ПАТЕНТНЫЙ ПОИСК В РФ
НОВЫЕ ПАТЕНТЫ, ЗАЯВКИ НА ПАТЕНТ
БИБЛИОТЕКА ПАТЕНТОВ НА ИЗОБРЕТЕНИЯ

штамм вируса гриппа а/17/виктория/2011/89 (h3n2) для производства живой гриппозной интраназальной вакцины для взрослых и для детей

Классы МПК:C12N7/00 Вирусы, например бактериофаги; их композиции; приготовление или очистка их
A61K39/145 Orthomyxoviridae, например вирус гриппа
Автор(ы):, , , , ,
Патентообладатель(и):Федеральное государственное бюджетное учреждение "Научно-исследовательский институт эскпериментальной медицины" Северо-западного отделения Российской Академии медицинских наук (ФГБУ "НИИЭМ" СЗО РАМН) (RU)
Приоритеты:
подача заявки:
2012-07-17
публикация патента:

Изобретение относится к медицинской вирусологии и биотехнологии. Штамм А/17/Виктория/2011/89 (H3N2) активно размножается в развивающихся куриных эмбрионах при оптимальной температуре 32°С. Характеризуется температурочувствительностью и холодоадаптированностью. Реассортант унаследовал гены, кодирующие поверхностные антигены вируса гемагглютинин (НА) и нейраминидазу (NA), от эпидемического родительского вируса и остальные шесть генов, кодирующих внутренние негликозилированные белки, от донора аттенуации. Штамм депонирован в Государственной коллекции вирусов ФГБУ «Научно-исследовательский институт вирусологии им. Д.И. Ивановского» под номером 2724. Изобретение может быть использовано в практическом здравоохранении для профилактики заболеваемости сезонным гриппом среди взрослых и детей с помощью живой гриппозной интраназальной вакцины из указанного штамма. 1 ил., 6 табл., штамм вируса гриппа а/17/виктория/2011/89 (h3n2) для производства   живой гриппозной интраназальной вакцины для взрослых и для детей, патент № 2532844

Рисунки к патенту РФ 2532844

штамм вируса гриппа а/17/виктория/2011/89 (h3n2) для производства   живой гриппозной интраназальной вакцины для взрослых и для детей, патент № 2532844

Изобретение относится к медицинской вирусологии и может быть использовано в здравоохранении для профилактики заболеваемости гриппом среди взрослых и детей с помощью живой гриппозной интраназальной вакцины из штамма вируса гриппа А, семейства Orthomyxoviridae, рода Influenzavirus А, А/17/Виктория/2011/89 (H3N2).

Известный вакцинный штамм вируса гриппа А/17/Брисбен/07/1 сероподтипа (H3N2) - прототип изобретения [Патент РФ № 2416640, дата приоритета 11.01.2010. Опубл. БИ № 11, 2011, 27.06.2011] - утратил антигенную актуальность и, вследствие этого, не сможет вызвать защитную реакцию во время эпидемии гриппа, вызванной штаммом вируса гриппа, аналогичным вирусу А/Виктория/361/2011 (H3N2).

Задачей, на решение которой направлено заявляемое изобретение, является получение вакцинного штамма актуальной антигенной разновидности для взрослых и для детей на основе нового дрейфового варианта вируса гриппа А/Виктория/361/2011 (H3N2). Штаммы вирусов гриппа для живых вакцин, применяемые в настоящее время, получают методом генетической реассортации эпидемически актуальных вирусов с холодоадаптированными штаммами - донорами аттенуации [Александрова Г.И. Применение метода генетической рекомбинации для получения вакцинных штаммов вируса гриппа // Вопр. Вирусол. - 1977. - № 4. - С.387-395.]. Донором аттенуации для гриппозных вакцин типа А является А/Ленинград/13 4/17/57 (H2N2) -холодоадаптированный (са) температурочувствительный (ts) штамм вируса гриппа, разрешенный для получения безвредных живых интраназальных вакцин для взрослых и детей [Александрова Г.И., Климов А.И. Живая вакцина против гриппа. - СПб.: Наука. - 1994. 151 с.].

Цель реассортации - получить штамм с вакцинной формулой генома 6:2. Гены, кодирующие антигенно значимые поверхностные белки вируса гриппа гемагглютинин (НА) и нейраминидазу (NA), наследуются от циркулирующего эпидемического вируса, а шесть генов, кодирующих внутренние и неструктурные белки (РВ2, РВ1, PA, NP, M, NS), от безопасного донора аттенуации.

В результате предлагаемого изобретения получен вакцинный штамм А/17/Виктория/2011/89 (H3N2), для чего использовали метод генетической реассортации эпидемического вируса А/Виктория/361/2011 (H3N2) с донором аттенуации А/Ленинград/134/17/57 (H2N2). Изобретение осуществили посредством инфицирования развивающихся куриных эмбрионов (РКЭ) смесью родительских вирусов в эквивалентных инфекционных дозах и последующей селекции клонов с заданными свойствами при пониженной до 25°С температуре инкубации в присутствии антисыворотки к донору аттенуации. Клоны дополнительно очищали трехкратным клонированием методом предельных разведений под прессом антисыворотки к донору при пониженной (25°С) и оптимальной (32°С) температурах инкубации. Чистые клоны были проверены по фенотипическим характеристикам (ts-, са-фенотип) и по формуле генома на соответствие требованиям к вакцинному штамму.

Заявляемый вакцинный штамм характеризуется следующими свойствами. Ответственный за антигенную специфичность поверхностный белок вакцинного штамма - гемагглютинин (НА) - в РТГА идентичен вирусу А/Виктория/361/2011 (H3N2), антисывороткой к которому полностью нейтрализуется.

Формула генома 6:2 вакцинного штамма А/17/Виктория/2011/89 (H3N2) соответствует требованиям, предъявляемым к штаммам живой гриппозной вакцины, т.е. гены, кодирующие поверхностные белки НА и NA, принадлежат эпидемическому родительскому вирусу А/Виктория/361/2011 (H3N2), а гены, кодирующие внутренние

Таблица 1
Праймеры для скрининга реассортантных вирусов гриппа сероподтипа A (H3N2) - кандидатов в живую вакцину на основе эпидемически актуального вируса и донора аттенуации
Сегмент геномаРодительский вирус Нуклеотидная позиция Последовательность прямого праймера (5'штамм вируса гриппа а/17/виктория/2011/89 (h3n2) для производства   живой гриппозной интраназальной вакцины для взрослых и для детей, патент № 2532844 3')Последовательность обратного праймера (5'штамм вируса гриппа а/17/виктория/2011/89 (h3n2) для производства   живой гриппозной интраназальной вакцины для взрослых и для детей, патент № 2532844 3')
штамм вируса гриппа а/17/виктория/2011/89 (h3n2) для производства   живой гриппозной интраназальной вакцины для взрослых и для детей, патент № 2532844 ЭВa 1477-2115GGTGTGGATGAATACTCCAGTA CATATCCCTCATGCACADTTAGC
РВ2 донор attb 1273-2118GGTGATCTGAATTTCGTTAATAGG GCCCATTTTGCTGACTCTTAAC
РВ1ЭВ1755-2223 GAAGCTGTGGGATCAAACCCAA GTTAATGCTCTAATTAGGTAAC
штамм вируса гриппа а/17/виктория/2011/89 (h3n2) для производства   живой гриппозной интраназальной вакцины для взрослых и для детей, патент № 2532844 донор att 1206-2169TCTCCTAATAGATGGCACAGTC AGTTTGGTCCTCCATCCGAAAT
PA ЭВ970-1851 GGATGGAAAGAACCTTATATAGTCGCCTGAACAATGAGGAGCAAC
штамм вируса гриппа а/17/виктория/2011/89 (h3n2) для производства   живой гриппозной интраназальной вакцины для взрослых и для детей, патент № 2532844 донор att 914-1712ACGAAGGAGAGGGAATACCAC GTCCTGCAGTTCTGCCAGTAAT
ид ЭВ29-593 CATGAAGACCATCATTGCTTTGAGCTACCCACCCATCTACCATTCC
tLrдонор att6-858AAGCAGGGGTTATACCATAGACAACCAAAA CCTTCTGTTTTCATGATCCCTGAACTACCT
NPЭВ 135-1122GAAGATGATTGATGGAATTGGGA GATCCTTCATTACTCATGTCAAAG
штамм вируса гриппа а/17/виктория/2011/89 (h3n2) для производства   живой гриппозной интраназальной вакцины для взрослых и для детей, патент № 2532844 донор att 640-1331CGTGGGATCAATGATCGGAAC GAAAGTTTCCCCCTTGGGAT
NA ЭВ34-568AAAGATAATAACRATTGGCTCTGTT TATTTTAGTACAGCCAC
штамм вируса гриппа а/17/виктория/2011/89 (h3n2) для производства   живой гриппозной интраназальной вакцины для взрослых и для детей, патент № 2532844 донор att 902-1334TGGAAAGGCTCTAATAGGCCCGTTA CCATCAGTCATTACTACTG
MЭВ51-547 CGTATGTTCTCTCTATCGTTCCA CACATATAAGGCCAAATGCTGA
штамм вируса гриппа а/17/виктория/2011/89 (h3n2) для производства   живой гриппозной интраназальной вакцины для взрослых и для детей, патент № 2532844 донор att 53-887TACGTTCTCTCTATCGTCCCG TTTTCAGACCGTGTTTAAAGAAG
мс ЭВ86-78 ACAAGTTGTAGACCAAGAACTGAAGCCATCTTATTTCTTCAAACTTC
11 0донор att13-726GTGACAAAGACATAATGGATCCT ATTTGCTCAAAACTATTCTCTGTTA
a - Эпидемически актуальные вирусы гриппа А сероподтипа (H3N2).

b - Донор аттенуации А/Ленинград /134/17/57 (H2N2).

белки (РВ2, РВ1, PA, NP, M, NS), принадлежат донору аттенуации А/Ленинград/134/17/57 (H2N2). Это установлено методом «да-нет» PCR. Метод основан на сравнении ДНК-копий участков РНК вирусов, амплифицированных с помощью селективно работающих праймеров (табл.1).

Подобраные праймеры специфично работают либо только с последовательностями генов донора аттенуации, либо только с последовательностями современных эпидемических вирусов [Киселева И.В., Voeten J.T.M., Teley L.C.P. и др. Анализ состава генома штаммов сезонной и пандемической живой гриппозной вакцины // Молекулярная генетика, микробиология и вирусология. - 2011. - № 4. - С.29-36].

На фиг.1, в качестве примера, представлен электрофорез в 1.7%-ном агарозном геле, содержащем 0.5 мкг/мл этидиума бромида, амплифицированных ДНК фрагментов гена, кодирующего белок РА с праймерами специфичными (а) - для эпидемического вируса гриппа А/Виктория/361/2011 (H3N2), (б) - для донора аттенуации А/Ленинград/134/17/57 (H2N2). Обозначения: 1-я дорожка - маркер молекулярного веса; 2 и 5-я дорожки - РА ген донора аттенуации А/Ленинград/134/17/57 (H2N2), 3, 4 и 6-я дорожки - РА ген кандидата в вакцинный штамм А/17/Виктория/2011/89 (H3N2), 7-я дорожка - РА ген эпидемического вируса гриппа А/Виктория/361/2011 (H3N2).

Результаты анализа всех генов в составе генома вакцинного штамма А/17/Виктория/2011/89 (H3N2) представлены в таблице 2.

Таблица 2 Состав генома реассортантного вакцинного штамма вируса гриппа А/17/Виктория/2011/89 (H3N2)
Ген Родительские вирусыРеассортантный вакцинный штамм А/17/Виктория/2011/89 (H3N2)
Эпидемический вирус А/Виктория/361/2011 (H3N2) Донор аттенуации А/Ленинград/134/17/57(H2N2)
РВ2ЭВ1 Лен172Лен17
РВ1ЭВЛен 17 Лен17
РА ЭВЛен17 Лен17
НА ЭВЛен17ЭВ
NPЭВ Лен17Лен17
NAЭВ Лен17ЭВ
МЭВЛен17 Лен17
NS ЭВЛен17 Лен17
1 - Ген принадлежит эпидемическому вирусу гриппа А/Виктория/361/2011 (H3N2).

2 - Ген принадлежит донору аттенуации А/Ленинград/134/17/57(H2N2).

В экспериментах in vitro определены фенотипические свойства полученного штамма. Вакцинный штамм А/17/Виктория/2011/89 (H3N2) является температурочувствительным (ts маркер: <1 lg ЭИД50 /мл при 40°С, где ЭИД50 - эмбриональная инфекционная доза, вызывающая гибель 50% РКЭ) и холодоадаптированным (са маркер: 6,7 lg ЭИД50/мл при 26°С).

Стабильность его фенотипических признаков подтверждена анализом способности к репродукции при оптимальной температуре (32°С) и при температурах за пределами температурного оптимума (25°С и 40°С) до и после его пятикратного пассирования в куриных эмбрионах (табл.3).

Таблица 3 Фенотипические свойства вакцинного штамма А/17/Виктория/2011/89 (H3N2) до и после его пассирования в куриных эмбрионах
ВирусТитр, lg ЭИД50 /0.2 млRCT25 RCT40 Фенотип
32°С 25°С40°С
А/Ленинград/134/17/578.2 6.52.01.7 6.2ts, ca
А/Виктория/361/2011 7.51.37.0 6.20.5 non-ts, non-ca
А/17/Виктория/2011/89 (H3N2), до пассирования8.5 7.3<1.01.2 >7.5ts, ca
А/17/Виктория/2011/89 (H3N2), 5-й пассаж8.27.0 <1.01.2 >7.2ts, ca

У созданного штамма установлена генетическая стабильность кодирующих мутаций. Генетическую стабильность вакцинного штамма А/17/Виктория/2011/89 (H3N2) изучали сравнением сохранности кодирующих мутаций во внутренних генах «до» и «после» пятикратного пассирования вакцинного штамма в куриных эмбрионах. Секвенированием генов кандидата в вакцинный штамм продемонстрирована идентичность мутаций во всех внутренних генах донора аттенуации А/Ленинград/134/17/57 (H2N2) и вакцинного штамма А/17/Виктория/2011/89 (H3N2) «до» и «после» его пятикратного пассирования, в том числе, в генах полимеразного комплекса (РВ2, РВ1, РА), ответственных за аттенуирующий фенотип (табл. 4).

Таблица 4. Кодирующие мутации в геноме вакцинного штамма А/17/Виктория/2011/89 (H3N2) по сравнению с донором аттенуации А/Ленинград/13 4/17/57 (H2N2) и его диким предшественником, вирусом А/Ленинград/13 4/5 7 (H2N2)
Ген НуклеотидАминокислота Мутации
Лен/wt1Лен 17 А/17/Виктория/2011/89 (H3N2)
до пассирования 5 пассаж
РВ2 1459478Val LeuLeu Leu
РВ1 819265Lys AsnAsn Asn
1795 591ValHe HeHe
PA107 28Leu ProProPro
1045341 ValLeu LeuLeu
NPNP ген донора аттенуации не содержит мутаций
Ml 6815He ValValVal
NS2798 100Met HeHeHe
1 Наличие мутаций в геноме вакцинного штамма А/17/Виктория/2011/89 (H3N2) определяли сравнением его аминокислотных последовательностей с последовательностями дикого предшественника донора аттенуации А/Ленинград/134/17/57 (H2N2), а именно, с вирусом дикого типа А/Ленинград/134/57 (H2N2), с помощью секвенирования.
Обозначения: Лен 17 - донор аттенуации А/Ленинград/134/17/57 (H2N2); Лен/wt вирус дикого типа А/Ленинград/134/57 (H2N2), предшественник донора аттенуации.

У созданного штамма была проверена чувствительность к неспецифическим гамма-ингибиторам сыворотки крови, реакции торможения гемагглютинации (РТГА) с нормальной (неиммунной) сывороткой крови лошади, прогретой 10 минут при 80°С. Продемонстрировано, что вакцинный штамм А/17/Виктория/2011/89 (H3N2), равно как и его эпидемический родитель А/Виктория/361/2011 (H3N2), высоко устойчивы к гамма-ингибиторам сыворотки крови лошади.

Изучение острой токсичности вакцинного штамма А/17/Виктория/2011/89 (H3N2) проводили в экспериментах на белых мышах обоего пола. Мышам вводили вирус внутрибрюшинно однократно в объеме 0.5 мл. Животным контрольной группы не вводили ничего. Безвредность вакцинного штамма А/17/Виктория/2011/89 (H3N2) оценивали по выживаемости животных и прибавке в весе. Вирус вводили в дозе 71g ЭИД50/0.2мл. В результате испытаний установлена безвредность вакцинного штамма для лабораторных животных при его внутрибрюшинном введении. Отмечена прибавка в весе животных при их 100%-ной выживаемости (табл. 5).

Таблица 5. Результаты изучения безвредности вакцинного штамма в экспериментах на мышах
ПолВведено ВыжилоПрибавка веса, г
Самцы ВШ в/б10/10+1.2
СамкиВШ в/б 10/10+1.4
Самцыконтроль 10/10+1.4
Самкиконтроль 10/10+1.3
Обозначения: ВШ - вакцинный штамм А/17/Виктория/2011/89 (H3N2);

в/б - внутрибрюшинное введение.

У нового штамма определяли аттенуацию и нейровирулентность для мышей. Изучение аттенуирующих свойств вакцинного штамма А/17/Виктория/2011/89 (H3N2) проводили в экспериментах на белых мышах после их интраназального заражения, оценивая степень репродукции вируса в легких по сравнению с уровнем репродукции донора аттенуации А/Ленинград/134/17/57 (H2N2) и его дикого предшественника, вируса А/Ленинград/134/57 (H2N2).

Отсутствие нейровирулентной активности у вакцинного штамма А/17/Виктория/2011/89 (H3N2) изучали путем интраназального заражения мышей с последующим выделением вируса из ткани мозга. В качестве контроля был использован нейровирулентный штамм вируса гриппа A/WSN/33 (H1N1). Вирусы вводили в дозе 7 lg ЭИД50 /0.2мл.

Опыты показали, что вакцинный штамм А/17/Виктория/2011/89 (H3N2) выделялся из легких и носовых ходов мышей в титрах, аналогичных донору аттенуации А/Ленинград/13 4/17/5 7 (H2N2). При этом вирусы дикого типа, такие как А/Ленинград/134/57 (H2N2) и A/WSN/33 (H1N1), использованные в тестировании созданного штамма, активнее репродуцировались в легких мышей по сравнению с холодоадаптированными вирусами (табл. 6), что подтверждает аттенуированный фенотип вакцинного штамма А/17/Виктория/2011/89 (H3N2). Установлено полное отсутствие проникновения вакцинного штамма А/17/Виктория/2011/89 (H3N2) в мозг инфицированных животных после их интраназального заражения при активной репродукции в мозговой ткани нейровирулентного вируса A/WSN/33 (H1N1).

Таблица 6 Изучение репродукции вакцинного штамма во внутренних органах мышей после интраназального заражения
Введенный мышам вирусВыделение вируса из органов, lg ЭИД50/0.2 мл
ЛегкиеНосовые ходы Мозг
Лен 17 2.11.2Не выделен
Лен/wt5.5 3.6Не выделен
А/17/Виктория/2011/89 2.11.3Не выделен
A/WSN/336.3 4.85.3
ПлацебоНе выделен Не выделенНе выделен
Обозначения: Лен17 - донор аттенуации А/Ленинград/134/17/57 (H2N2);

Лен/wt - вирус дикого типа А/Ленинград/134/57 (H2N2), предшественник донора аттенуации.

Обозначения: Лен17 - донор аттенуации А/Ленинград/134/17/57 (H2N2);

Лен/wt - вирус дикого типа А/Ленинград/134/57 (H2N2), предшественник донора аттенуации.

В ходе исследований установлено, что заявляемый вакцинный штамм живой гриппозной вакцины А/17/Виктория/2011/89 (H3N2) характеризуется сочетанием полезных признаков, необходимых вакцинному штамму: антигенной специфичностью эпидемического вируса А/Виктория/361/2011 (H3N2), структурой генома, оптимальной для реассортантных вакцинных штаммов, температурочувствительностью и холодоадаптированностью, что коррелирует с аттенуацией для человека, характерной для донора аттенуации. Инфекционная активность вакцинного штамма при репродукции в развивающихся куриных эмбрионах при 32°С в течение 48 часов - 8,8 lg ЭИД50/мл. Гемагглютинирующая активность - 1:1024. Штамм проявляет генетическую стабильность биологических признаков после 5 пассажей на куриных эмбрионах (при использовании больших заражающих доз). Штамм аттенуирован и безвреден для лабораторных животных. Морфология штамма полиморфная, типичная для вируса гриппа.

Таким образом, вакцинный штамм А/17/Виктория/2011/89 (H3N2) по биологическим свойствам соответствует требованиям, предъявляемым к вакцинным штаммам Фармакопейной статьей ФСП Р № 003224/01-050210 на живую гриппозную вакцину для интраназального применения и действующему приказу Министерства здравоохранения РФ от 07.08.1998 № 156/79 «О подготовке новых вакцинных, производственных и диагностических штаммов вируса гриппа и их внедрении в производство вакцин и диагностических препаратов».

В прилагаемом паспорте на штамм указаны требуемые для вакцинного штамма характеристики.

Штамм депонирован в Государственную коллекцию вирусов ГУ НИИ вирусологии им. Д.И. Ивановского РАМН. Штамму присвоен № депонента ГКВ № 2724.

ПАСПОРТ ВАКЦИННОГО ШТАММА

1 Название штамма А/17/Виктория/2011/89

2 ИЭМ № 8995.

3 Серия (Лот № ) Серия № 1.

4 Сероподтип H3N2.

5 Метод подготовки Классическая реассортация в куриных эмбрионах.

6 Родительские вирусы.

6.1 Эпидемический штамм: А/Виктория/361/2011 (H3N2); CDC ID# 2012702646.

6.2 Донор аттенуации: А/Ленинград/134/17/57 (H2N2).

7 Пассажи в куриных Е7/Е1 (совместное заражение, два селективных пассажа, эмбрионах в процессе четыре клонирования и одно накопление) реассортации

8 Состав генома Гены РВ2, FBI, PA,NP, M и NS от донора аттенуации, НА и NA - от эпидемического вируса (формула генома 6:2).

9 Характеристика штамма до лиофильной сушки.

9.1 Оптимальные условия накопления 32°С, 48 часов.

9.2 Титр ГА 1:1024 с 1.0% куриными эритроцитами.

9.3 Титр вируса при оптимальной температуре 32°С 8.8 log10 ЭИД50/мл.

9.4 Взаимодействие с неспецифическими штамм вируса гриппа а/17/виктория/2011/89 (h3n2) для производства   живой гриппозной интраназальной вакцины для взрослых и для детей, патент № 2532844 -ингибиторами сыворотки крови лошади и морской свинки: устойчив.

9.5 ts маркер: <1 lg ЭИД50 /мл при 40°С (ts фенотип).

9.6 са маркер: 6.7 lg ЭИД50/мл при 26°С (са фенотип).

10 Характеристика штамма после лиофильной сушки

10.1 Дата лиофилизации: 16.04.2012 г.

10.2 Объем материала в ампуле: 0.5 мл.

10.3 Титр вируса при 32°С: 8.0 lg ЭИД50/мл.

10.4 Титр ГА - 1:512 с 1.0% куриными эритроцитами.

11 Антигенная специфичность

11.1 Гемагглютинин: идентичен эпидемическому вирусу А/Виктория/3 61/2011 (H3N2), что подтверждено в РТГА с гипериммунной крысиной сывороткой.

11.2 Нейраминидаза: идентична эпидемическому вирусу А/Виктория/3 61/2011 (H3N2), подтверждено секвенированием.

12 Токсикологическое: Не токсичен после внутрибрюшинного заражения исследование in vivo (острая мышей токсичность)

13 Контроль стерильности Стерилен (30.04.2012).

ФОРМУЛА ИЗОБРЕТЕНИЯ

Штамм вируса гриппа А/17/Виктория/2011/89 (H3N2), депонированный в Государственной коллекции вирусов ФГБУ «Научно-исследовательский институт вирусологии им. Д.И. Ивановского» Минздравсоцразвития России под номером 2724, для получения живой гриппозной интраназальной эпидемической вакцины для взрослых и для детей.


Скачать патент РФ Официальная публикация
патента РФ № 2532844

patent-2532844.pdf
Патентный поиск по классам МПК-8:

Класс C12N7/00 Вирусы, например бактериофаги; их композиции; приготовление или очистка их

Патенты РФ в классе C12N7/00:
холодоадаптированный штамм вируса гриппа в-в/виктория/2/63/87, предназначенный в качестве штамма-донора аттенуации для получения реассортантов холодоадаптированных штаммов для живой гриппозной вакцины -  патент 2529772 (27.09.2014)
штамм "г 244/11" вируса блютанга 14 серотипа для вирусологических исследований, изготовления вакцинных и диагностических препаратов -  патент 2528057 (10.09.2014)
флавивирус с двухкомпонентным геномом и его использование -  патент 2527891 (10.09.2014)
поликатионное соединение "тривирон (triviron)" и способ его получения -  патент 2527256 (27.08.2014)
аттенуированный рекомбинантный парвовирус, пригодный для защиты собак от инфицирования парвовирусом -  патент 2527157 (27.08.2014)
кодон-оптимизированная кднк, кодирующая дисферлин человека, генно-инженерная конструкция, рекомбинантный аденовирус и фармацевтическая композиция для лечения дисферлинопатий -  патент 2527073 (27.08.2014)
вакцина против ящура типа а инактивированная сорбированная -  патент 2526570 (27.08.2014)
способ оценки противооспенной активности лечебно-профилактических препаратов -  патент 2526504 (20.08.2014)
способ удаления вируса иммунодефицита человека из спермы мужчины -  патент 2526494 (20.08.2014)
набор олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации рнк вируса хунин методом полимеразной цепной реакции в реальном времени -  патент 2525938 (20.08.2014)

Класс A61K39/145 Orthomyxoviridae, например вирус гриппа

Патенты РФ в классе A61K39/145:
холодоадаптированный штамм вируса гриппа в-в/виктория/2/63/87, предназначенный в качестве штамма-донора аттенуации для получения реассортантов холодоадаптированных штаммов для живой гриппозной вакцины -  патент 2529772 (27.09.2014)
рекомбинантная вакцина на основе инактивированного вирусного вектора -  патент 2528750 (20.09.2014)
рекомбинантная псевдоаденовирусная частица на основе генома аденовируса человека 5 серотипа, продуцирующая гемагглютинин вируса гриппа штамма a/brisbane/59/2007(h1n1) и способ ее использования -  патент 2523599 (20.07.2014)
варианты гемагглютинина и нейрамидазы вируса гриппа -  патент 2523587 (20.07.2014)
вирус гриппа, способный инфицировать собачьих, и его применение -  патент 2520081 (20.06.2014)
штамм вируса гриппа а/гонконг/1/68/162/35 (h3n2)-универсальный донор внутренних генов для реассортантов и реассортантные штаммы а/спб/гк/09 (h1n1) и а/нк/astana/6:2/2010 (h5n1), полученные на его основе -  патент 2511431 (10.04.2014)
рекомбинантная псевдоаденовирусная частица на основе генома аденовируса человека 5 серотипа, для индукции специфического иммунитета к вирусу гриппа а субтипа н3n2 и способ ее использования -  патент 2507258 (20.02.2014)
рекомбинантная псевдоаденовирусная частица на основе генома аденовируса человека 5 серотипа для индукции специфического иммунитета к вирусу гриппа а субтипа н1n1 и способ ее использования в качестве компонента для создания вакцины -  патент 2507257 (20.02.2014)
штамм вируса гриппа а/17/mallard/нидерланды/00/95(h7n3) для производства живой и производства инактивированной гриппозных вакцин -  патент 2507256 (20.02.2014)
способ очистки вирусов путем ультрацентрифугирования в градиенте концентрации сахара (варианты) -  патент 2503719 (10.01.2014)


Наверх