболевания дыхательной системы и синдрома кашля -  патент 2528093 (10.09.2014)
способ лечения жирового гепатоза кошек -  патент 2527700 (10.09.2014)
способ комбинированного лечения ретиноваскулярного макулярного отека -  патент 2527360 (27.08.2014)

Класс C07K16/26 против гормонов

Патенты РФ в классе C07K16/26:
способы лечения хронической боли -  патент 2522493 (20.07.2014)
антитело к эритропоэтину человека (варианты) и продуцирующий моноклональное антитело к эритропоэтину штамм гибридомы -  патент 2513689 (20.04.2014)
антитела и пептидные антигены для получения антител, имеющих селективную специфичность связывания с биологически активным интактным паратиреоидным гормоном (птг(ртн))1-84 -  патент 2460737 (10.09.2012)
специфические антитела для диагностики сердечной недостаточности -  патент 2315773 (27.01.2008)
агонисты рецептора кортикотропин-рилизинг фактора 2 и их применение -  патент 2305110 (27.08.2007)
агонисты рецептора кортикотропин-рилизинг фактора 2 (crf 2r) применение -  патент 2294333 (27.02.2007)
способ обнаружения n-концевого про-мнп -  патент 2218568 (10.12.2003)
антитело против белка, родственного паращитовидному гормону человека, днк, вектор, способ получения и использование антитела -  патент 2198220 (10.02.2003)

Класс A61P9/08 вазодилататоры для широких показаний

Патенты РФ в классе A61P9/08:
способы и составы для лечения субарахноидального кровоизлияния коронарной и артериальной аневризмы -  патент 2528097 (10.09.2014)
коронародилатирующее лекарственное средство -  патент 2526118 (20.08.2014)
способ эндотелиопротекции апи-фитокомпозицией -  патент 2524799 (10.08.2014)
способ коррекции эндотелиальной дисфункции азитромицином при adma-подобной модели гестоза в эксперименте -  патент 2507595 (20.02.2014)
способ коррекции l-name индуцированного дефицита оксида азота комбинацией тадалафила и l-норвалина в эксперименте -  патент 2500040 (27.11.2013)
способ коррекции эндотелиальной дисфункции раствором гомеопатических разведений антител к с-концевому фрагменту рецептора ангиотензина ii -  патент 2482546 (20.05.2013)
способ и композиция для лечения заболеваний периферических сосудов -  патент 2481841 (20.05.2013)
способ коррекции эндотелиальной дисфункции смесью гелия с кислородом при l-name индуцированном дефиците оксида азота -  патент 2479873 (20.04.2013)
способ коррекции эндотелиальной дисфункции раствором гомеопатических разведений антител к фактору некроза опухоли-альфа -  патент 2478233 (27.03.2013)
способ коррекции эндотелиальной дисфункции раствором гомеопатических разведений антител к интерлейкину-6 -  патент 2477530 (10.03.2013)

Класс A61P29/00 Анальгетики нецентрального действия, жаропонижающие или противовоспалительные средства, например противоревматические средства; нестероидные противовоспалительные средства (НПВС)

Патенты РФ в классе A61P29/00:
ациламино-замещенные производные конденсированных циклопентанкарбоновых кислот и их применение в качестве фармацевтических средств -  патент 2529484 (27.09.2014)
модулирующие jak киназу хиназолиновые производные и способы их применения -  патент 2529019 (27.09.2014)
способ повышения адаптационных возможностей предстательной железы крыс при действии низких сезонных температур -  патент 2528906 (20.09.2014)
новые бензолсульфонамидные соединения, способ их получения и применение в терапии и косметике -  патент 2528826 (20.09.2014)
новое производное пиразол-3-карбоксамида, обладающее антагонистической активностью в отношении рецептора 5-нт2в -  патент 2528406 (20.09.2014)
соединения и способы лечения боли и других заболеваний -  патент 2528333 (10.09.2014)
средство пептидной структуры, обладающее анальгетическим, противовоспалительным действием, и лекарственные формы на его основе -  патент 2528094 (10.09.2014)
2, 5-дизамещенные арилсульфонамидные антагонисты ссr3 -  патент 2527165 (27.08.2014)
1-(4-этилфенил)-2-[3-(4-этилфенил)-2-(1н)-хиноксалинилиден]-1-этанон, обладающий анальгетической активностью -  патент 2525397 (10.08.2014)
средство для лечения ревматоидного артрита -  патент 2524152 (27.07.2014)


Наверх