ПАТЕНТНЫЙ ПОИСК В РФ
НОВЫЕ ПАТЕНТЫ, ЗАЯВКИ НА ПАТЕНТ
БИБЛИОТЕКА ПАТЕНТОВ НА ИЗОБРЕТЕНИЯ

набор синтетических олигонуклеотидов для амплификации и секвенирования its1-5.8s-its2 сосудистых растений

Классы МПК:C12Q1/68 использующие нуклеиновые кислоты
C07H21/04 с дезоксирибозилом в качестве сахаридного радикала
Автор(ы):, ,
Патентообладатель(и):Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования "Алтайский государственный университет" (RU)
Приоритеты:
подача заявки:
2013-02-18
публикация патента:

Изобретение относится к области биохимии, в частности к набору синтетических олигонуклеотидов для амплификации и последующего секвенирования ITS1-5.8S-ITS2 сосудистых растений, включающего проведение полимеразой цепной реакции с помощью универсальных праймеров со следующим нуклеотидным составом: primer ITS-for CGTAACAAGGTTTCCGTAG, primer ITS-rew GGAATCCTTGTAAGTTTCTTT. Изобретение позволяет эффективно анализировать структуру внутреннего транскрибируемого спейсера рибосомной ДНК сосудистых растений. 1ил.

Рисунки к патенту РФ 2528063

набор синтетических олигонуклеотидов для амплификации и секвенирования   its1-5.8s-its2 сосудистых растений, патент № 2528063

Изобретение относится к области молекулярной генетики и геносистематики, может быть использовано для синтеза и последующего анализа структуры внутреннего транскрибируемого спейсера рибосомной ДНК сосудистых растений.

Для молекулярно-генетических исследований в области систематики растений на уровне видов наиболее часто используемыми являются внутренние транскрибируемые спейсеры (ITS) области ядерной рибосомальной ДНК (18S-5.8S-26S), обладающие большой копийностью в геноме [Alvarez, I. & Wendel, J. F. (2003) Ribosomal ITS sequences and plant phylogenetic inference // Mol. Phylogenet. Evol. 29, 417-434]. В этом регионе показана высокая вариабельность и потенциальная применимость в качестве маркерного участка (за исключением папоротников) [Stoeckle, М. (2003) Use of DNA barcodes to identify flowering plants // Bioscience 53, 2-3]. На уровне видов дискриминация и простота технического исполнения подтверждаются в большинстве филогенетических исследований, при использовании ITS к тому же существует большое количество данных о последовательностях для данного региона. Анализ полиморфизма межгенных спейсеров позволяет изучать филогенетические отношения между близкородственными видами, а также изучать филогению между популяциями внутри вида и между отдельными индивидуумами.

Преимущество региона ITS в том, что она может быть амплифицирована по частям (имеется два более мелких фрагмента - ITS1 и ITS2 - прилегающих к 5.8S локусу, который расположен в центре всего участка и консервативен). Консервативный регион 5.8S на самом деле содержит филогенетической информацию для дискриминации на уровне классов [Cullings, К. W. & Vogler, D. R. (1998) A 5.8S nuclear ribosomal RNA gene sequence database: applications to ecology and evolution // Mol. Ecol. 7, 919-923]. Некоторые участки 5.8S из немногих видов растений и грибов имеют индели [Hershkovitz, М.А. & Lewis, L.А. (1996) Deep-level diagnostic value of the rDNA-ITS region // Mol. Biol. Evol. 13, 1276-1295]. Для филогенетической реконструкции ITS, как любой быстро развивающийся некодирующий локус, может потребовать разработки комплекса оценки гомологии последовательности. Таким образом, 5.8S локус может служить в качестве опорной точки для поиска алгоритмов, которые используются для филогенетических целей.

Для проведения полимеразной цепной реакции используют праймеры - короткие ДНК-затравки, между которыми происходит синтез определенной последовательности. Для амплификации последовательностей межгенных спейсеров используют, как правило, праймеры, качественный состав которых определяется по нуклеотидной последовательности структурных субъединиц рибосомальных повторов, т.е. 18S и 28S рДНК. Ограниченность использования праймеров обусловлена их видоспецифичностью [Blattner F.R. (1999) Direct amplification of the entire ITS region from poorly preserved plant material using recombinant PCR. In.: Biotechniques 27:1180-1186; White TJ, Bruns T, Lee S, Taylor J, (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Shinsky JJ, White TJ, editors. PCR Protocols: A Guide to Methods and Applications, 315-322. Academic Press, San Diego; Фризен H. Молекулярные методы, используемые в систематике растений. - Барнаул: АзБука, 2007.-64 с.].

Рассмотрим прототип - способ исследования структурно-функциональной организации ДНК рибосомального кластера эукариот, предусматривающий проведение полимеразной цепной реакции с помощью универсальных праймеров, где в качестве праймеров используют последовательности ДНК со следующим ITS1-5.8S-ITS2 нуклеотидным составом:

5' -CTACTAGATGGTTCGATTAGTC-3'

5'-GTCCCTGCCGTTTGTACACA-3'

для анализа внутреннего межгенного спейсера; ITS1-5.8S-ITS2 [Патент RU № 2113481 от 20.06.98. Способ исследования структурно-функциональной организации ДНК рибосомального кластера эукариот].

Недостатком данного метода является то, что берется широкий круг таксонов эукариот. Данное обстоятельство чревато тем, что довольно высок процент загрязнения: в результате полимеразной цепной реакции может произойти преимущественная амплификация ITS1-5.8S-ITS2 нецелевого вида.

Работа над созданием праймеров строится следующим образом.

1) С помощью открытых и коммерческих баз данных нуклеотидных последовательностей различных видов сосудистых растений либо в результате самостоятельного определения нуклеотидной последовательности сосудистых растений выбирается участок генома, уникальный для данной группы видов.

2) На основании выбранного участка генома с помощью специального программного обеспечения или вручную подбирается последовательность олигонуклеотидов, используемых для проведения ПЦР-реакции (часто 2 праймера). На данном этапе работа заключается в создании выравнивания многих последовательностей и выборе участка последовательности, где отсутствуют отличия. Выравнивание геномных последовательностей означает сравнение последовательностей многих видов друг с другом, поиск универсальных для сосудистых растений участков.

3) Изготовление праймеров производится на автоматических синтезаторах.

4) С помощью практических экспериментов доказывается пригодность подобранных последовательностей для конкретных целей.

Анализ нуклеотидного полиморфизма последовательности ITS1-5.8S-ITS2 на основании данных NCBI (http://www.ncbi.nlm.nih.gov/) (нуклеотидная база данных представляет собой набор последовательностей из нескольких источников, в том числе GenBank, RefSeq, ТПА и PDB). Данные базы обеспечивают основу для медико-биологических исследований и открытий - позволяют применить данные последовательности в качестве основы для создания праймеров.

Для определения универсальных праймеров выявлены сверхконсервативные субпоследовательности 18S и 28S рДНК различных видов сосудистых растений, которые используются в качестве основы для подбора праймеров для работы методом ПЦР.

Предлагаемое изобретение используется для синтеза и последующего анализа структуры внутреннего транскрибируемого спейсера рибосомной ДНК сосудистых растений. Задачей данного изобретения является поиск универсальных праймеров, применимых для анализа структуры ITS1-5.8S-ITS2 сосудистых растений.

Поставленная задача решается посредством определения последовательности праймеров, а именно для амплификации ITS1-5.8S-ITS2 рибосомной ДНК сосудистых растений предложена пара праймеров следующего нуклеотидного состава:

набор синтетических олигонуклеотидов для амплификации и секвенирования   its1-5.8s-its2 сосудистых растений, патент № 2528063

Аналогичные наборы, реакционные смеси, праймеры для амплификации и последующего секвенирования ITS1-5.8S-ITS2 рибосомной ДНК сосудистых растений неизвестны.

Заявляемый набор синтетических олигонуклеотидов для амплификации и последующего секвенирования ITS1-5.8S-ITS2 проверяют на различных видах сосудистых растений.

Ход работы с применением набора синтетических олигонуклеотидов для амплификации и последующего секвенирования ITS1-5.8S-ITS2 рибосомной ДНК сосудистых растений состоит из следующих шагов.

1) Растительный материал перед проведением ПНР с помощью заявляемого набора проводится через процедуру пробоподготовки с использованием набора Diamont DNA kit (ООО «АБТ», Россия) в соответствии с инструкцией производителя; в ходе этой процедуры из растительного материала выделяется ДНК, которую в свою очередь используют для ПЦР.

2) Полимеразную цепную реакцию проводят на амплификаторе MyCycler (Bio-Rad, USA). Амплификация проводится по следующей программе: 6 циклов: 30 циклов: 94°C - 45 сек, 56°C - 60 сек, 72°C - 70 сек; завершающая стадия: 72°C - 10 мин, охлаждение при 4°C.

Инкубационная смесь конечным объемом 25 мкл содержит: 14,6 мкл H2 O; 2 мкл ДНК; 2,5 мкл 10Х буфер; 2,5 мкл 25 мМ MgCl2 ; по 1 мкл 10 мМ каждого праймера; 1,2 мкл 20 мМ dNTPs; 0,2 мкл Taq-полимеразы.

3) Разделение продукта амплификации производится в 1,8% агарозном геле и 0,5 М ТАЕ-буфере при 2,5 В/см в горизонтальной электрофорезной камере Pharmacia LKB-GNA 200. После электрофореза гель окрашивается раствором этидиум бромида в концентрации 2,5 мг/л в течение 20 мин и фотографируется в проходящем УФ-излучении. На фиг.1 наблюдают результат амплификации ITS1-5.8S-ITS2 рибосомной ДНК различных видов сосудистых растений.

Наличие продуктов амплификации во всех дорожках подчеркивает универсальность предлагаемых праймеров.

Секвенирование проводят на автоматическом секвенаторе ABI Prism 3500 xl с использованием протоколов и наборов реагентов, универсальных рекомендуемых производителем и предлагаемых праймеров. Примеры некоторых последовательностей ITS1-5.8S-ITS2 рибосомной ДНК, размещенные в генбанке NCBI.

1) Последовательность ITS 1-5.8S-ITS2 Bunias orientalis секвенированная с помощью предлагаемых праймеров размещена в генбанке NCBI под номером HE863772.1.

2) Последовательность ITS1-5.8S-ITS2 Rhododendron fauriei секвенированная с помощью предлагаемых праймеров размещена в генбанке NCBI под номером HM854166.1.

3) Последовательность ITS1-5.8S-ITS2 Calluna vulgaris секвенированная с помощью предлагаемых праймеров размещена в генбанке NCBI под номером HM854157.1.

4) Последовательность ITS1-5.8S-ITS2 Rhodiola rosea секвенированная с помощью предложенных праймеров размещена в генбанке NCBI под номером GU384199.1.

5) Последовательность ITS1-5.8S-ITS2 Rhododendron adamsii секвенированная с помощью предложенных праймеров размещена в генбанке NCBI под номером HM854164.1.

6) Последовательность ITS1-5.8S-ITS2 Rhododendron japonicum секвенированная с помощью предложенных праймеров размещена в генбанке NCBI под номером HM854167.1.

ФОРМУЛА ИЗОБРЕТЕНИЯ

Набор синтетических олигонуклеотидов для амплификации и последующего секвенирования ITS1-5.8S-ITS2 сосудистых растений, включающий проведение полимеразной цепной реакции с помощью универсальных праймеров, отличающийся тем, что в качестве праймеров используются последовательности ДНК со следующим нуклеотидным составом:

primer ITS-for CGTAACAAGGTTTCCGTAG

primer ITS-rew GGAATCCTTGTAAGTTTCTTT


Скачать патент РФ Официальная публикация
патента РФ № 2528063

patent-2528063.pdf
Патентный поиск по классам МПК-8:

Класс C12Q1/68 использующие нуклеиновые кислоты

Патенты РФ в классе C12Q1/68:
способ идентификации вызывающих муковисцидоз мутаций в гене cftr человека, набор праймеров, биочип, набор мишеней и тест-система, используемые в способе -  патент 2529717 (27.09.2014)
аптамер, специфичный к опухолевым тканям легкого человека -  патент 2528870 (20.09.2014)
способ выявления микобактерий туберкулеза генотипа веijing в режиме реального времени -  патент 2528866 (20.09.2014)
способ проведения пцр и пцр-пдрф для идентификации аллельных вариантов waxy-генов пшеницы -  патент 2528748 (20.09.2014)
синтетические олигонуклеотидные праймеры для идентификации вируса блютанга нуклеотипа в (3, 13 и 16 серотипы) методом от-пцр -  патент 2528745 (20.09.2014)
способ проведения пцр-пдрф для генотипирования крупного рогатого скота по аллелям а и к гена dgat1 -  патент 2528743 (20.09.2014)
синтетические олигонуклеотидные праймеры и способ выявления генотипов для идентификации личности с помощью системы микросателлитных днк-маркеров y-хромосомы -  патент 2528742 (20.09.2014)
способ оценки чувствительности клеток рака легкого к доксорубицину на основании уровней экспрессии маркерных генов и набор для его осуществления -  патент 2528247 (10.09.2014)
биологический микрочип для выявления и многопараметрического анализа противохолерных антител -  патент 2528099 (10.09.2014)
способ и набор для детекции микроорганизмов -  патент 2527897 (10.09.2014)

Класс C07H21/04 с дезоксирибозилом в качестве сахаридного радикала

Патенты РФ в классе C07H21/04:
биологический днк маркер для идентификации гена устойчивости к х вирусу картофеля -  патент 2522828 (20.07.2014)
элементы рекомбинантного вектора экспрессии (reves) для усиления экспрессии рекомбинантных белков в клетках-хозяевах -  патент 2518340 (10.06.2014)
способ специфического отбора высокоаффинных молекул днк (днк-аптамеров) к рекомбинантному белку-мишени -  патент 2513700 (20.04.2014)
способ анализа нарушений, связанных с раком яичников -  патент 2511408 (10.04.2014)
набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации днк аденовируса серотипов 3,4,7,14,21 методом гибридизационно-флуоресцентной полимеразной цепной реакции -  патент 2511043 (10.04.2014)
способ количественной оценки терминальных нуклеотидов g-цепи теломерной днк человека с помощью полимеразной цепной реакции и дуплекс-специфического анализа, наборы синтетических олигонуклеотидных праймеров и зондов для осуществления этого способа -  патент 2508407 (27.02.2014)
композиции и способы модуляции экспрессии рецептора фактора роста фибробластов 4 (fgfr4) -  патент 2501803 (20.12.2013)
способ очистки g-богатых олигодезоксирибонуклеотидов -  патент 2501802 (20.12.2013)
способ выделения и очистки нуклеиновых кислот из жидкой среды (варианты) и сосуд из пластика для сорбирования нуклеиновых кислот из жидкой среды -  патент 2495925 (20.10.2013)
способ получения днк из молок лососевых рыб -  патент 2488634 (27.07.2013)


Наверх