Поиск патентов
ПАТЕНТНЫЙ ПОИСК В РФ

варианты альфа-амилазы ts-23 с измененными свойствами

Классы МПК:C12N9/28 альфа-амилаза микробного происхождения, например бактериальная амилаза
Автор(ы):, , , , , , , , , ,
Патентообладатель(и):ДАНИСКО ЮЭс ИНК. (US)
Приоритеты:
подача заявки:
2009-02-04
публикация патента:

Изобретение относится к биотехнологии и представляет собой улучшенный вариант исходной альфа-амилазы AmyTS23 с последовательностью SEQ ID NO:1, имеющий альфа-амилазную активность. При этом указанный вариант имеет укорочение С-конца и аминокислотную последовательность, которая обладает по меньшей мере 90% идентичностью с аминокислотной последовательностью SEQ ID NO:2, и содержит мутацию S243Q и делецию остатков R180 и S181, где нумерация указанных аминокислотных остатков представлена относительно SEQ ID NO:1. Изобретение позволяет расширить ассортимент альфа-амилаз, пригодных для использования в составе моющих композиций и при переработке крахмала. 8 н. и 7 з.п. ф-лы, 14 ил., 7 табл., 11 пр.

Рисунки к патенту РФ 2526516

варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516

ПРИОРИТЕТ

По настоящей заявке испрашивается приоритет по предварительным патентным заявкам США с номерами 61/026056, поданной 4 февраля 2008 года; и 61/059403, поданной 6 июня 2008 года, которые включены в настоящий документ в виде ссылок в полном объеме.

ТЕХНИЧЕСКАЯ ОБЛАСТЬ

Описаны композиции и способы, связанные с вариантами варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы TS-23 (варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы), причем варианты обладают измененными биохимическими свойствами и преимущественными эксплуатационными характеристиками относительно исходной амилазы. Варианты пригодны для применения, например, для переработки крахмала, продукции этанола, стирки, мытья посуды, очистки твердых поверхностей, расшлихтовки тканей и/или продукции подсластителей.

УРОВЕНЬ ТЕХНИКИ

Крахмал состоит из смеси амилозы (15-30% масс./масс.) и амилопектина (70-85% масс./масс.). Амилоза состоит из линейных цепей варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -1,4-связанных элементов глюкозы, имеющих молекулярную массу (ММ) от приблизительно 60000 до приблизительно 800000. Амилопектин представляет собой разветвленный полимер, содержащий варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -1,6-точки ветвления на каждые 24-30 элементов глюкозы; его ММ может составлять до 100 миллионов.

Сахара из крахмала в форме концентрированных декстрозных сиропов в настоящее время получают посредством катализируемого ферментом процесса, включающего: (1) разжижение (или плавление) твердого крахмала варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазой до декстринов, имеющих среднюю степень полимеризации приблизительно 7-10; и (2) осахаривание полученного разжиженного крахмала (т.е. гидролизата крахмала) с помощью амилоглюкозидазы (также называемой глюкоамилазой или GA). Полученный сироп имеет высокое содержание глюкозы. Большую часть сиропа глюкозы, который получают коммерчески, впоследствии подвергают ферментативной изомеризации до смеси декстроза/фруктоза, известной как изосироп.

Альфа-(варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 )-амилазы (варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -1,4-глюкан-4-глюканогидролазы, EC 3.2.1.1) представляют собой группу ферментов, которые гидролизуют крахмал, гликоген и сходные полисахариды расщеплением внутренних варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -1,4-глюкозидных связей случайным образом. Этот класс ферментов имеет ряд важных коммерческих применений, например, на начальных стадиях переработки (при разжижении) крахмала, при расшлихтовке тканей, удалении краски из макулатуры, модификации крахмала в бумажной и целлюлозной промышленности, для влажного измельчения кукурузы, для продукции алкоголя, для изготовления подсластителей (т.е. сахара), в промышленности напитков, в пивоварении, в нефтяном промысле, в кормах для животных и в моющих средствах в детергентных матрицах. Например, эти ферменты можно использовать для удаления крахмальных пятен в процессе мытья посуды и стирки.

варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -Амилазы выделяют из широкого множества бактерий, грибов, растений и животных. В промышленности многие важные варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы представляют собой варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, выделенные из Bacilli. Одной из охарактеризованных варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаз является варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза штамма TS-23 алкалофильных Bacillus sp., который продуцирует по меньшей мере пять типов ферментов, проявляющих активность гидролиза крахмала (Lin et al., 1998, "Production and properties of a raw-starch-degrading amylase from the thermophilic and alkaliphilic Bacillus sp. TS-23", Biotechnol. Appl. Biochem. 28: 61-68). варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -Амилаза Bacillus sp. no. TS-23 имеет оптимум pH 9, хотя она является стабильной в широком диапазоне pH (т.е. pH от 4,7 до 10,8). Ее температурный оптимум составляет 45°C, хотя фермент обладает активностью и при более низких температурах, например 15-20°C. Остается необходимость в варианте варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, которая обладает измененными биохимическими характеристиками и предоставляет улучшенные реализации при промышленном применении.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Описаны варианты (мутанты) варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы TS-23, которые обладают измененными свойствами, которые являются преимущественными в отношении различных промышленных процессов, таких как переработка крахмала (например, разжижение, осахаривание крахмала и т.п.), в текстильной промышленности (например, для расшлихтовки) и в качестве добавок к детергентам (например, для очистки пятен крахмала).

Изменения включают, но не ограничиваются ими, изменения удельной активности, специфичности к субстрату, связывания субстрата, характера расщепления субстрата, термической стабильности, устойчивости к окислению, зависимости от Ca2+, профиля pH/активности, профиля pH/стабильности и других представляющих интерес свойств. Иллюстративным измененным профилем pH/стабильности является повышенная стабильность при низких pH (например, pH<6 и даже pH<5) и/или повышенная стабильность при высоких pH (например, pH>9).

В одном аспекте предусмотрен вариант исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы AmyTS23, который имеет аминокислотную последовательность, которая обладает по меньшей мере приблизительно 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или даже 99% идентичностью исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазе и содержит по меньшей мере два из следующих: (a) укорочение C-конца, (b) замена аминокислоты 201 или (c) делеция остатков R180 и S181, и где вариант обладает активностью варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы (при использовании SEQ ID NO:1 для нумерации). В некоторых вариантах осуществления исходная варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза представляет собой SEQ ID NO:1. В некоторых вариантах осуществления исходная варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза имеет определенную гомологию с SEQ ID NO:1.

Другой аспект предусматривает композицию для ручного или автоматического мытья посуды, содержащую варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу Bacillus sp. no. TS-23 или ее вариант. Кроме того, композиция может содержать одно или несколько из поверхностно-активного вещества, моющего компонента детергента, комплексообразующего вещества, полимера, системы для отбеливания, стабилизатора, пенообразователя, пеногасителя, антикоррозионного вещества, суспендирующего грязь вещества, вещества против повторного осаждения грязи, красителя, бактерицидного вещества, гидротропного вещества, ингибитора потускнения и отдушки. Композиции для мытья посуды могут представлять собой композиции, используемые для ручного или автоматического мытья посуды.

Сходный аспект предусматривает детергентную добавку для стирки, содержащую варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу Bacillus sp. no. TS-23 или ее вариант. Как указано выше, композиция может дополнительно содержать одно или несколько из поверхностно-активного вещества, моющего компонента детергента, комплексообразующего вещества, полимера, системы для отбеливания, стабилизатора, пенообразователя, пеногасителя, антикоррозионного вещества, суспендирующего грязь вещества, вещества против повторного осаждения грязи, красителя, бактерицидного вещества, гидротропного вещества, ингибитора потускнения и отдушки. Композиция также может содержать одно или несколько из поверхностно-активного вещества, моющего компонента детергента, комплексообразующего вещества, полимера, системы для отбеливания, стабилизатора, пенообразователя, пеногасителя, антикоррозионного вещества, суспендирующего грязь вещества, вещества против повторного осаждения грязи, красителя, бактерицидного вещества, гидротропного вещества, оптического отбеливателя, кондиционера для тканей и отдушки.

Следующий аспект относится к нуклеиновой кислоте, кодирующей описанные варианты, и к векторам, содержащим такие нуклеиновые кислоты. Также предусматриваются клетки, в которые такие нуклеиновые кислоты введены, например, с помощью вектора, фага или вируса. Выделенная клетка-хозяин может представлять собой микроорганизм, например бактерию или гриб. Бактерия может представлять собой грамположительную бактерию, выбранную из группы, состоящей из Bacillus subtilis, B. licheniformis, B. lentus, B. brevis, G. stearothermophilus (ранее называемую B. stearothermophilus), B. alkalophilus, B. amyloliquefaciens, B. coagulans, B. circulans, B. lautus, B. thuringiensis, Streptomyces lividans или S. murinus; или грамотрицательную бактерию, где указанная грамотрицательная бактерия представляет собой Escherichia coli или вид Pseudomonas.

Другие аспекты относятся к способу получения полипептидных вариантов и к применению полипептидных вариантов, отдельно или в сочетании с другими ферментами, включая варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилолитические ферменты, в различных промышленных процессах, таких как разжижение крахмала. Некоторые аспекты предусматривают применение полипептидных вариантов для стирки и/или мытья посуды. Также предусмотрены способы очистки тканей и/или других твердых поверхностей с использованием полипептидных вариантов. Другой аспект предусматривает применение варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, описанной в настоящем документе, и любых из вариантов варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаз в композиции для расшлихтовки тканей, например, где композиция представляет собой водный раствор. Также предусматриваются способы расшлихтовки тканей с использованием указанных композиций.

Полипептидные варианты необязательно могут находиться в форме непылящего гранулята, микрогранулята, стабилизированной жидкости или защищенного фермента. Другой аспект предусматривает, что детергентная добавка или детергентная композиция дополнительно содержит фермент, выбранный из группы, состоящей из целлюлазы, протеазы, ацилтрансферазы, аминопептидазы, амилазы, карбогидразы, карбоксипептидазы, каталазы, хитиназы, кутиназы, циклодекстрингликотрансферазы, дезоксирибонуклеазы, эстеразы, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -галактозидазы, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -галактозидазы, глюкоамилазы, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -глюкозидазы, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -глюкозидазы, галопероксидазы, инвертазы, лакказы, липазы, маннозидазы, оксидазы, пектинолитического фермента, пептидоглутаминазы, пероксидазы, фитазы, полифенолоксидазы, протеолитического фермента, рибонуклеазы, трансглутаминазы, ксиланазы, пуллуланазы, изоамилазы, каррагеназы или любого сочетания этих ферментов. Другие амилазы, предусмотренные для применения в композиции, включают две или более других варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаз, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу, изоамилазу или глюкоамилазу.

Некоторые аспекты предусматривают композицию для переработки крахмала, содержащую варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу Bacillus sp. no. TS-23 или ее варианты, в водном растворе. Также предусматривается способ применения такой композиции для переработки крахмала. Способ и композиция могут дополнительно включать глюкоамилазу, изоамилазу, пуллуланазу, фитазу или их комбинацию. Другой аспект предусматривает композицию для деградации (например, гидролиза) биопленки, содержащую варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу Bacillus sp. no. TS-23 или ее вариант в растворе или геле и необязательно дополнительно содержащую целлюлазу, гемицеллюлазу, ксиланазу, липазу, протеазу, пектиназу, противомикробное средство или любое их сочетание. Также предусматриваются способы гидролиза биопленок с использованием указанных композиций.

Другой предусмотренный аспект представляет собой композицию для осахаривания крахмала, содержащую варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу Bacillus sp. no. TS-23 или ее вариант в растворе. Таким образом, также предусмотрен способ осахаривания крахмала, включающий применение композиции в течение периода, достаточного для осахаривания указанного крахмала.

Другой предусмотренный вариант осуществления представляет собой композицию для разжижения крахмала, содержащую варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу Bacillus sp. no. TS-23 или ее вариант в растворе. Также предусмотрен способ разжижения крахмала, включающий применение композиции с использованием указанной композиции в течение периода, достаточного для разжижения указанного крахмала.

Некоторые конкретные аспекты композиций и способа описаны ниже.

В одном аспекте предусматривается вариант исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы AmyTS23, где вариант имеет аминокислотную последовательность, которая обладает по меньшей мере 80% идентичностью исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазе и содержит по меньшей мере два из следующих:

(a) укорочение C-конца,

(b) замена остатка 201 или

(c) делеция остатков R180 и S181, где указанные аминокислотные остатки относятся к аминокислотной последовательности SEQ ID NO:1. В некоторых вариантах осуществления вариант обладает активностью варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы.

В некоторых вариантах осуществления вариант обладает по меньшей мере 90% идентичностью исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазе. В некоторых вариантах осуществления вариант обладает по меньшей мере 95% идентичностью исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазе. В конкретных вариантах осуществления исходная варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза обладает аминокислотной последовательностью SEQ ID NO:1.

В некоторых вариантах осуществления вариант дополнительно содержит замену в одном или нескольких остатках, выбранных из группы, состоящей из остатка 87, остатка 225, остатка 272 и остатка 282.

В другом аспекте предусматривается вариант исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы AmyTS23, где вариант имеет аминокислотную последовательность, которая обладает по меньшей мере 85% идентичностью исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазе и содержит укорочение C-конца. В некоторых вариантах осуществления вариант имеет аминокислотную последовательность SEQ ID NO:2. Вариант может обладать повышенной активностью очистки крахмальных пятен в холодной воде по сравнению с исходной амилазой.

В некоторых вариантах осуществления вариант дополнительно содержит делецию остатков в положении R180 и S181, где положения аминокислотных остатков относятся к аминокислотной последовательности SEQ ID NO:1. Вариант может обладать повышенной детергентной стабильностью по сравнению с исходной амилазой.

В некоторых вариантах осуществления вариант дополнительно содержит замену остатка в положении 201, где положение аминокислотного остатка относится к аминокислотной последовательности SEQ ID NO:1. Вариант может обладать повышенной окислительной стабильностью по сравнению с исходной амилазой. Вариант может иметь замену M201L.

Любой из вариантов может дополнительно содержать замену в одном или нескольких остатках, выбранных из группы, состоящей из остатка 87, остатка 225, остатка 272 и остатка 282, где положение аминокислотного остатка относится к аминокислотной последовательности SEQ ID NO:1.

В сходном аспекте предусматривается нуклеиновая кислота, кодирующая вариант, описанный в настоящем документе. В некоторых вариантах осуществления предусматривается экспрессирующий вектор, содержащий эту нуклеиновую кислоту, под контролем пригодного промотора. В некоторых вариантах осуществления предусматривается клетка-хозяин, содержащая экспрессирующий вектор.

В сходном аспекте предусматривается композиция для ручного или автоматического мытья посуды, содержащая вариант, описанный в настоящем документе, и одно или несколько из: поверхностно-активного вещества, моющего компонента детергента, комплексообразующего вещества, полимера, системы для отбеливания, стабилизатора, пенообразователя, пеногасителя, антикоррозионного вещества, суспендирующего грязь вещества, вещества против повторного осаждения грязи, красителя, бактерицидного вещества, гидротропного вещества, ингибитора потускнения и отдушки.

В сходном аспекте предусмотрена детергентная добавка для стирки, содержащая вариант, как описано в настоящем документе, и одно или несколько из поверхностно-активного вещества, моющего компонента детергента, комплексообразующего вещества, полимера, системы для отбеливания, стабилизатора, пенообразователя, пеногасителя, антикоррозионного вещества, суспендирующего грязь вещества, вещества против повторного осаждения грязи, красителя, бактерицидного вещества, гидротропного вещества, оптического отбеливателя, кондиционера для ткани и отдушки.

В другом аспекте предусматривается способ удаления крахмала из тканей, включающий инкубацию тканей в присутствии варианта исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы AmyTS23, где вариант имеет аминокислотную последовательность, которая обладает по меньшей мере 80% идентичностью исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазе и содержит по меньшей мере два из следующих:

(a) укорочение C-конца,

(b) замена остатка 201 или

(c) делеция остатков R180 и S181, где указанные аминокислотные остатки относятся к аминокислотной последовательности SEQ ID NO:1 и где указанная инкубация удаляет крахмал из ткани.

В сходном аспекте предусматривается способ переработки крахмала, включающий инкубацию ткани в присутствии варианта исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы AmyTS23, где вариант имеет аминокислотную последовательность, которая обладает по меньшей мере 80% идентичностью исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазе и содержит по меньшей мере два из следующих:

(a) укорочение C-конца,

(b) замена остатка 201 или

(c) делеция остатков R180 и S181, где указанные аминокислотные остатки относятся к аминокислотной последовательности SEQ ID NO:1 и где указанная инкубация гидролизует крахмал.

Эти и другие аспекты и варианты осуществления композиций и способа по настоящему изобретению станут понятными с помощью описания и фигур.

КРАТКОЕ ОПИСАНИЕ ФИГУР

На фиг.1 представлена аминокислотная последовательность исходной амилазы AmyTS23 (полноразмерная, зрелая; SEQ ID NO:1).

На фиг.2 представлена аминокислотная последовательность укороченного полипептида AmyTS23t (зрелая, SEQ ID NO:2). Полужирным и подчеркнутым текстом указаны аминокислотные остатки R180, S181 и M201.

На фиг.3 представлена последовательность ДНК оптимизированного гена amyTS23 (SEQ ID NO:3).

На фиг.4 представлена последовательность ДНК оптимизированного гена amyTS23t (SEQ ID NO:4).

На фиг.5 представлена экспрессирующая кассета для AmyTS23 и AmyTS23t.

На фиг.6 представлен график, на котором показаны результаты анализа очистки образца ткани c помощью полноразмерной амилазы AmyTS23 (AmyTS23fl) и контроля OxAm.

На фиг.7 представлен график, на котором показаны результаты анализа очистки образцов амилазой AmyTS23fl и контролем OxAm.

На фиг.8 представлен график, на котором показаны результаты анализа очистки образца ткани амилазой AmyTS23t и контролем OxAm.

На фиг.9 представлен график, на котором показаны результаты анализа очистки образца AmyTS23t и контролем OxAm.

На фиг.10 представлен график, на котором показано ускоренное исследование стабильности с AmyTS23t и AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS в двух различных составах детергента для стирки.

На фиг.11 представлен график, на котором показана окислительная стабильность AmyTS23t, AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS и AmyTS23t(M201L+варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS).

На фиг.12 представлен график, на котором показаны характеристики AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS в жидком детергенте на образцах с рисовым крахмалом.

На фиг.13 представлен график, на котором показана остаточная активность в качестве функции изменения заряда.

На фиг.14 представлены дополнительные аминокислотные и нуклеотидные последовательности, указанные в описании.

ПОДРОБНОЕ ОПИСАНИЕ

Описаны композиции и способы, включающие варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу Bacillus sp. no. TS-23 и ее варианты. Варианты TS-23 обладают измененными биохимическими характеристиками и демонстрируют высокую эффективность, например, в применениях, связанных со стиркой и мытьем посуды. Эти и другие признаки вариантов, а также применения с использованием вариантов подробно описаны.

1. Сокращения и определения

Применяются следующие сокращения и определения. Формы единственного числа включают множественное число, если контекст явно не указывает на иное. Таким образом, например, указание на "фермент" включает множество таких ферментов, а указание на "состав" включает указание на один или несколько составов и их эквивалентов, известных специалистам в данной области, и т.д.

Если в настоящем документе не определено иначе, все технические и научные термины, используемые в настоящем документе, имеют то же значение, которое обычно понимает специалист в области. В Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 2D ED., John Wiley and Sons, New York (1994) и Hale & Markham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) предоставлены для специалиста в данной области словари многих из терминов, использованных в настоящем документе.

Некоторые аспекты композиций и способов основываются на общепринятых технологиях и способах, используемых в области генетической инженерии и молекулярной биологии. Следующие источники включают описания общей технологии, пригодной в соответствии с композициями и способами по настоящему изобретению: Sambrook et al., MOLECULAR CLONING A LABORATORY MANUAL (2nd Ed., 1989), Kreigler, GENE TRANSFER AND EXPRESSION, A LABORATORY MANUAL (1990) и Ausubel et al., Eds CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (1994). В этих общих ссылках предоставлены определения и способы, известные специалистам в данной области. Однако не подразумевается, что композиции и способы ограничиваются какими-либо конкретными описанными способами, протоколами и реагентами, поскольку они могут варьировать. Хотя любые способы и материалы, сходные или эквивалентные способам и материалам, описанным в настоящем документе, можно использовать на практике или при тестировании композиций и способов по настоящему изобретению, предпочтительные способы и материалы описаны.

При описании белков и генов, которые кодируют их, название гена, как правило, указано курсивом и непрописными буквами, в то время как название белка, как правило, не указано курсивом, и первая буква является прописной.

Все патенты и публикации, указанные в настоящем документе, включая все последовательности, описанные в таких патентах и публикациях, полностью включены в виде ссылок.

1.1 Определения

Как используют в настоящем документе, термин "крахмал" относится к любому материалу, состоящему из комплексных полисахаридных углеводов растений, состоящих из амилозы и амилопектина с формулой (C6H10 O5)x, где "X" может представлять собой любое число. В частности, термин относится к любому растительному материалу, включая, но не ограничиваясь ими, зерна, травы, клубни и корни, более конкретно, пшеницу, ячмень, кукурузу, рожь, рис, сорго, отруби, маниоку, просо, картофель, сладкий картофель и тапиоку.

Как используют в настоящем документе, "амилаза" представляет собой фермент, способный катализировать деградацию крахмала. Амилазы представляют собой гидролазы, которые расщепляют варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -D-(1варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 4) O-гликозидные связи в крахмале. Как правило, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы (EC 3.2.1.1; варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -D-(1варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 4)-глюканглюканогидролазы) определяют как эндо-действующие ферменты, расщепляющие варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -D-(1варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 4)-O-гликозидные связи в молекуле крахмала случайным образом. В противоположность этому, экзо-действующие амилолитические ферменты, такие как варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы (EC 3.2.1.2; варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -D-(1варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 4)-глюканмальтогидролаза) и некоторые продукт-специфические амилазы, такие как мальтогенная варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза (EC 3.2.1.133), расщепляют молекулу крахмала с невосстанавливающего конца субстрата. варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -Амилазы, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -глюкозидазы (EC 3.2.1.20; варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -D-глюкозидглюкогидролаза), глюкоамилазы (EC 3.2.1.3; варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -D-(1варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 4)-глюканглюкогидролаза) и продукт-специфические амилазы могут продуцировать из крахмала мальтоолигосахариды определенной длины. Как используют в настоящем документе, амилазы включают любые/все амилазы, включая глюкоамилазы, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы и варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы дикого типа, такие как амилазы Bacillus sp., например B. lichemformis и B. subtilis.

Как используют в настоящем документе, "варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза штамма TS-23 Bacillus sp." и сходные выражения относятся к варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазе из штамма TS-23 Bacillus sp. Ген, кодирующий варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу, может представлять собой ген дикого типа или кодон-оптимизированный полинуклеотид, который кодирует варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу. Зрелая варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза штамма TS-23 Bacillus sp. представляет собой (в ориентации от N к С) (SEQ ID NO:1, фиг.1):

варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516

Как используют в настоящем документе, "варианты варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы штамма TS-23 Bacillus sp." и сходные выражения относятся к вариантам/мутантам варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы дикого типаштамма TS-23 Bacillus sp., который включает аминокислотную замену, вставку или делецию относительно аминокислотной последовательности исходной (дикого типа) амилазы штамма TS-23 Bacillus sp. Термин "вариант" используют взаимозаменяемо с термином "мутант". Вариант варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы Bacillus sp. штамма TS-23 может включать мутации в сигнальной последовательности относительно исходной сигнальной последовательности. Кроме того, вариант варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы Bacillus sp. штамма TS-23 может находиться в форме слитого белка, содержащего гетерологичную сигнальную последовательность варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, например, из B. licheniformis (LAT).

Как используют в настоящем документе, выражения "исходная варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза Bacillus sp. штамма TS-23", "варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза Bacillus sp. штамма TS-23 дикого типа", "эталонная варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза Bacillus sp. штамма TS-23" и сходные выражения относятся к полипептиду Bacillus sp. штамма TS-23. Термин может быть сокращен как "исходный фермент", "фермент дикого типа", "исходный полипептид", "эталонный полипептид" или сходные с ними, для удобства. Исходная варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза Bacillus sp. штамма TS-23 может включать мутации в сигнальной последовательности исходного полипептида. Кроме того, исходная варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза штамма TS-23 Bacillus sp. может находиться в форме слитого белка, содержащего гетерологичную сигнальную последовательность варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, например, из B. licheniformis (LAT).

"Исходная нуклеиновая кислота/полинуклеотид", "нуклеиновая кислота/полинуклеотид дикого типа" или "эталонная нуклеиновая кислота/полинуклеотид" относятся к последовательности нуклеиновой кислоты, кодирующей исходный полипептид, и к нуклеиновой кислоте, комплементарной ей.

"Вариант нуклеиновой кислоты/полинуклеотида" относится к последовательности нуклеиновой кислоты, кодирующей полипептидный вариант или нуклеиновую кислоту, комплементарную ей, или к полинуклеотидной последовательности, имеющей замену, вставку или делецию по меньшей мере одного основания, относительно последовательности исходного полинуклеотида или нуклеиновой кислоты, комплементарной ему. Когда указано, такие нуклеиновые кислоты могут включать нуклеиновые кислоты, имеющие определенную степень гомологии с эталонной последовательностью или способные гибридизоваться с эталонной последовательностью, например, в строгих условиях [например, 50°С и 0,2X SSC (1X SSC=0,15M NaCl, 0,015M Na3-цитрат, pH 7,0)] или в высоко строгих условиях [например, 65°С и 0,1X SSC (1X SSC=0,15M NaCl, 0,015M Na3-цитрат, pH 7,0)]. Вариант нуклеиновой кислоты может быть оптимизирован для того, чтобы отражать предпочтительное использование кодона для определенных организмов-хозяев, таких как метилотрофные дрожжи (например, Pichia, Hansenula, и т.д.) или нитчатые грибы (например, Trichoderma (например, T. Reesei) и т.д.) или другие экспрессирующие хозяева (например, Bacillus , Streptomyces и т.п.).

Термин "рекомбинантный" при использовании в отношении рассматриваемой клетки, нуклеиновой кислоты, белка или вектора указывает на то, что клетка, нуклеиновая кислота, белок или вектор модифицированы введением гетерологичной нуклеиновой кислоты или белка или изменением нативной нуклеиновой кислоты или белка или что клетка происходит из клетки, модифицированной таким образом. Таким образом, например, рекомбинантные клетки экспрессируют гены, которые не встречаются в нативной (нерекомбинантной) форме клетки, или экспрессируют нативные гены, которые в ином случае аномально экспрессируются, сверхэкспрессируются или не экспрессируются совсем.

Термины "извлеченный", "выделенный" и "отделенный" относятся к соединению, белку, клетке, нуклеиновой кислоте или аминокислоте, которые удалены по меньшей мере из одного компонента, с которым они естественным образом ассоциированы и встречаются в природе.

Как используют в настоящем документе, "очищенный" относится к материалу (например, к выделенному полипептиду или полинуклеотиду), который находится в его относительно чистом состоянии, например он является по меньшей мере приблизительно на 90% чистым, или по меньшей мере приблизительно на 95% чистым, по меньшей мере приблизительно на 98% чистым или по меньшей мере приблизительно на 99% чистым.

Термины "термостабильный" и "термостабильность" относятся к способности фермента сохранять активность после воздействия повышенных температур. Термическую стабильность фермента, такого как ферменты варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, определяют по его времени полужизни (t1/2 ), приводимому в минутах, часах или сутках, в ходе которого утрачивается половина активности фермента в определенных условиях. Время полужизни вычисляют посредством измерения остаточной активности варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы после воздействия (т.е. нагрузки) повышенной температуры.

"Диапазон pH" относится к диапазону значений pH, при которых фермент проявляет каталитическую активность.

Как используют в настоящем документе, термины "pH-стабильный" и "pH-стабильность" относятся к способности фермента сохранять активность на протяжении широкого диапазона pH в течение заданного периода времени (например, 15 мин, 30 мин, 1 час и т.п.).

Как используют в настоящем документе, "аминокислотная последовательность" является синонимом терминов "полипептид", "белок" и "пептид", и их используют в настоящем документе взаимозаменяемо. Когда такая аминокислотная последовательность проявляет активность, она может называться "ферментом". В настоящем документе используют общепринятый однобуквенный или трехбуквенный код для аминокислотных остатков.

Термин "нуклеиновая кислота" охватывает ДНК, РНК, гетеродуплексы и синтетические молекулы, способные кодировать полипептид. Нуклеиновые кислоты могут быть одноцепочечными или двухцепочечными и могут представлять собой их химические модификации. Термины "нуклеиновая кислота" и "полинуклеотид" используют взаимозаменяемо. Поскольку генетический код является вырожденным, для кодирования конкретной аминокислоты можно использовать более одного кодона, и настоящие композиции и способы охватывают нуклеотидные последовательности, которые кодируют конкретную аминокислотную последовательность.

Если нет иных указаний, нуклеиновые кислоты представлены слева направо в ориентации от 5' к 3'; аминокислотные последовательности представлены слева направо в ориентации от N к С соответственно.

"Гомолог" означает структуру, обладающую определенной степенью идентичности с рассматриваемыми аминокислотными последовательностями и рассматриваемыми нуклеотидными последовательностями. Гомологичная последовательность включает аминокислотную последовательность, по меньшей мере приблизительно на 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или даже на 99% идентичную рассматриваемой последовательности, при использовании традиционных инструментов выравнивания последовательностей (например, Clustal, BLAST и т.п.). Как правило, гомолог может включать те же остатки активного центра, что и рассматриваемая аминокислотная последовательность, если нет иных указаний.

Как используют в настоящем документе, "гибридизация" относится к процессу, посредством которого одна цепь нуклеиновой кислоты образует пары оснований с комплементарной цепью, как в способах блот-гибридизации и способах ПЦР.

Как используют в настоящем документе, "синтетическая" молекула продуцируется химическим и ферментативным синтезом in vitro, а не организмом.

Как используют в настоящем документе, термины "трансформированный", "стабильно трансформированный" и "трансгенный", используемые в отношении клетки, означают, что клетка имеет ненативную (например, гетерологичную) последовательность нуклеиновой кислоты, встроенную в ее геном или находящуюся в ней в качестве эписомальной плазмиды, которая сохраняется на протяжении множества поколений.

Термин "введенный" в контексте введения последовательности нуклеиновой кислоты в клетку означает "трансфекцию", или "трансформацию", или "трансдукцию", как известно в данной области.

"Штамм-хозяин" или "клетка-хозяин" представляет собой организм, в который введен вектор, фаг, вирус или другая конструкция ДНК, включающие полинуклеотид, кодирующий представляющий интерес полипептид (например, вариант варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы). Иллюстративные штаммы-хозяева представляют собой бактериальные клетки. Термин "клетка-хозяин" включает протопласты, образованные из клеток, такие как протопласты Bacillus sp.

Термин "гетерологичный" в отношении полинуклеотида или белка относится к полинуклеотиду или белку, который в природе не встречается в клетке-хозяине.

Термин "эндогенный" в отношении полинуклеотида или белка относится к полинуклеотиду или белку, который встречается в клетке-хозяине в природе.

Как используют в настоящем документе, термин "экспрессия" относится к процессу, посредством которого получают полипептид на основе последовательности нуклеиновой кислоты гена. Процесс включает как транскрипцию, так и трансляцию.

Термины "селективный маркер" или "селектируемый маркер" относятся к гену, способному экспрессироваться в хозяине, обеспечивая простоту селекции клеток-хозяев, которые содержат этот ген. Примеры селективных маркеров включают, но не ограничиваются ими, гены устойчивости к противомикробным средствам (например, гигромицину, блеомицину или хлорамфениколу) и/или гены, которые обеспечивают метаболическое преимущество, такое как пищевое преимущество, в клетке-хозяине.

"Культивирование" относится к росту популяции микробных клеток в пригодных условиях в жидкой или твердой среде. Культивирование включает ферментативное биопревращение крахмального субстрата, содержащего гранулярный крахмал, в конечный продукт (как правило, в емкости или реакторе).

"Ферментация" представляет собой ферментативное и анаэробное разложение органических веществ микроорганизмами с образованием более простых органических соединений. Хотя ферментация происходит в анаэробных условиях, не предполагается, что термин ограничивается строго анаэробными условиями, поскольку ферментация также происходит в присутствии кислорода.

"Ген" относится к сегменту ДНК, который вовлечен в образование полипептида и включает кодирующие области, области, предшествующие кодирующим областям и следующие после них, и встроенные последовательности (интроны) между отдельными кодирующими сегментами (экзонами).

"Вектор" относится к полинуклеотидной последовательности, предназначенной для введения нуклеиновых кислот в один или несколько типов клеток. Векторы включают клонирующие векторы, экспрессирующие векторы, челночные векторы, плазмиды, фаговые частицы, кассеты и т.п.

"Экспрессирующий вектор" относится к конструкции ДНК, содержащей последовательность ДНК, кодирующую представляющий интерес полипептид, которая функционально связана с пригодной последовательностью контроля, способной осуществлять экспрессию ДНК в пригодном хозяине. Такие последовательности контроля могут включать промотор для осуществления транскрипции, необязательную последовательность оператора для контроля транскрипции, последовательность, кодирующую пригодные участки связывания рибосом на мРНК, энхансеры и последовательности, которые контролируют терминацию транскрипции и трансляции.

"Промотор" представляет собой регуляторную последовательность, которая вовлечена в связывание РНК-полимеразы для инициации транскрипции гена. Промотор может представлять собой индуцибельный промотор или конститутивный промотор. Иллюстративным промотором является промотор варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы (AmyL) Bacilluslicheniformis.

Термин "функционально связанный" означает, что определенные компоненты взаимосвязаны (включая, но не ограничиваясь этим, соседнее положение), что позволяет им функционировать предполагаемым для них образом. Например, регуляторная последовательность функционально связана с кодирующей последовательностью, так чтобы экспрессия кодирующей последовательности была под контролем регуляторных последовательностей.

Термин "под транскрипционным контролем" означает, что транскрипция полинуклеотидной последовательности, как правило, последовательности ДНК, зависит от функционально связанного с ней элемента, который обеспечивает инициацию транскрипции или запускает ее.

Термин "под трансляционным контролем" означает, что трансляция полинуклеотидной последовательности, как правило, последовательности РНК, в полипептид зависит от функционально связанного с ней элемента, который обеспечивает инициацию трансляции или запускает ее.

"Сигнальная последовательность" представляет собой последовательность аминокислот, связанную с N-концевой частью белка, которая облегчает секрецию белка за пределы клетки. Зрелая форма внеклеточного белка лишена сигнальной последовательности, которая отщепляется в ходе процесса секреции.

Как используют в настоящем документе, "биологически активный" относится к последовательности, имеющей определенную биологическую активность, такую как ферментативная активность. В случае амилаз по настоящему изобретению активность представляет собой активность варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы.

"Жесткость воды" является показателем неорганических элементов (например, кальция и магния), присутствующих в воде.

"Осахаривание" относится к ферментативному превращению крахмала в глюкозу.

"Желатинизация" означает солюбилизацию молекулы крахмала обработкой, образующей вязкую суспензию.

"Разжижение" относится к стадии превращения крахмала, в которой желатинизированный крахмал гидролизуется с образованием низкомолекулярных растворимых декстринов.

Термин "степень полимеризации (DP)" относится к числу (n) элементов ангидроглюкопиранозы в данном сахариде. Примерами DP1 являются моносахариды, такие как глюкоза и фруктоза. Примерами DP2 являются дисахариды, такие как мальтоза и сахароза. DP>3 обозначает полимеры со степенью полимеризации более 3.

В отношении переработки крахмала термины "конечный продукт" или "требуемый конечный продукт" относятся к определенным происходящим из источника углерода молекулам, в которые ферментативно превращается крахмальный субстрат.

Как используют в настоящем документе, термин "содержание сухих твердых веществ (ds)" относится к общему количеству твердых веществ в суспензии, выраженному в % в расчете на сухую массу.

Термин "суспензия" относится к водной смеси, содержащей нерастворимые твердые вещества.

Термин "остаточный крахмал" относится к остаточному крахмалу (растворимому или нерастворимому) в композиции после ферментации или ферментативного гидролиза содержащего крахмал субстрата.

Как используют в настоящем документе, "стадия повторного использования" относится к повторному использованию компонентов пульпы, которые включают остаточный крахмал, ферменты и/или микроорганизмы в качестве содержащих крахмал субстратов ферментов.

Термин "пульпа" относится к водной смеси, включающей ферментируемые источники углерода (углеводы), которую можно использовать для продукции ферментированного продукта, такого как спирт. В некоторых вариантах осуществления термин "бражка" и "пульпа" используют взаимозаменяемо.

Термин "барда" означает смесь неферментированных твердых веществ и воды, которая представляет собой осадок после удаления спирта из ферментированной пульпы.

Термины "сухое очищенное зерно (DDG)" и "сухое очищенное зерно с растворимыми веществами (DDGS)" относятся к пригодному побочному продукту ферментации зерна.

Как используют в настоящем документе, "этанологенный микроорганизм" относится к микроорганизму со способностью превращать сахар или олигосахарид в этанол. Этанологенные микроорганизмы являются этанологенными благодаря их способности экспрессировать один или несколько ферментов, которые по отдельности или вместе превращают сахар в этанол.

Как используют в настоящем документе, термин "продуцент этанола" или "продуцирующий этанол микроорганизм" относится к любому организму или клетке, которые способны продуцировать этанол из гексозы или пентозы. Как правило, продуцирующие этанол клетки содержат алкогольдегидрогеназу и пируватдекарбоксилазу. Примеры продуцирующих этанол микроорганизмов включают микроорганизмы грибов, таких как дрожжи. Предпочтительные дрожжи включают штаммы Sacchromyces, в частности S. cerevisiae.

В отношении ферментов амилаз и их субстратов термин "контактирование" относится к помещению фермента достаточно близко к субстрату для обеспечения превращения ферментом субстрата в конечный продукт. Контактирование может включать смешивание.

Термин "происходящий" охватывает термины "возникший из", "основанный на", "полученный", или "получаемый из", или "выделенный из" в зависимости от контекста.

Термин "ферментативное превращение", главным образом, относится к модификации субстрата (например, крахмала) под действием фермента (например, амилазы).

Как используют в настоящем документе, термин "удельная активность" относится к количеству моль субстрата, превращающегося в продукт препаратом фермента за единицу времени в конкретных условиях. Удельную активность выражают как единицы (Е)/мг белка.

Термин "выход" относится к количеству конечного продукта, продуцируемого с использованием способа, например, выраженному в концентрации, объеме, количестве или проценте от исходного материала.

"ATCC" относится к American Type Culture Collection, расположенной в Manassas, Va. 20108 (ATCC).

"NRRL" относится к Agricultural Research Service Culture Collection, National Center for Agricultural Utilization Research (и ранее известный как USDA Northern Regional Research Laboratory), Peoria, Ill.

Числовые диапазоны включают числа, определяющие диапазон.

Как правило, заголовки являются только описательными и не подразумеваются как ограничения.

1.2 Сокращения

Применяются следующие сокращения, если нет иных указаний

AEэтоксилат спирта
AEO этоксилат спирта
AEOS этоксисульфат спирта
AES этоксисульфат спирта
AFAUкислые элементы варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы грибов
AGU единица активности глюкоамилазы
AOSварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -олефинсульфонат
AS сульфат спирта
BAAварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза Bacillusamyloliquefaciens
BLABacillus licheniformis (или LAT)
BSAбычий сывороточный альбумин
кДНКкомплементарная ДНК
CMC карбоксиметилцеллюлоза
ДНК дезоксирибонуклеиновая кислота
DP3степень полимеризации с тремя субъединицами
DPn степень полимеризации с n субъединицами
DTMPAдиэтилтриаминпентауксусная кислота
EC комиссия по ферментам для классификации ферментов
ЭДТАэтилендиаминтетрауксусная кислота
EO оксид этилена
F&HC промышленная и домашняя гигиена
FAUединица амилазы грибов
GAглюкоамилаза
gpgзерна на галлон
HFCS кукурузный сироп с высоким содержанием фруктозы
HFSSсироп на основе крахмала с высоким содержанием фруктозы
IPTGизопропил-варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -D-1-тиогалактопиранозид
LASлинейный алкилбензолсульфонат
LOMLaunder-O-meter
LUединица Liquiphon
MW молекулярная масса
MWU модифицированная единица Wohlgemuth
NOBSнонаноилоксибензолсульфонат
NTAнитрилотриуксусная кислота
ПЦР полимеразная цепная реакция
PEGполиэтиленгликоль
PVAполи(виниловый спирт)
PVPполи(винилпирролидон)
РНКрибонуклеиновая кислота
SAS вторичные алкансульфонаты
TAED тетраацетилэтилендиамин
TCAтрихлоруксусная кислота
TSBтрипсинизированный соевый бульон
UFC ультрафильтрационный концентрат
масс./об.масса/объем
масс./масс. масса/масса
Wtдикий тип

1.3 Номенклатура

В настоящем описании и формуле изобретения используют общепринятые однобуквенный и трехбуквенный коды для аминокислотных остатков. Для простоты указания варианты варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы описывают с использованием следующей номенклатуры.

Исходная аминокислота(ы): положение(я): замещенная аминокислота(ы)

Согласно этой номенклатуре, например, замену серина аланином в 242 положении показывают как:

Ser242Ala или S242A,

делецию аланина в 30 положении показывают как:

Ala30* или A30* или варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 A30

и вставку дополнительного аминокислотного остатка, такого как лизин, показывают как:

Ala30AlaLys или A30AK.

Делецию участка из последовательно расположенных аминокислотных остатков, таких как аминокислотные остатки 30-33, указывают как (30-33)*, или варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 (A30-N33), или варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 30-33. Делецию двух последовательно расположенных аминокислот, таких как аминокислотные остатки R180-S181, показывают как варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS или варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 180-181.

Когда конкретная варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза содержит "делецию" по сравнению с другими варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазами и в такое положение внесена вставка, это показывают как:

*36Asp или *36D

для вставки аспарагиновой кислоты в положении 36.

Множественные мутации разделены знаками плюса, т.е.:

Ala30Asp+Glu34Ser или A30N+E34S,

что соответствует мутациям в положениях 30 и 34 с заменой аланина и глутаминовой кислоты аспарагином и серином соответственно.

Когда один или несколько альтернативных аминокислотных остатков могут быть встроены в данное положение, это указывают как

A30N,E или

A30N или A30E.

Более того, когда положение, подходящее для модификации, указано в настоящем документе без какой-либо предложенной модификации, следует понимать, что любой аминокислотный остаток может заменять аминокислотный остаток, присутствующий в этом положении. Таким образом, например, когда упоминают модификацию аланина в 30 положении, но не указывают конкретно, следует понимать, что аланин может быть удален или замещен любой другой аминокислотой, т.е. любой из: R, N, D, A, C, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y, V.

Кроме того, "A30X" означает любую из следующих замен: A30R, A30N, A30D, A30C, A30Q, A30E, A30G, A30H, A30I, A30L, A30K, A30M, A30F, A30P, A30S, A30T, A30W, A30Y или A30V;

или кратко: A30R,N,D,C,Q,E,G,H,I,L,K,M,F,P,S,T,W,Y,V.

Если исходный фермент, используемый для нумерации, уже имеет представляющий интерес для замены аминокислотный остаток в этом положении, используют следующую номенклатуру:

"X30N" или "X30N,V"

в случае, где, например, один из N или V присутствует в белке дикого типа. Таким образом, это означает, что другие соответствующие исходные ферменты заменены на "Asn" или "Val" в положении 30.

1.4 Характеристики аминокислотных остатков

Заряженные аминокислоты:

Asp, Glu, Arg, Lys, His

Отрицательно заряженные аминокислоты (где наиболее отрицательный остаток является первым):

Asp, Glu

Положительно заряженные аминокислоты (где наиболее положительный остаток является первым):

Arg, Lys, His

Нейтральные аминокислоты:

Gly, Ala, Val, Leu, Ile, Phe, Tyr, Trp, Met, Cys, Asn, Gln, Ser, Thr, Pro

Гидрофобные аминокислотные остатки (наиболее гидрофобный остаток приведен последним):

Gly, Ala, Val, Pro, Met, Leu, Ile, Tyr, Phe, Trp

Гидрофильные аминокислоты (наиболее гидрофильный остаток приведен последним):

Thr, Ser, Cys, Gln, Asn, Asp

1.5 Гомология (идентичность)

Полинуклеотид или полипептид, имеющий определенный процент (например, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или даже 99%) идентичности последовательности с другой последовательностью, означает, что при выравнивании это процентное количество оснований или аминокислотных остатков является одинаковым при сравнении двух последовательностей. Это выравнивание и процентную гомологию или идентичность можно определять с использованием любого пригодного программного обеспечения, известного в данной области, например программного обеспечения, описанного в CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F.M. Ausubel et al. (eds) 1987, Supplement 30, раздел 7.7.18). Предпочтительные программы включают Vector NTI Advance TM 9.0 (Invitrogen Corp. Carlsbad, CA), программу GCG Pileup, FASTA (Pearson et al. (1988) Proc. Natl. Acad. Sci. USA 85:2444-2448) и BLAST (BLAST Manual, Altschul et al., Natl Cent. Biotechnol. Inf., Natl Lib. Med. (NCIB NLM NIH), Bethesda, Md., и Altschul et al., (1997) NAR 25:3389-3402). Другой предпочтительной программой для выравнивания является ALIGN Plus (Scientific and Educational Software, PA), предпочтительно с использованием параметров по умолчанию. Другим программным обеспечением для последовательностей, которое является применимым, является TFASTA Data Searching Program, доступная в Sequence Software Package Version 6.0 (Genetics Computer Group, University of Wisconsin, Madison, WI).

Гомологию можно определить как степень идентичности между двумя последовательностями, указывающую на происхождение первой последовательности из второй. Гомологию можно пригодным образом определять с помощью компьютерных программ, известных в данной области, таких как GAP, предоставленная в пакете программ GCG (описанном выше). Таким образом, GAP GCG v8 можно использовать со стандартной оценочной матрицей для идентичности и следующих параметров по умолчанию: штраф за создание пропуска 5,0 и штраф за продолжение пропуска 0,3 соответственно для сравнения последовательностей нуклеиновых кислот и штраф за создание пропуска 3,0 и штраф за продолжение делеции 0,1 соответственно для сравнения белковых последовательностей. В GAP используется способ Needleman and Wunsch, (1970), J. Mol. Biol. 48:443-453, для проведения выравнивания и для вычисления идентичности.

Структурное выравнивание между AmyTS23 (SEQ ID NO:1) и, например, другой варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазой можно использовать для идентификации эквивалентных/соответствующих положений в других варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазах, имеющих высокую степень гомологии, например, приблизительно 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или даже 99% с AmyTS23. Одним из способов проведения указанного структурного выравнивания является использование программы Pile Up из пакета GCG с использованием значений по умолчанию для штрафов за пропуск, т.е. штраф за создание пропуска 3,0 и штраф за продолжение пропуска 0,1. Другие способы структурного выравнивания включают анализ гидрофобных кластеров (Gaboriaud et al., (1987) FEBS LETTERS 224, pp. 149-155) и способ обратного считывания (Huber, T; Torda, AE, PROTEIN SCIENCE Vol. 7, No.1, pp. 142-149 (1998)).

1.6 Гибридизация

Олигонуклеотидный зонд, используемый для охарактеризации AmyTS23 выше, можно пригодным образом получать на основе полной или частичной нуклеотидной или аминокислотной последовательности представляющей интерес варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы.

Пригодные условия для тестирования гибридизации вовлекают предварительное погружение в 5X SSC и прегибридизацию в течение 1 часа при 40°С в растворе 20% формамида, 5X раствора Денхардта, 50 мМ фосфата натрия, pH 6,8, и 50 мг денатурированной облученной ультразвуковым облучением ДНК тимуса теленка, с последующей гибридизацией в том же растворе, дополненном 100 мМ ATP, в течение 18 часов при 40°С, с последующим промыванием фильтра три раза в 2X SSC, 0,2% SDS при 40°С в течение 30 минут (низкая строгость), предпочтительно при 50°С (средняя строгость), более предпочтительно при 65°C (высокая строгость), еще более предпочтительно при 75°C (очень высокая строгость). Более подробное описание способа гибридизации может быть найдено в Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor, 1989.

В настоящем контексте термин "происходящий из" предназначен не только для указания на варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу, продуцированную или продуцируемую штаммом представляющего интерес организма, но также на варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу, кодируемую последовательностью ДНК, выделенной из такого штамма и продуцируемой в организме хозяина, трансформированном указанной последовательностью ДНК. Наконец, термин предназначен для указания на варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу, которая кодируется последовательностью ДНК синтетического происхождения и/или кДНК и которая обладает идентифицирующими характеристиками представляющей интерес варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы. Также термин предназначен для указания на то, что исходная варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза может представлять собой вариант встречающейся в природе варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, т.е. вариант, который является результатом модификации (вставки, замены, делеции) одного или нескольких аминокислотных остатков встречающейся в природе варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы.

Специалист в данной области поймет, что описанные последовательности также могут определяться способностью гибридизоваться в строгих условиях гибридизации с иллюстративной последовательностью AmyTS23 (например, SEQ ID NO:4, представленной на фиг.4). Нуклеиновая кислота является гибридизующейся с другой последовательностью нуклеиновой кислоты, когда одноцепочечная форма нуклеиновой кислоты может подвергаться отжигу с другой нуклеиновой кислотой в условиях соответствующей температуры и ионной силы раствора. Условия гибридизации и промывания хорошо известны в данной области (см., например, Sambrook (1989) выше, в частности главы 9 и 11). В некоторых вариантах осуществления строгие условия соответствуют Tm 65°С и 0,1×SSC, 0,1% SDS.

1.7 Исходные варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы

Согласно настоящему описанию любую варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу AmyTS23, как определено выше, можно использовать в качестве исходной (т.е. основной) варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы. В предпочтительном варианте осуществления источником исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы является штамм TS-23 Bacillus sp., например одна из варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаз, указанных выше, такая как варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза TS-23, имеющая аминокислотную последовательность, представленную в SEQ ID NO:1 (см. фиг.1).

1.8 Измененные свойства

В следующем разделе описана взаимосвязь между мутациями, которые присутствуют в варианте, описанном в настоящем документе, и желательными изменениями свойств (относительно свойств исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы TS-23), которые могут быть их результатом. Варианты, охватываемые композициями и способами по изобретению, подробно описаны в описании и только обобщены в следующих абзацах.

Как описано выше, один из аспектов композиций и способов относится к варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазам, происходящим или получаемым из варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы Bacillus sp. штамма TS-23, включая варианты/мутанты, имеющие измененные свойства в отношении исходных амилаз. Исходные варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы TS-23 представляют собой указанную выше исходную варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу TS-23 и гибридные или химерные варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, которые содержат по меньшей мере часть варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы TS-23, такие как аминокислотные последовательности зрелого полипептида.

Хотя варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу Bacillus sp. штамма TS-23 (SEQ ID NO:1) используют в качестве исходной точки для обсуждения вариантов амилаз, понятно, что в качестве исходной амилазы могут служить другие варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы Bacillus, имеющие высокую степень гомологии с варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазой Bacillus sp. штамма TS-23 без нарушения объема композиций и способов. Это особенно справедливо для других встречающихся в природе варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаз Bacillus, которые включают только минорную последовательность, отличающуюся по сравнению с варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазой Bacillus sp. штамма TS-23, не включающей замен, делеций или вставок, которые являются объектом настоящего описания.

В первом аспекте композиций и способов по изобретению предусмотрен вариант исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы штамма Bacillus sp., где вариант содержит по меньшей мере два из следующих изменений:

(a) укорочение C-конца,

(b) замена аминокислоты 201 (т.е. M201) с использованием SEQ ID NO:1 для нумерации или

(c) делеция по меньшей мере двух остатков, выбранных из группы, состоящей из R180, S181, T182 и G183.

Следует отметить, что нумерация аминокислотных остатков относится к SEQ ID NO:1. В некоторых вариантах осуществления изменения включают (a) и (b). В других вариантах осуществления изменения включают (a) и (c). В некоторых вариантах осуществления вариант может дополнительно включать замену в одном или нескольких остатках, выбранных из группы, состоящей из остатка 87, остатка 225, остатка 272 и остатка 282. Вариант амилазы предпочтительно обладает активностью варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы. Помимо конкретных указанных изменений остальные аминокислотные последовательности вариантов амилаз могут иметь по меньшей мере 85% идентичность аминокислотной последовательности с аминокислотной последовательностью SEQ ID NO:1.

В родственном аспекте предусмотрен вариант исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы AmyTS23, где вариант имеет аминокислотную последовательность, которая обладает по меньшей мере 85% идентичностью с исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазой и содержит укорочение C-конца. Вариант может иметь аминокислотную последовательность SEQ ID NO:2. Вариант может обладать повышенной активностью очистки крахмальных пятен в холодной воде по сравнению с исходной амилазой.

В некоторых вариантах осуществления вариант, имеющий укорочение C-конца, может дополнительно включать делецию остатков в положении R180 и S181 (относительно аминокислотной последовательности SEQ ID NO:1). Полученный вариант может иметь повышенную детергентную стабильность по сравнению с исходной амилазой.

В некоторых вариантах осуществления вариант, содержащий укорочение C-конца, может дополнительно включать замену остатка в положении 201 (также относительно аминокислотной последовательности SEQ ID NO:1). Полученный вариант может обладать повышенной окислительной стабильностью по сравнению с исходной амилазой.

В некоторых вариантах осуществления любой из указанных выше вариантов может дополнительно включать замену в одном или нескольких остатках, выбранных из группы, состоящей из остатка 87, остатка 225, остатка 272 и остатка 282.

1.8.1 Стабильность

В контексте вариантов, описанных в настоящем документе, мутации (включая аминокислотные замены и делеции), важные в отношении достижения измененной стабильности (т.е. более высокой или более низкой), в частности повышенной стабильности, особенно при высоких температурах (т.е. 70-120°С) и/или крайних значениях pH (т.е. низком или высоком значении pH, т.е. pH 4-6 или pH 8-11 соответственно), в частности при концентрациях свободного (т.е. несвязанного, таким образом, находящегося в растворе) кальция ниже 60 ч./млн, включают любые из мутаций, приведенных в разделе "Измененные свойства". Стабильность можно определять, как описано в разделе "Способы" ниже.

1.8.2 Зависящая от Ca2+ стабильность

Измененная зависящая от Ca2+ стабильность означает, что стабильность фермента при устранении Ca2+ улучшается, т.е. становится более высокой или более низкой в данном контексте. В контексте описанных в настоящее время вариантов мутации (включая замены и делеции аминокислот), важные с точки зрения достижения измененной зависящей от Ca2+ стабильности, в частности улучшенной зависящей от Ca2+ стабильности, т.е. более высокой или более низкой стабильности, особенно при высоких значениях pH (т.е. pH 8-10,5), включают любые из мутаций, приведенных в разделе "Измененные свойства".

1.8.3 Удельная активность

В следующем аспекте мутации (включая замены и делеции аминокислот), важные в отношении получения вариантов, обладающих измененной удельной активностью, в частности повышенной или сниженной удельной активностью, особенно при температурах 10-60°С, предпочтительно 20-50°С, особенно 30-40°С, включают любые мутации, приведенные в разделе "Измененные свойства". Удельную активность можно определять, как описано в разделе "Способы" ниже.

1.8.4 Стабильность при окислении

Описанные варианты могут обладать измененной стабильностью при окислении, в частности более высокой стабильностью при окислении, по сравнению с исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазой. Повышенная стабильность при окислении является преимущественной, например, в детергентных композициях, а сниженная стабильность при окислении может быть преимущественной в композиции для разжижения крахмала. Стабильность при окислении можно определять, как описано в разделе "Способы" ниже.

1.8.5 Измененный pH-профиль

Важные положения и мутации в отношении получения вариантов с измененным pH-профилем, в частности повышенной активностью при особенно высоких значениях pH (т.е. pH 8-10,5) или низких значениях pH (т.е. pH 4-6), включают мутации аминокислотных остатков, расположенных вблизи остатков активного центра.

Предпочтительные конкретные мутации/замены представляют собой мутации/замены, приведенные выше в разделе "Измененные свойства" для представляющих интерес положений. Пригодные анализы описаны в разделе "Способы" ниже.

1.8.6 Эффективность мытья

Положения и мутации, важные с точки зрения получения вариантов с улучшенной эффективностью мытья при особенно высоких значениях pH (т.е. pH 8,5-11), включают конкретные мутации/замены, приведенные выше в разделе "Измененные свойства" для представляющего интерес положения. Эффективность мытья можно тестировать, как описано ниже в разделе "Способы".

2. Способы получения вариантов варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы

Таким образом, один аспект относится к последовательности варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы штамма TS-23 Bacillus sp. для создания рекомбинантных форм, которые включают другие ранее определенные аминокислотные замены, делеции, трансверсии, вставки и их сочетания для получения вариантов варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы штамма TS-23 Bacillus sp. Эти варианты могут обладать дополнительным повышением продукции, повышенной pH-стабильностью, повышенной температурной стабильностью, сниженной потребностью в Ca2+, повышенной удельной активностью, улучшенными моющими характеристиками в отношении мытья посуды или стирки, повышенной растворимостью, повышенной стабильностью при хранении или их сочетаниями. Способы рекомбинантного получения вариантов можно выполнять с использованием предоставленных последовательностей и векторов или с использованием других способов, известных в данной области.

В данной области известно несколько способов внесения мутаций в гены. После короткого обсуждения клонирования кодирующих варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу последовательностей ДНК рассмотрены способы внесения мутаций в конкретные участки кодирующей варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу последовательности.

2.1 Клонирование последовательности ДНК, кодирующей варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу

Последовательности ДНК, кодирующие исходную варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу, можно выделять из любой клетки или микроорганизма, продуцирующих представляющую интерес варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу, с использованием различных способов, хорошо известных в данной области. Сначала следует сконструировать библиотеку геномной ДНК и/или кДНК с использованием хромосомной ДНК или матричной РНК из организма, который продуцирует варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу, подлежащую исследованию. Затем, если аминокислотная последовательность варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы известна, можно синтезировать гомологичные меченые олигонуклеотидные зонды и использовать их для идентификации кодирующих варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу клонов из геномной библиотеки, полученной из представляющего интерес организма. Альтернативно в качестве зонда для идентификации кодирующих варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу клонов можно использовать меченый олигонуклеотидный зонд, содержащий последовательности, гомологичные известному гену варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, с использованием условий гибридизации и промывания более низкой строгости.

Другой способ идентификации кодирующих варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу клонов может вовлекать встраивание фрагментов геномной ДНК в экспрессирующий вектор, такой как плазмида, трансформацию отрицательных по варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазе бактерий полученной геномной библиотекой ДНК, а затем высевание трансформированных бактерий на агар, содержащий субстрат для варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, позволяя, таким образом, идентифицировать клоны, экспрессирующие варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу.

Альтернативно последовательность ДНК, кодирующую фермент, можно получать синтетически общепринятыми стандартными способами, например способом с фосфоамидитом, описанным S.L. Beaucage и M.H. Caruthers (1981), или способом, описанным Matthes et al. (1984). В способе с фосфоамидитом синтезируют олигонуклеотиды, например, в автоматическом устройстве для синтеза ДНК, очищают, гибридизуют, лигируют и клонируют в соответствующие векторы.

Наконец, последовательность ДНК может представлять собой последовательность смешанного происхождения из синтетической ДНК и из кДНК или смешанного происхождения из геномной ДНК и кДНК, полученную лигированием фрагментов синтетического, геномного происхождения или из кДНК (в зависимости от ситуации, фрагментов, соответствующих различным частям полной последовательности ДНК), в соответствии со стандартными способами. Также последовательность ДНК можно получать с помощью полимеразной цепной реакции (ПЦР) с использованием специфических праймеров, например, как описано в патенте США № 4683202 или R.K. Saiki et al. (1988).

2.2 Сайт-направленный мутагенез

После выделения кодирующей варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу последовательности ДНК и идентификации желательных для мутации участков мутации можно вносить с использованием синтетических олигонуклеотидов. Эти олигонуклеотиды содержат нуклеотидные последовательности, фланкирующие желательные участки мутации; мутантные нуклеотиды встраивают в ходе синтеза олигонуклеотида. В конкретном способе в векторе, обладающем геном варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, создается одноцепочечный разрыв ДНК в кодирующей варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу последовательности. Затем синтетический нуклеотид, обладающий желательной мутацией, гибридизуют с гомологичной частью одноцепочечной ДНК. Затем оставшийся разрыв достраивают ДНК-полимеразой I (фрагмент Кленова) и конструкцию лигируют с использованием T4-лигазы. Конкретный пример этого способа описан Morinaga et al. (1984). В патенте США № 4760025 описано применение олигонуклеотидов, кодирующих множество мутаций, посредством внесения незначительных изменений в кассету. Однако еще большее количество мутаций можно внести одновременно способом Morinaga, поскольку можно применять множество олигонуклеотидов различной длины.

Другой способ внесения мутаций в кодирующие варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу последовательности ДНК описан Nelson and Long (1989). Он включает 3-стадийное получение фрагмента ПЦР, содержащего требуемую мутацию, внесенную с использованием химически синтезированной цепи ДНК в качестве одного из праймеров в реакциях ПЦР. Из полученного посредством ПЦР фрагмента можно расщеплением эндонуклеазами рестрикции выделить фрагмент ДНК, обладающий мутацией, и повторно встроить его в экспрессирующую плазмиду.

Альтернативные способы предоставления вариантов включают "перетасовку" генов, например, как описано в WO 95/22625 (от Affymax Technologies N.V.) или в WO 96/00343 (от Novo Nordisk A/S), или другие соответствующие методики, приводящие к гибридному ферменту, содержащему представляющую интерес мутацию(и), например замену(ы) и/или делецию(и).

2.3. Экспрессия вариантов варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы

Последовательность ДНК, кодирующую вариант варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, получаемый способами, описанными выше, или любыми альтернативными способами, известными в данной области, можно использовать для экспрессии варианта амилазы (например, фермента) с использованием экспрессирующего вектора, который, как правило, включает последовательности контроля, кодирующие промотор, оператор, участок связывания рибосом, сигнал инициации трансляции и необязательно ген репрессора или различные гены активаторов.

Рекомбинантный экспрессирующий вектор, обладающий последовательностью ДНК, кодирующей вариант варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, описанный в настоящем документе, может представлять собой любой вектор, который можно удобным образом подвергать способам рекомбинантных ДНК, и выбор вектора часто будет зависеть от клетки-хозяина, в которую его надлежит ввести. Таким образом, вектор может представлять собой автономно реплицирующийся вектор, т.е. вектор, который существует в качестве внехромосомного объекта, репликация которого не зависит от репликации хромосом, например плазмиду, бактериофаг или внехромосомный элемент, минихромосому или искусственную хромосому. Альтернативно вектор может представлять собой вектор, который при введении в клетку-хозяина встраивается в геном клетки-хозяина и реплицируется с хромосомой(ами), в которую он встроен.

В векторе последовательность ДНК должна быть функционально связанной с пригодной промоторной последовательностью. Промотор может представлять собой любую последовательность ДНК, которая демонстрирует транскрипционную активность в выбираемой клетке-хозяине, и она может быть образована из генов, кодирующих белки, либо гомологичные, либо гетерологичные, для клетки-хозяина. Примеры пригодных промоторов для направления транскрипции последовательности ДНК, кодирующей вариант варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, описанный в настоящем документе, особенно в бактериальном хозяине, представляют собой промотор lac-оперона E. coli , промоторы генов агаразы dagA Streptomyces coelicolor , промоторы гена варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы (amyL) Bacilluslicheniformis, промоторы гена мальтогенной амилазы GeoBacillusstearothermophilus (amyM), промоторы варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы Bacillusamyloliquefaciens (amyQ), промоторы генов xylA и xylB Bacillussubtilis и т.д. Для транскрипции в грибном хозяине примеры пригодных промоторов представляют собой промоторы, образованные из гена, кодирующего амилазу TAKA A. oryzae, аспарагиновую протеиназу Rhizomucor miehei, нейтральную варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу A. niger, кислотоустойчивую варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу A. niger, глюкоамилазу A. niger, липазу Rhizomucor miehei, щелочную протеазу A. oryzae , триозофосфатизомеразу A. oryzae или ацетамидазу A. nidulans.

Экспрессирующий вектор также может содержать пригодный терминатор транскрипции и, у эукариот, последовательности полиаденилирования, функционально связанные с последовательностью ДНК, кодирующей вариант варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, описанный в настоящем документе. Последовательности терминации и полиаденилирования пригодным образом могут быть получены из тех же источников, что и промотор.

Кроме того, вектор может содержать последовательность ДНК, обеспечивающую репликацию вектора в представляющей интерес клетке-хозяине. Примерами таких последовательностей являются ориджины репликации плазмид pUC19, pACYC177, pUB110, pE194, pAMB1 и pIJ702.

Также вектор может содержать селективный маркер, например ген, продукт которого комплементирует дефект в клетке-хозяине, такой как гены dal из B. subtilis или B. licheniformis , или ген, который придает устойчивость к антибиотикам, такую как устойчивость к ампициллину, канамицину, хлорамфениколу или тетрациклину. Более того, вектор может содержать селективные маркеры Aspergillus, такие как amdS, argB , niaD и sC, маркер, обеспечивающий устойчивость к гигромицину, или селекцию можно проводить посредством котрансформации, например, как описано в WO 91/17243.

Хотя внутриклеточная экспрессия может быть преимущественной в некоторых отношениях, например при использовании определенных бактерий или грибов в качестве клеток-хозяев, как правило, экспрессия фермента является внеклеточной. Как правило, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы Bacillus, упомянутые в настоящем документе, содержат преучасток, обеспечивающий секрецию экспрессированного фермента в культуральную среду. Если желательно, этот преучасток можно заменять другим преучастком, что удобно проводить посредством замены последовательностей ДНК, кодирующих соответствующие преучастки.

Способы, используемые для лигирования конструкции ДНК, кодирующей вариант варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, описанный в настоящем документе, промотор, терминатор и другие элементы соответственно, и для вставки ее в пригодные векторы, содержащие информацию, необходимую для репликации, хорошо известны специалистам в данной области (для сравнения, например, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor, 1989).

Клетку, содержащую либо конструкцию ДНК, либо экспрессирующий вектор, как определено выше, преимущественно используют в клетке-хозяине при рекомбинантной продукции варианта варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, описанного в настоящем документе. Клетку можно трансформировать описанной конструкцией ДНК, кодирующей вариант, удобным является встраивание конструкции ДНК (в виде одной или нескольких копий) в хромосому хозяина. Это встраивание, как правило, считается преимущественным, поскольку последовательность ДНК с большей вероятностью будет стабильно поддерживаться в клетке. Встраивание конструкций ДНК в хромосому хозяина можно проводить общепринятыми способами, например посредством гомологичной или гетерологичной рекомбинации. Альтернативно клетку можно трансформировать экспрессирующим вектором, как описано выше в отношении различных типов клеток-хозяев. Клетка может представлять собой клетку высшего организма (т.е. эукариот), такого как млекопитающее или насекомое, но предпочтительно она представляет собой микробную клетку, например клетку бактерий или грибов (включая дрожжи).

Примерами пригодных бактерий являются грамположительные бактерии, такие как Bacillus subtilis, Bacillus licheniformis, Bacillus lentus, Bacillus brevis, GeoBacillus stearothermophilus, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus coagulans, Bacillus circulans, Bacillus lautus, Bacillus megaterium, Bacillus thuringiensis, или Streptomyces lividans, или Streptomyces murinus, или грамотрицательные бактерии, такие как E. coli. Трансформацию бактерий, например, можно осуществлять путем трансформации протопласта или с использованием компетентных клеток по существу известным образом.

Примерами пригодных дрожжей являются виды Saccharomyces или Schizosaccharomyces , например Saccharomyces cerevisiae. Нитчатые грибы преимущественно могут относится к виду Aspergillus, например Aspergillus oryzae или Aspergillus niger. Клетки грибов можно трансформировать посредством процесса, вовлекающего образование протопласта и трансформацию протопластов с последующей регенерацией клеточной стенки по существу известным способом. Пригодный способ трансформации клеток-хозяев Aspergillus описан, например, в EP 238023.

В другом аспекте предусмотрен способ продукции варианта варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, причем этот способ включает культивирование клетки-хозяина, как описано выше, в условиях, способствующих продукции варианта, и выделение варианта из клеток и/или культуральной среды.

Среда, используемая для культивирования клеток, может представлять собой любую общепринятую среду, пригодную для выращивания представляющих интерес клеток-хозяев и экспрессии варианта варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, описанного в настоящем документе. Пригодные среды доступны от коммерческих поставщиков, или их можно получать согласно опубликованным рецептам (например, как описано в каталогах American Type Culture Collection).

Вариант варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, секретируемый из клеток-хозяев, можно удобным образом выделять из культуральной среды хорошо известными способами, включая отделение клеток от среды центрифугированием или фильтрацией и осаждение белковых компонентов среды с помощью соли, такой как сульфат аммония, с последующим применением хроматографических способов, таких как ионообменная хроматография, аффинная хроматография или сходные с ними.

3. Промышленное применение

Варианты варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, представленные в настоящем документе, обладают ценными свойствами, предусматривающими множество промышленных применений. В частности, варианты фермента применимы в качестве компонента в детергентных композициях для стирки, мытья посуды и очистки твердых поверхностей.

Один или несколько из вариантов с измененными свойствами можно использовать для переработки крахмала, в частности для осахаривания крахмала, особенно для разжижения крахмала (см., например, патент США № 3912590, патентные заявки EP № 252 730 и 63 909, WO 99/19467 и WO 96/28567, все из которых включены в настоящий документ в виде ссылок в полном объеме). Также предусматриваются композиции для осахаривания крахмала, которые, помимо описанного в настоящем документе варианта, также содержат глюкоамилазу, пуллуланазу и другие варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы.

Кроме того, один или несколько вариантов также особенно пригодны для изготовления подсластителей и этанола (см., например, патент США № 5231017, включенный в настоящий документ в виде ссылки в полном объеме), такого как топливный, пищевой и промышленный этанол, из крахмала или целых зерен.

Описанные в настоящем документе варианты также могут быть пригодны для расшлихтовки текстильных изделий, тканей и предметов одежды (см., например, WO 95/21247, патент США № 4643736 и EP 119920, включенные в настоящий документ в виде ссылок в полном объеме), изготовления бражки или пивоварения, при изготовлении пульпы и бумаги.

3.1 Переработка крахмала

Общепринятые процессы переработки крахмала, такие как процессы разжижения и осахаривания, описаны, например, в патенте США № 3912590 и патентных публикациях EP № 252730 и 63909, включенных в настоящий документ в качестве ссылок в полном объеме.

В одном из вариантов осуществления способ переработки крахмала, деградирующий крахмал до низкомолекулярных углеводных компонентов, таких как сахара или заменители жиров, включает стадию расщепления разветвленной структуры.

3.2 Превращение крахмала в сахар

В случае преобразования крахмала в сахар крахмал деполимеризуют. Такой процесс деполимеризации состоит из стадии предварительной обработки и двух или трех последовательных стадий процесса, а именно процесса разжижения, процесса осахаривания и, в зависимости от требуемого конечного продукта, необязательно процесса изомеризации.

3.3 Предварительная обработка нативного крахмала

Нативный крахмал состоит из микроскопических гранул, которые нерастворимы в воде при комнатной температуре. Когда водную суспензию крахмала нагревают, гранулы набухают и в конечном итоге разрываются, рассредоточивая молекулы крахмала в растворе. В ходе этого процесса "желатинизации" происходит значительное повышение вязкости. Поскольку уровень твердых веществ в типичном промышленном процессе составляет 30-40%, крахмал должен быть расплавленным или "разжиженным", так чтобы его можно было обрабатывать. Этого снижения вязкости в настоящее время достигают посредством ферментативной деградации.

3.4 Разжижение

В процессе стадии разжижения крахмал с длинной цепью расщепляется варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазой на разветвленные и линейные более короткие элементы (мальтодекстрины). Процесс разжижения проводят при 105-110°С в течение от 5 до 10 минут, а затем в течение 1-2 часов при 95°С, pH находится между 5,5 и 6,2. Для обеспечения оптимальной стабильности фермента в этих условиях добавляют 1 мМ кальций (40 ч./млн свободных ионов кальция). После этой обработки разжиженный крахмал имеет "эквивалент декстрозы" (DE), составляющий 10-15.

3.5 Осахаривание

После процесса разжижения мальтодекстрины превращают в декстрозу добавлением глюкоамилазы (например, OPTIDEX® L-400) и расщепляющего разветвленную структуру фермента, такого как изоамилаза (патент США № 4335208) или пуллуланаза. Перед этой стадией pH снижают до величины менее 4,5, поддерживая высокую температуру (выше 95°C) для инактивации разжижающей варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы в целях уменьшения образования короткого олигосахарида, называемого "предшественниками панозы", который не может быть надлежащим образом гидролизован расщепляющим разветвленную структуру ферментом.

Температуру снижают до 60°С и добавляют глюкоамилазу и устраняющий ветвление фермент. Процесс осахаривания продолжается в течение 24-72 часов.

Обычно при денатурации варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы после стадии разжижения приблизительно 0,2-0,5% продукта осахаривания представляет собой разветвленный трисахарид, Glcpварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 1-6Glcpварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 1-4Glc (паноза), который может быть деградирован пуллуланазой. Если в процессе осахаривания присутствует активная амилаза со стадии разжижения (т.е. без денатурации), этот уровень может составлять до 1-2%, что крайне нежелательно, поскольку это значительно снижает выход осахаривания.

3.6 Изомеризация

Когда требуемый конечный продукт в виде сахара представляет собой, например, сироп с высоким содержанием фруктозы, сироп декстрозы можно превращать во фруктозу. После процесса осахаривания pH повышают до величины в диапазоне 6-8, предпочтительно pH 7,5, и кальций удаляют ионным обменом. Затем сироп декстрозы превращают в сироп с высоким содержанием фруктозы с использованием, например, иммобилизованной глюкозоизомеразы (такой, как Gensweet® IGI-HF).

3.7 Продукция этанола

В общем, продукцию спирта (этанола) из цельного зерна можно разделить на 4 основных стадии:

измельчение,

разжижение,

осахаривание,

ферментация.

3.7.1 Измельчение

Зерно измельчают для открытия структуры и возможности последующей переработки. Двумя используемыми способами являются влажное или сухое измельчение. При сухом измельчении цельное зерно измельчают и используют в остальной части процесса. Влажное измельчение обеспечивает очень хорошее разделение зародыша и питательной части (крахмальные гранулы и белок), и его применяют, с некоторыми исключениями, в местах, где проводят параллельную продукцию сиропов.

3.7.2 Разжижение

В процессе разжижения крахмальные гранулы солюбилизируют гидролизом до мальтодекстринов, главным образом, с DP более 4. Гидролиз можно проводить обработкой кислотой или ферментативно варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазой. Гидролиз кислотой используют ограничено. Сырье может представлять собой измельченное цельное зерно или побочную фракцию переработки крахмала.

Ферментативное разжижение, как правило, проводят в качестве трехстадийного процесса в горячей суспензии. Суспензию нагревают до 60-95°С, предпочтительно 80-85°С, и добавляют фермент(ы). Затем суспензию подвергают струйной обработке при приблизительно 95-140°С, предпочтительно 105-125°С, охлаждают до 60-95°С и добавляют большее количество фермента(ов), обеспечивая конечный гидролиз. Процесс разжижения проводят при pH 4,5-6,5, как правило, при pH между 5 и 6. Измельченное и разжиженное зерно также известно как пульпа.

3.7.3 Осахаривание

Для получения низкомолекулярных сахаров с DP1-3, которые могут метаболизироваться дрожжами, мальтодекстрин после разжижения необходимо далее гидролизовать. Гидролиз, как правило, проводят ферментативно глюкоамилазами, альтернативно варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -глюкозидазами, или можно использовать кислые варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы. Полная стадия осахаривания может длиться вплоть до 72 часов, однако обычно делают только предварительное осахаривание в течение, как правило, 40-90 минут, а затем полное осахаривание в ходе ферментации (SSF). Осахаривание проводят, как правило, при температурах 30-65°С, как правило, при приблизительно 60°С, и при pH 4,5.

3.7.4 Ферментация

В пульпу, как правило, добавляют дрожжи из Saccharomyces spp., и ферментация продолжается в течение 24-96 часов, как правило, 35-60 часов. Температура составляет между 26-34°C, как правило, приблизительно 32°С, и pH составляет pH 3-6, предпочтительно приблизительно pH 4-5.

Следует отметить, что наиболее широко используемым способом является способ одновременного осахаривания и ферментации (SSF), где отсутствует стадия выдерживания для осахаривания, что означает, что дрожжи и фермент добавляют вместе. Когда проводят SSF, обычно добавляют стадию предварительного осахаривания при температуре выше 50°С, непосредственно перед ферментацией.

3.8 Дистилляция

После ферментации пульпу подвергают дистилляции для экстрагирования этанола. Этанол, полученный способом, описанным в настоящем документе, можно использовать, например, в качестве топливного этанола; пищевого этанола, т.е. питьевого нейтрального спирта; или промышленного этанола.

3.9 Побочные продукты

После ферментации остается зерно, которое обычно используют для кормов для животных либо в жидкой форме, либо в высушенной.

Дополнительная информация о том, как проводить разжижение, осахаривание, ферментацию, дистилляцию и выделение этанола хорошо известна специалисту.

В соответствии с описанным в настоящем документе способом осахаривание и ферментацию можно проводить одновременно или по отдельности.

3.10 Продукция пульпы и бумаги

Также можно использовать вариант щелочной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, как описано в настоящем документе, для продукции лигноцеллюлозных материалов, таких как пульпа, бумага и картон, из упрочненных крахмалом отходов бумаги и картона, особенно где превращение в волокнистую массу происходит при pH более 7 и где амилазы способствуют дезинтеграции материала отходов посредством деградации упрочняющего крахмала. варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -Амилаза особенно пригодна в способе продукции бумажной массы из покрытой крахмалом печатной бумаги. Способ можно выполнять, как описано в WO 95/14807, и он включает следующие стадии:

a) дезинтеграцию бумаги с получением пульпы,

b) обработку деградирующим крахмал ферментом до, в процессе или после стадии a) и

c) отделение частиц чернил от пульпы после стадий a) и b).

варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -Амилазы также могут быть высоко пригодными для модификации крахмала, где ферментативно модифицированный крахмал используют при изготовлении бумаги вместе с щелочными наполнителями, такими как карбонат кальция, каолин и глины. С помощью описанных щелочных варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаз становится возможной модификация крахмала в присутствии наполнителя, таким образом, обеспечивая более простой интегрированный процесс.

3.11 Расшлихтовка текстильных изделий, тканей и предметов одежды

варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -Амилаза по настоящему изобретению также может быть пригодна для расшлихтовки текстильных изделий, тканей и предметов одежды. В текстильной промышленности варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы традиционно используют в качестве вспомогательного средства в процессе расшлихтовки для облегчения удаления содержащей крахмал шлихты, которая служит в качестве защитного покрытия на уточной пряже в процессе тканья. Полное удаление покрытия шлихты после тканья является важным для обеспечения оптимальных результатов при последующих процессах, в которых ткань очищают, отбеливают и сушат. Ферментативное разрушение крахмала является предпочтительным, поскольку оно не влечет за собой какого-либо вредного действия на материал ткани. Для снижения стоимости обработки и повышения производительности предприятия обработку для расшлихтовки иногда комбинируют со стадиями очистки и отбеливания. В таких случаях для разрушения крахмала обычно используют неферментные вспомогательные средства, такие как щелочные или окислительные агенты, поскольку традиционные варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы мало совместимы с высокими уровнями pH и отбеливателями. Неферментативное разрушение крахмальной шлихты приводит к некоторому повреждению волокон вследствие применения достаточно агрессивных химических веществ. Таким образом, может быть желательным использование вариантов варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, поскольку они обладают повышенной эффективностью в щелочных растворах. варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -Амилазы можно использовать отдельно или в сочетании с целлюлазой при расшлихтовке содержащей целлюлозу ткани или текстильного изделия.

Способы расшлихтовки и отбеливания хорошо известны в данной области. Например, такие способы описаны в WO 95/21247, патенте США № 4643736 и EP 119920, которые включены в настоящий документ в виде ссылок в полном объеме.

Коммерчески доступные продукты для расшлихтовки включают OPTISIZE® FLEX от Genencor.

Также предусмотрены композиции и способы для обработки тканей (например, для расшлихтовки тканей) с использованием одной или нескольких варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаз штамма TS-23 Bacillus sp. или их вариантов. Фермент можно использовать в любом способе обработки тканей, который хорошо известен в данной области, см. например, патент США № 6077316. Например, в одном аспекте осязательные ощущения и внешний вид ткани улучшают способом, включающим контактирование ткани с варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазой штамма TS-23 Bacillus sp. или ее вариантом в растворе. В одном аспекте ткань обрабатывают раствором под давлением.

В одном аспекте ферменты применяют до или после тканья тканей, или в ходе стадии расшлихтовки, или на одной или нескольких дополнительных стадиях обработки ткани. В ходе тканья тканей нити подвергают воздействию значительного механического натяжения. Перед тканьем на механических ткацких станках основную пряжу часто покрывают крахмалом или производными крахмала для шлихтования в целях повышения ее прочности при растяжении и для предотвращения разрыва. Для удаления этого крахмала или производных крахмала можно применять ферменты. После тканья ткани ткань можно подвергать стадии расшлихтовки. За этим может следовать одна или несколько дополнительных стадий обработки ткани. Расшлихтовка представляет собой действие удаления шлихты из ткани. После тканья покрытие из шлихты должно быть удалено перед последующей обработкой ткани в целях обеспечения результатов, состоящих в однородности и устойчивости при стирке. Также предусмотрен способ расшлихтовки, включающий ферментативный гидролиз шлихты под действием варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы штамма TS-23 Bacillus sp. или ее варианта.

Ферменты можно использовать отдельно или с другими осуществляющими расшлихтовку химическими реагентами и/или осуществляющими расшлихтовку ферментами для расшлихтовки тканей, включая содержащие хлопок ткани, в качестве детергентных добавок, например, в водных композициях. варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -Амилазу штамма TS-23 Bacillus sp. или ее вариант также можно использовать в композициях и способах для обеспечения изношенного вида белья, окрашенного индиго, и одежды из денима. Для изготовления одежды ткань можно нарезать и шить из нее белье или одежду, которые затем подвергают конечной обработке. В частности, для изготовления джинсов из денима разработаны различные способы ферментативной конечной обработки. Конечную обработку одежды из денима в норме начинают ферментативной стадией расшлихтовки, в ходе которой одежду подвергают воздействию амилолитических ферментов для обеспечения мягкости ткани и повышения доступности хлопка для последующих стадий ферментативной конечной обработки. Ферменты можно использовать в способах конечной обработки одежды из денима (например, в "процессе биоизнашивания"), ферментативной расшлихтовки и обеспечения мягкости ткани и/или в процессе окончательной обработки. Дозировка амилазы варьирует в зависимости от типа процесса. Меньшие дозировки могут потребовать большего времени, чем большие дозировки того же фермента. Однако не существует верхнего предела количества присутствующей амилазы для расшлихтовки кроме предела, определяемого физическими ограничениями раствора. Таким образом, предел фермента может представлять собой количество, способное растворяться в растворе. Как правило, ферменты для расшлихтовки, такие как варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, включают в композиции для обработки в количестве от приблизительно 0,00001% до приблизительно 2% белка фермента по массе ткани; или от приблизительно 0,0001% до приблизительно 1% белка фермента по массе ткани; или от приблизительно 0,001% до приблизительно 0,5% белка фермента по массе ткани; и в другом примере оно может составлять от приблизительно 0,01% до приблизительно 0,2% белка фермента по массе ткани.

3.12 Изготовление бражки

Варианты варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаз, представленные в настоящем документе, также могут быть пригодны в способах изготовления бражки; варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, главным образом, можно добавлять в процессе образования пульпы.

3.13 Детергентные композиции

Варианты варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, описанные в настоящем документе, можно добавлять в детергентную композицию, и, таким образом, они становятся ее компонентом.

Детергентную композицию, представленную в настоящем документе, например, можно изготавливать в виде детергентной композиции для ручной или машинной стирки, включая композицию добавки для стирки, пригодную для предварительной обработки испачканной ткани, и добавляемую при полоскании композицию для смягчения ткани, или ее можно изготавливать в виде детергентной композиции для применения в основных действиях, направленных на очистку бытовых твердых поверхностей, или ее можно изготавливать для действий, связанных с ручной или машинной стиркой.

В конкретном аспекте в настоящем документе предусматривается детергентная добавка, содержащая вариант фермента, описанный в настоящем документе. Детергентная добавка, так же как и детергентная композиция, может содержать один или несколько других ферментов, таких как протеаза, липаза, пероксидаза, другой амилолитический фермент, например другую варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу, глюкоамилазу, мальтогенную амилазу, CGT-азу и/или целлюлазу, маннаназу (такую, как MANNASTARTM от Danisco US Inc., Genencor Division), пектиназу, пектинлиазу, кутиназу и/или лакказу.

Как правило, свойства выбранного фермента(ов) должны быть совместимы с выбранным детергентом (например, оптимум pH, совместимость с другими ферментативными и неферментативными ингредиентами и т.д.), и фермент(ы) должен(ны) присутствовать в эффективных количествах.

Протеазы: пригодные протеазы включают протеазы животного, растительного или микробного происхождения. Микробное происхождение является предпочтительным. Включены химически модифицированные или полученные способами белковой инженерии мутанты. Протеаза может представлять собой сериновую протеазу или металлопротеиназу, предпочтительно щелочную микробную протеазу, трипсин-подобную протеазу или химотрипсин-подобную протеазу. Примерами щелочных протеаз являются субтилизины, особенно субтилизины, источником которых являются Bacillus, например субтилизин Novo, субтилизин Carlsberg, субтилизин 309, субтилизин 147 и субтилизин 168 (описанные в WO 89/06279). Примерами трипсин-подобных протеаз являются трипсин (например, источником которого являются свиньи или крупный рогатый скот) и протеаза Fusarium (описанная в WO 89/06270 и WO 94/25583).

Примеры пригодных протеаз также включают, но не ограничиваются ими, варианты, описанные в WO 98/23732, WO 99/20770, WO 92/19729, WO 98/20115, WO 98/20116 и WO 98/34946, особенно варианты с заменами в одном или нескольких из следующих положений: 27, 36, 57, 76, 87, 97, 101, 104, 120, 123, 167, 170, 194, 206, 218, 222, 224, 235 и 274.

Примеры коммерчески доступных протеаз включают, но не ограничиваются ими, ALCALASE®, SAVINASE®, PRIMASE®, DURALASE®, ESPERASE® и KANNASE® (от Novozymes A/S), MAXATASE®, MAXACAL®, MAXAPEM®, PROPERASE®, PURAFECT®, PURAFECT OXP®, FN2®, FN3® и FN4® (Genencor).

Липазы: пригодные липазы включают липазы бактерий или грибов. Они включают химически модифицированные или полученные способами белковой инженерии мутанты. Примеры пригодных липаз включают, но не ограничиваются ими, липазы из Humicola (синоним Thermomyces), например из H. lanuginosa (T. lanuginosus), как описано в EP 258068 и EP 305216, или из H. insolens, как описано в WO 96/13580; липазу Pseudomonas, например, из P. alcaligenes или P. pseudoalcaligenes (EP 218 272), P. cepacia (EP 331 376), P. stutzeri (GB 1372034), P. fluorescens , Pseudomonas sp. штамм SD 705 (WO 95/06720 и WO 96/27002), P. wisconsinensis (WO 96/12012); липазу Bacillus, например, из B. subtilis (Dartois et al. Biochemica et Biophysica Acta, 1131: 253-360 (1993)), B. stearothermophilus (JP 64/744992) или B. pumilus (WO 91/16422). Дополнительные иллюстративные варианты липазы, предусмотренные для применения в составах, включают липазы, описанные, например, в WO 92/05249, WO 94/01541, EP 407 225, EP 260 105, WO 95/35381, WO 96/00292, WO 95/30744, WO 94/25578, WO 95/14783, WO 95/22615, WO 97/04079 и WO 97/07202.

Коммерчески доступные ферменты-липазы включают LIPOLASETM и LIPOLASE ULTRATM (Novozymes A/S).

Полиэстеразы: в композицию могут быть включены пригодные полиэстеразы. Пригодные полиэстеразы включают, например, полиэстеразы, описанные в WO 01/34899 и WO 01/14629.

Амилазы: также могут быть включены одна или несколько дополнительных амилаз (в дополнение к варианту(ам) амилазы, описанному(ным) в настоящем документе). Пригодные амилазы (варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 и/или варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 ) включают амилазы бактерий или грибов. Они включают химически модифицированные или полученные способами белковой инженерии мутанты. Амилазы включают, например, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, полученные из Bacillus, например, конкретного штамма B. licheniformis, более подробно описанные в GB 1296839. Примерами пригодных варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаз являются варианты, описанные в WO 94/18314, WO 96/39528, WO 94/02597, WO 94/18314, WO 96/23873 и WO 97/43424, особенно варианты с заменами в одном или нескольких из следующих положений: 15, 23, 105, 106, 124, 128, 133, 154, 156, 181, 188, 190, 197, 202, 208, 209, 243, 264, 304, 305, 391, 408 и 444.

Коммерчески доступными варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазами являются DURAMYLTM, LIQUEZYME TM, TERMAMYLTM, NATALASETM, STAINZYME TM PLUS, STAINZYMETM ULTRA, FUNGAMYLTM и BANTM (Novozymes A/S), RAPIDASETM и PURASTARTM (от Genencor).

Целлюлазы : в композиции можно добавлять целлюлазы. Пригодные целлюлазы включают целлюлазы бактерий или грибов. Они включают химически модифицированные или полученные способами белковой инженерии мутанты. Пригодные целлюлазы включают целлюлазы из рода Bacillus , Pseudomonas, Trichoderma, Humicola, Fusarium, Thielavia, Acremonium, например целлюлазы грибов, полученные из Humicola insolens, Myceliophthora thermophila и Fusarium oxysporum, описанные, например, в патенте США № 4435307; патенте США № 5648263; патенте США № 5691178; патенте США № 5776757 и WO 89/09259. Иллюстративные целлюлазы Trichoderma reesei описаны в патенте США № 4689297, патенте США № 5814501, патенте США № 5324649, WO 92/06221 и WO 92/06165. Иллюстративные целлюлазы Bacillus описаны в патенте США № 6562612.

Коммерчески доступные целлюлазы включают CELLUZYME® и CAREZYME® (Novozymes A/S); CLAZINASE® и PURADAX HA® (Genencor International Inc.); и KAC-500(B)® (Kao Corporation).

Пероксидазы/Оксидазы : пригодные пероксидазы/оксидазы включают пероксидазы/оксидазы растений, бактерий или грибов. Они включают химически модифицированные или полученные способами белковой инженерии мутанты. Примеры пригодных пероксидаз включают пероксидазы из Coprinus, например, из C. cinereus и их варианты, такие как варианты, описанные в WO 93/24618, WO 95/10602 и WO 98/15257.

Коммерчески доступные пероксидазы включают, например, GUARDZYME® (Novozymes A/S).

В детергентную композицию может быть включен детергентный(ые) фермент(ы) посредством добавления отдельных добавок, содержащих один или несколько ферментов, или посредством добавления комбинированной добавки, содержащей все из этих ферментов. Детергентную добавку, т.е. отдельную добавку или комбинированную добавку, можно изготавливать, например, в виде гранулята, жидкости, суспензии и т.д. Иллюстративные составы детергентных добавок представляют собой грануляты, в частности непылящие грануляты, жидкости, в частности стабилизированные жидкости, или суспензии.

Непылящие грануляты можно получать, например, как описано в патентах США № 4106991 и 4661452, и необязательно на них можно наносить покрытие способами, известными в данной области. Примерами восковидных материалов покрытия являются продукты поли(оксида этилена) (например, полиэтиленгликоль, PEG) со средней молярной массой от 1000 до 20000; этоксилированные нонилфенолы, имеющие от 16 до 50 элементов оксида этилена; этоксилированные жирные спирты, в которых спирт содержит от 12 до 20 атомов углерода и в которых имеется от 15 до 80 элементов оксида этилена; жирные спирты; жирные кислоты; моно-, ди- и триглицериды жирных кислот. Примеры пленкообразующих материалов для покрытия, пригодных для нанесения способами в псевдоожиженном слое, приведены, например, в патенте Великобритании № 1483591. Жидкие препараты ферментов могут быть стабилизированы, например, добавлением полиола, такого как пропиленгликоль, сахара или спирта сахара, молочной кислоты или борной кислоты в соответствии с общепринятыми способами. Другие стабилизаторы ферментов хорошо известны в данной области. Защищенные ферменты можно получать способом, описанным, например, в заявке EP № 238216.

Как правило, детергентная композиция может быть в любой удобной форме, например бруска, таблетки, порошка, гранул, пасты или жидкости. Жидкий детергент может быть водным, как правило, содержащим вплоть до приблизительно 70% воды и от 0% до приблизительно 30% органического растворителя. Компактные детергентные гели содержат, например, приблизительно 30% воды или менее.

Детергентная композиция содержит одно или несколько поверхностно-активных веществ, которые могут быть неионными, в том числе полуполярными, и/или анионными, и/или катионными, и/или цвиттерионными. Поверхностно-активные вещества, как правило, присутствуют в широком диапазоне от приблизительно 0,1% до 60% по массе.

Когда он включен, детергент, как правило, может содержать от приблизительно 1% до приблизительно 40% анионного поверхностно-активного вещества, когда оно включено, такого как линейный алкилбензолсульфонат, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -олефинсульфонат, алкилсульфат (сульфат жирного спирта), этоксисульфат спирта, вторичный алкансульфонат, метиловый эфир жирной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -сульфокислоты, алкил- или алкенилянтарная кислота или мыло.

Когда он включен, детергент, как правило, может содержать от приблизительно 0,2% до приблизительно 40% неионного поверхностно-активного вещества, когда оно включено, такого как этоксилат спирта, этоксилат нонилфенола, алкилполигликозид, алкилдиметиламиноксид, этоксилированный моноэтаноламид жирной кислоты, моноэтаноламид жирной кислоты, амид жирной полигидроксиалкилкислоты или N-ацил-N-алкильные производные глюкозамина ("глюкамиды").

Детергент может содержать от 0% до приблизительно 65% детергентного моющего компонента или комплексообразующего вещества, такого как цеолит, дифосфат, трифосфат, фосфонат, карбонат, цитрат, нитрилотриуксусная кислота, этилендиаминтетрауксусная кислота (EDTA), диэтилентриаминпентауксусная кислота, алкил- или алкенилянтарная кислота, растворимые силикаты или слоистые силикаты (например, SKS-6 от Hoechst).

Детергент может содержать один или несколько полимеров. Примерами являются карбоксиметилцеллюлоза (CMC), поли(винилпирролидон) (PVP), поли(этиленгликоль) (PEG), поли(виниловый спирт) (PVA), поли(винилпиридин-N-оксид), поли(винилимидазол), поликарбоксилаты, например полиакрилаты, сополимеры малеиновая/акриловая кислота и сополимеры лаурилметакрилат/акриловая кислота.

Детергент может содержать систему для отбеливания, которая может содержать источник H2O 2, такой как перборат или перкарбонат, который может быть комбинирован с образующим перкислоту активатором отбелки (например, тетраацетилэтилендиамином или нонаноилоксибензолсульфонатом). Альтернативно система для отбеливания может содержать пероксикислоты (например, пероксикислоты амидного, имидного или сульфонового типа). Также система для отбеливания может представлять собой ферментативную систему для отбеливания. См., например, WO 05/056782.

Фермент(ы) детергентной композиции и в способах по изобретению можно стабилизировать с использованием общепринятых стабилизаторов, например, таких как полиол (например, пропиленгликоль или глицерин), сахар или спирт сахара, молочная кислота, борная кислота, или производное борной кислоты (например, ароматический боратный сложный эфир), или производное фенилбороновой кислоты (например, 4-формилфенилбороновая кислота), и композицию можно изготавливать, как описано в WO 92/19709 и WO 92/19708.

Также детергент может содержать другие общепринятые ингредиенты детергентов, например, такие как кондиционеры для ткани, включая глины, пенообразователи, пеногасители, антикоррозионные средства, суспендирующие грязь вещества, средства против повторного отложения грязи, красители, бактерицидные вещества, оптические отбеливатели, гидротропные вещества, ингибиторы потускнения или отдушки.

В настоящее время предусмотрено, что в детергентные композиции, в частности, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу штамма TS-23 Bacillus sp. или ее вариант, можно добавлять в количестве, соответствующем от приблизительно 0,01 до приблизительно 100 мг белка фермента на литр моющей жидкости, например от приблизительно 0,05 до приблизительно 5,0 мг ферментного белка на литр моющей жидкости или от приблизительно 0,1 до приблизительно 1,0 мг белка фермента на литр моющей жидкости.

Один или несколько вариантов фермента, описанных в настоящем документе, могут быть дополнительно включены в детергентные составы, описанные в WO 97/07202, которая включена в настоящий документ в качестве ссылки.

4. Композиции и применение

Один или несколько вариантов фермента, описанных в настоящем документе, также можно использовать в способах, в которых используется вариант варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы в детергентах, в частности в детергентных композициях для стирки или в детергентных композициях для мытья посуды, в моющих композициях для очистки твердых поверхностей и в композициях для расшлихтовки текстильных изделий, тканей или предметов одежды, в способах продукции пульпы и бумаги, для получения бражки, для продукции этанола и переработки крахмала, как описано выше.

4.1 Детергентные композиции для стирки и применение

Согласно одному варианту осуществления одна или несколько варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаз штамма TS-23 Bacillus sp. или ее вариантов, как правило, могут быть компонентами детергентной композиции для стирки. По существу, они могут быть включены в детергентную композицию в форме непылящего гранулята, стабилизированной жидкости или защищенного фермента. Сухие составы могут находиться в форме гранулята или микрогранулята. Непылящие грануляты можно получать, например, как описано в патентах США № 4106991 и 4661452, и необязательно они могут быть покрыты способами, известными в данной области. Примерами восковидных материалов для покрытия являются продукты поли(оксида этилена) (полиэтиленгликоль, PEG) со средними молярными массами от 1000 до 20000; этоксилированные нонилфенолы, имеющие от 16 до 50 элементов оксида этилена; этоксилированные жирные спирты, в которых спирт содержит от 12 до 20 атомов углерода и в которых имеется от 15 до 80 элементов оксида этилена; жирные спирты; жирные кислоты; моно-, ди- и триглицериды жирных кислот. Примеры пленкообразующих материалов для покрытия, пригодных для нанесения способами в псевдоожиженном слое, приведены, например, в патенте Великобритании № 1483591. Жидкие препараты ферментов могут быть стабилизированы, например, добавлением полиола, такого как пропиленгликоль, сахара или спирта сахара, молочной кислоты или борной кислоты в соответствии с общепринятыми способами. Другие стабилизаторы ферментов хорошо известны в данной области. Защищенные ферменты можно получать способом, описанным, например, в заявке EP № 238216. Полиолы давно были признаны в качестве стабилизаторов белков, а также они повышают растворимость белков. См., например, J.K. Kaushik et al., "Why is trehalose an exceptional protein stabilizer? An analysis of the thermal stability of proteins in presence of the compatible osmolyte trehalose", J. Biol. Chem. 278: 26458-65 (2003) и ссылки, приведенные в ней; и Monica Conti et al., "Capillary isoelectric focusing: the problem of protein solubility", J. Chromatography 757: 237-245 (1997).

Композиция может содержать варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу штамма TS-23 Bacillus sp. или ее варианты в качестве основного ферментативного компонента, например она может представлять собой однокомпонентную композицию. Альтернативно композиция может обладать несколькими ферментативными активными веществами, такими как аминопептидаза, амилаза, карбогидраза, карбоксипептидаза, каталаза, целлюлаза, хитиназа, кутиназа, циклодекстрин гликозилтрансфераза, дезоксирибонуклеаза, эстераза, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -галактозидаза, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -галактозидаза, глюкоамилаза, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -глюкозидаза, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -глюкозидаза, галопероксидаза, инвертаза, лакказа, липаза, маннозидаза, оксидаза, пектинолитический фермент, пептидоглутаминаза, пероксидаза, фитаза, полифенолоксидаза, протеолитический фермент, рибонуклеаза, трансглутаминаза или ксиланаза, а также другие ферменты, рассмотренные ниже. Дополнительный(ые) фермент(ы) можно получать с помощью микроорганизмов, относящихся к родам Aspergillus, Trichoderma, Humicola (например, H. insolens) и Fusarium. Иллюстративные члены рода Aspergillus включают Aspergillus aculeatus, Aspergillus awamori, Aspergillus niger или Aspergillus oryzae. Иллюстративные члены рода Fusarium включают Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusariumheterosporum, Fusarium negundinis, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides и Fusarium venenatum.

Детергентная композиция может быть в любой пригодной форме, например в форме порошков, гранул, паст или жидкостей. Жидкий детергент может быть водным, как правило, он содержит вплоть до приблизительно 70% воды и от 0% до приблизительно 30% органического растворителя. Также он может быть в форме компактного геля, содержащего только приблизительно 30% воды. Ферменты можно использовать в любой детергентной композиции, совместимой со стабильностью фермента. Ферменты обычно можно защищать от вредных компонентов известными формами инкапсулирования, например посредством грануляции или заключения в гидрогели. Ферменты и, конкретно, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы не ограничиваются применением для стирки и мытья посуды, их также можно использовать в средствах для чистки поверхностей, при получении этанола из крахмала или биомассы.

Детергентная композиция содержит одно или несколько поверхностно-активных веществ, каждое из которых может быть анионным, неионным, катионным или цвиттерионным. Детергент, как правило, будет содержать от 0% до приблизительно 50% анионного поверхностно-активного вещества, такого как линейный алкилбензолсульфонат (LAS); варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -олефинсульфонат (AOS); алкилсульфат (сульфат жирного спирта) (AS); этоксисульфат спирта (AEOS или AES); вторичные алкансульфонаты (SAS); метиловые сложные эфиры жирных варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -сульфокислот; алкил- или алкенилянтарная кислота или мыло. Также композиция может содержать от 0% до приблизительно 40% неионного поверхностно-активного вещества, такого как этоксилат спирта (AEO или AE), карбоксилированные этоксилаты спиртов, этоксилат нонилфенола, алкилполигликозид, алкилдиметиламиноксид, моноэтаноламид этоксилированной жирной кислоты, моноэтаноламид жирной кислоты или амид жирной полигидроксиалкилкислоты (как описано, например, в WO 92/06154).

Кроме того, детергентная композиция может содержать один или несколько других ферментов, таких как липаза, кутиназа, протеаза, целлюлаза, пероксидаза и/или лакказа в любом сочетании. См. выше.

Детергент необязательно может содержать от приблизительно 1% до приблизительно 65% моющего детергентного компонента или комплексообразующего средства, такого как цеолит, дифосфат, трифосфат, фосфонат, цитрат, нитрилотриуксусная кислота (NTA), этилендиаминтетрауксусная кислота (EDTA), диэтилентриаминпентауксусная кислота (DTMPA), алкил- или алкенилянтарная кислота, растворимые силикаты или многослойные силикаты (например, SKS-6 от Hoechst). Также детергент может не содержать наполнителя, т.е. он может по существу не содержать основного компонента детергента.

Детергент необязательно может содержать один или несколько полимеров. Их примеры включают карбоксиметилцеллюлозу (CMC), поли(винилпирролидон) (PVP), полиэтиленгликоль (PEG), поли(виниловый спирт) (PVA), поликарбоксилаты, такие как полиакрилаты, сополимеры малеиновая/акриловая кислота и сополимеры лаурилметакрилат/акриловая кислота.

Детергент необязательно может содержать отбеливающую систему, которая может содержать источник H 2O2, такой как перборат или перкарбонат, который может быть комбинирован с образующим перкислоту активатором отбеливания, таким как тетраацетилэтилендиамин (TAED) или нонаноилоксибензолсульфонат (NOBS). Альтернативно отбеливающая система может содержать пероксикислоты, например, амидного, имидного или сульфонового типа. Также отбеливающая система может представлять собой ферментативную отбеливающую систему, где пергидролаза активирует пероксид, как описано, например, в WO 2005/056783.

Ферменты детергентной композиции можно стабилизировать с использованием общепринятых стабилизаторов, например полиолов, таких как пропиленгликоль или глицерин; сахара или спирта сахара; молочной кислоты; борной кислоты или производного борной кислоты, например, такого как ароматический боратный сложный эфир; и композиция может быть изготовлена, как описано, например, в WO 92/19709 и WO 92/19708.

Также детергент может содержать другие общепринятые ингредиенты детергентов, например, такие как кондиционеры для тканей, включая глины, пенообразователи, пеногасители, средства против коррозии, суспендирующие грязь вещества, средства против повторного отложения грязи, красители, бактерицидные средства, оптические отбеливатели или отдушку.

Значение pH (измеренное в водном растворе при используемой концентрации), как правило, является нейтральным или щелочным, например pH составляет от приблизительно 7,0 до приблизительно 11,0.

Конкретные формы детергентных композиций, содержащих варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу штамма TS-23 Bacillus sp. или ее вариант, можно изготавливать так, чтобы они включали:

1) Детергентную композицию, изготовленную в виде гранулята, имеющего объемную плотность по меньшей мере 600 г/л, содержащего линейный алкилбензолсульфонат (из расчета по кислоте) от приблизительно 7% до приблизительно 12%; этоксисульфат спирта (например, C 12-C18спирт, 1-2 оксид этилена (EO)) или алкилсульфат (например, C16-C18) от приблизительно 1% до приблизительно 4%; этоксилат спирта (например, C14-15 спирт, 7 EO) от приблизительно 5% до приблизительно 9%; карбонат натрия (например, Na2CO3) от приблизительно 14% до приблизительно 20%; растворимый силикат (например, Na 2O, 2SiO2) от приблизительно 2 до приблизительно 6%; цеолит (например, NaAlSiO4) от приблизительно 15% до приблизительно 22%; сульфат натрия (например, Na2 SO4) от 0% до приблизительно 6%; смесь цитрат натрия/лимонная кислота (например, C6H5Na3O 7/C6H8O7) от приблизительно 0% до приблизительно 15%; перборат натрия (например, NaBO 3H2O) от приблизительно 11% до приблизительно 18%; TAED от приблизительно 2% до приблизительно 6%; карбоксиметилцеллюлозу (CMC) от 0% до приблизительно 2%; полимеры (например, сополимер малеиновая/акриловая кислота, PVP, PEG) 0-3%; ферменты (из расчета на чистый фермент) 0,0001-0,1% белка; и второстепенные ингредиенты (например, пеногасители, отдушка, оптический отбеливатель, фотоотбеливатель) 0-5%.

2) Детергентную композицию, изготовленную в виде гранулята, имеющего объемную плотность по меньшей мере 600 г/л, содержащего линейный алкилбензолсульфонат (из расчета на кислоту) от приблизительно 6% до приблизительно 11%; этоксисульфат спирта (например, C12-18спирт, 1-2 EO) или алкилсульфат (например, C16-18) от приблизительно 1% до приблизительно 3%; этоксилат спирта (например, C14-15спирт, 7 EO) от приблизительно 5% до приблизительно 9%; карбонат натрия (например, Na2CO3) от приблизительно 15% до приблизительно 21%; растворимый силикат (например, Na2O, 2SiO 2) от приблизительно 1% до приблизительно 4%; цеолит (например, NaAlSiO4) от приблизительно 24% до приблизительно 34%; сульфат натрия (например, Na2SO4) от приблизительно 4% до приблизительно 10%; смесь цитрат натрия/лимонная кислота (например, C6H5Na3O 7/C6H8O7) от 0% до приблизительно 15%; карбоксиметилцеллюлозу (CMC) от 0% до приблизительно 2%; полимер (например, сополимер малеиновая/акриловая кислота, PVP, PEG) 1-6%; ферменты (из расчета на чистый белок фермента) 0,0001-0,1%; второстепенные ингредиенты (например, пеногасители, отдушка) 0-5%.

3) Детергентную композицию, изготовленную в виде гранулята, имеющего объемную плотность по меньшей мере 600 г/л, содержащего линейный алкилбензолсульфонат (из расчета на кислоту) от приблизительно 5% до приблизительно 9%; этоксилат спирта (например, C12-15спирт, 7 EO) от приблизительно 7% до приблизительно 14%; мыло в виде жирной кислоты (например, C16-22 жирная кислота) от приблизительно 1 до приблизительно 3%; карбонат натрия (в виде Na2CO3) от приблизительно 10% до приблизительно 17%; растворимый силикат (например, Na2O, 2SiO2) от приблизительно 3% до приблизительно 9%; цеолит (в виде NaAlSiO4) от приблизительно 23% до приблизительно 33%; сульфат натрия (например, Na2SO4) от 0% до приблизительно 4%; перборат натрия (например, NaBO3H2O) от приблизительно 8% до приблизительно 16%; TAED от приблизительно 2% до приблизительно 8%; фосфонат (например, EDTMPA) от 0% до приблизительно 1%; карбоксиметилцеллюлозу (CMC) от 0% до приблизительно 2%; полимеры (например, сополимер малеиновая/акриловая кислота, PVP, PEG) 0-3%; ферменты (из расчета на чистый белок фермента) 0,0001-0,1%; вспомогательные ингредиенты (например, пеногасители, отдушка, оптический отбеливатель) 0-5%.

4) Детергентную композицию, изготовленную в виде гранулята, имеющего объемную плотность по меньшей мере 600 г/л, содержащего линейный алкилбензолсульфонат (из расчета на кислоту) от приблизительно 8% до приблизительно 12%; этоксилат спирта (например, C12-C15спирт, 7 EO) от приблизительно 10% до приблизительно 25%; карбонат натрия (в виде Na2 CO3) от приблизительно 14% до приблизительно 22%; растворимый силикат (например, Na2O, 2SiO2 ) от приблизительно 1% до приблизительно 5%; цеолит (например, NaAlSiO4) от приблизительно 25% до приблизительно 35%; сульфат натрия (например, Na2SO4) от 0% до приблизительно 10%; карбоксиметилцеллюлозу (CMC) от 0% до приблизительно 2%; полимеры (например, сополимер малеиновая/акриловая кислота, PVP, PEG) 1-3%; ферменты (из расчета на чистый белок фермента) 0,0001-0,1%; и вспомогательные ингредиенты (например, пеногасители, отдушка) 0-5%.

5) Водную жидкую детергентную композицию, содержащую линейный алкилбензолсульфонат (из расчета на кислоту) от приблизительно 15% до приблизительно 21%; этоксилат спирта (например, C12-15спирт, 7 EO или C12-15спирт, 5 EO) от приблизительно 12% до приблизительно 18%; мыло в качестве жирной кислоты (например, олеиновой кислоты) от приблизительно 3% до приблизительно 13%; алкенилянтарную кислоту (C12-14) от 0% до приблизительно 13%; аминоэтанол от приблизительно 8% до приблизительно 18%; лимонную кислоту от приблизительно 2% до приблизительно 8%; фосфонат от 0% до приблизительно 3%; полимеры (например, PVP, PEG) от 0% до приблизительно 3%; борат (например, B4O7) от 0% до приблизительно 2%; этанол от 0% до приблизительно 3%; пропиленгликоль от приблизительно 8% до приблизительно 14%; ферменты (из расчета на чистый белок фермента) 0,0001-0,1%; и вспомогательные ингредиенты (например, диспергирующие вещества, пеногасители, отдушка, оптический осветлитель) 0-5%.

6) Водную структурированную жидкую детергентную композицию, содержащую линейный алкилбензолсульфонат (из расчета на кислоту) от приблизительно 15% до приблизительно 21%; этоксилат спирта (например, C12-15спирт, 7 EO, или C12-15 спирт, 5 EO) 3-9%; мыло в качестве жирной кислоты (например, олеиновой кислоты) от приблизительно 3% до приблизительно 10%; цеолит (такой, как NaAlSiO4) от приблизительно 14% до приблизительно 22%; цитрат калия от приблизительно 9% до приблизительно 18%; борат (например, B4O7) от 0% до приблизительно 2%; карбоксиметилцеллюлозу (CMC) от 0% до приблизительно 2%; полимеры (например, PEG, PVP) от 0% до приблизительно 3%; прививаемые к поверхности полимеры, например, такие как сополимер лаурилметакрилат/акриловая кислота (молярное соотношение 25:1, ММ 3800), от 0% до приблизительно 3%; глицерин от 0% до приблизительно 5%; ферменты (из расчета на чистый белок фермента) 0,0001-0,1%; и вспомогательные ингредиенты (например, диспергирующие вещества, пеногасители, отдушка, оптические отбеливатели) 0-5%.

7) Детергентную композицию, изготовленную в виде гранулята, имеющего объемную плотность по меньшей мере 600 г/л, содержащую сульфат жирного спирта от приблизительно 5% до приблизительно 10%; этоксилированный моноэтаноламид жирной кислоты от приблизительно 3% до приблизительно 9%; мыло в качестве жирной кислоты 0-3%; карбонат натрия (например, Na2 CO3) от приблизительно 5% до приблизительно 10%; растворимый силикат (например, Na2O, 2SiO2) от приблизительно 1% до приблизительно 4%; цеолит (например, NaAlSiO4 ) от приблизительно 20% до приблизительно 40%; сульфат натрия (например, Na2SO4) от приблизительно 2% до приблизительно 8%; перборат натрия (например, NaBO3 H2O) от приблизительно 12% до приблизительно 18%; TAED от приблизительно 2% до приблизительно 7%; полимеры (например, сополимер малеиновая/акриловая кислота, PEG) от приблизительно 1% до приблизительно 5%; ферменты (из расчета на чистый белок фермента) 0,0001-0,1%; и вспомогательные ингредиенты (например, оптический отбеливатель, пеногасители, отдушка) 0-5%.

8) Детергентную композицию, изготовленную в виде гранулята, содержащего линейный алкилбензолсульфонат (из расчета на кислоту) от приблизительно 8% до приблизительно 14%; этоксилированный моноэтаноламид жирной кислоты от приблизительно 5% до приблизительно 11%; мыло в качестве жирной кислоты от 0% до приблизительно 3%; карбонат натрия (например, Na2CO3) от приблизительно 4% до приблизительно 10%; растворимый силикат (Na2O, 2SiO2) от приблизительно 1% до приблизительно 4%; цеолит (например, NaAlSiO4) от приблизительно 30% до приблизительно 50%; сульфат натрия (например, Na2SO4) от приблизительно 3% до приблизительно 11%; цитрат натрия (например, C6H5Na3O7) от приблизительно 5% до приблизительно 12%; полимеры (например, PVP, сополимер малеиновая/акриловая кислота, PEG) от приблизительно 1% до приблизительно 5%; ферменты (из расчета на чистый белок фермента) 0,0001-0,1%; и вспомогательные ингредиенты (например, пеногасители, отдушка) 0-5%.

9) Детергентную композицию, изготовленную в виде гранулята, содержащего линейный алкилбензолсульфонат (из расчета на кислоту) от приблизительно 6% до приблизительно 12%; неионное поверхностно-активное вещество от приблизительно 1% до приблизительно 4%; мыло в качестве жирной кислоты от приблизительно 2% до приблизительно 6%; карбонат натрия (например, Na2 CO3) от приблизительно 14% до приблизительно 22%; цеолит (например, NaAlSiO4) от приблизительно 18% до приблизительно 32%; сульфат натрия (например, Na2 SO4) от приблизительно 5% до приблизительно 20%; цитрат натрия (например, C6H5Na3O 7) от приблизительно 3% до приблизительно 8%; перборат натрия (например, NaBO3H2O) от приблизительно 4% до приблизительно 9%; активатор отбелки (например, NOBS или TAED) от приблизительно 1% до приблизительно 5%; карбоксиметилцеллюлозу (CMC) от 0% до приблизительно 2%; полимеры (например, поликарбоксилат или PEG) от приблизительно 1% до приблизительно 5%; ферменты (из расчета на чистый белок фермента) 0,0001-0,1%; и вспомогательные ингредиенты (например, оптический отбеливатель, отдушку) 0-5%.

10) Водную жидкую детергентную композицию, содержащую линейный алкилбензолсульфонат (из расчета на кислоту) от приблизительно 15% до приблизительно 23%; этоксисульфат спирта (например, C 12-15спирт, 2-3 EO) от приблизительно 8% до приблизительно 15%; этоксилат спирта (например, C12-15спирт, 7 EO, или C12-15спирт, 5 EO) от приблизительно 3% до приблизительно 9%; мыло в качестве жирной кислоты (например, лауриновая кислота) от 0% до приблизительно 3%; аминоэтанол от приблизительно 1% до приблизительно 5%; цитрат натрия от приблизительно 5% до приблизительно 10%; гидротропное вещество (например, толуолсульфонат натрия) от приблизительно 2% до приблизительно 6%; борат (например, B 4O7) от 0% до приблизительно 2%; карбоксиметилцеллюлозу от 0% до приблизительно 1%; этанол от приблизительно 1% до приблизительно 3%; пропиленгликоль от приблизительно 2% до приблизительно 5%; ферменты (из расчета на чистый белок фермента) 0,0001-0,1%; и вспомогательные ингредиенты (например, полимеры, диспергирующие вещества, отдушку, оптические отбеливатели) 0-5%.

11) Водную жидкую детергентную композицию, содержащую линейный алкилбензолсульфонат (из расчета на кислоту) от приблизительно 20% до приблизительно 32%; этоксилат спирта (например, C 12-15спирт, 7 EO или C12-15спирт, 5 EO) 6-12%; аминоэтанол от приблизительно 2% до приблизительно 6%; лимонную кислоту от приблизительно 8% до приблизительно 14%; борат (например, B4O7) от приблизительно 1% до приблизительно 3%; полимер (например, сополимер малеиновая/акриловая кислота, прививаемый к поверхности полимер, например, такой как сополимер лаурилметакрилат/акриловая кислота) от 0% до приблизительно 3%; глицерин от приблизительно 3% до приблизительно 8%; ферменты (из расчета на чистый белок фермента) 0,0001-0,1%; и вспомогательные ингредиенты (например, гидротропные вещества, диспергирующие вещества, отдушка, оптические отбеливатели) 0-5%.

12) Детергентную композицию, изготовленную в виде гранулята, имеющего объемную плотность по меньшей мере 600 г/л, содержащего анионное поверхностно-активное вещество (линейный алкилбензолсульфонат, алкилсульфат, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -олефинсульфонат, метиловые эфиры жирных варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -сульфокислот, алкансульфонаты, мыло) от приблизительно 25% до приблизительно 40%; неионное поверхностно-активное вещество (например, этоксилат спирта) от приблизительно 1% до приблизительно 10%; карбонат натрия (например, Na2CO3) от приблизительно 8% до приблизительно 25%; растворимые силикаты (например, Na2O, 2SiO2) от приблизительно 5% до приблизительно 15%; сульфат натрия (например, Na2 SO4) от 0% до приблизительно 5%; цеолит (NaAlSiO 4) от приблизительно 15% до приблизительно 28%; перборат натрия (например, NaBO3·4H2O) от 0% до приблизительно 20%; активатор отбелки (TAED или NOBS) от приблизительно 0% до приблизительно 5%; ферменты (из расчета на чистый белок фермента) 0,0001-0,1%; вспомогательные ингредиенты (например, отдушка, оптические отбеливатели) 0-3%.

13) Детергентные композиции, как описано для композиций 1)-12) выше, где весь линейный алкилбензолсульфонат или его часть заменен (C12 -C18)алкилсульфатом.

14) Детергентную композицию, изготовленную в виде гранулята, имеющего объемную плотность по меньшей мере 600 г/л, содержащего (C12 -C18)алкилсульфат от приблизительно 9% до приблизительно 15%; этоксилат спирта от приблизительно 3% до приблизительно 6%; амид полигидроксиалкиловой жирной кислоты от приблизительно 1% до приблизительно 5%; цеолит (например, NaAlSiO4 ) от приблизительно 10% до приблизительно 20%; слоистый дисиликат (например, SK56 от Hoechst) от приблизительно 10% до приблизительно 20%; карбонат натрия (например, Na2CO3) от приблизительно 3% до приблизительно 12%; растворимый силикат (например, Na2O, 2SiO2) от 0% до приблизительно 6%; цитрат натрия от приблизительно 4% до приблизительно 8%; перкарбонат натрия от приблизительно 13% до приблизительно 22%; TAED от приблизительно 3% до приблизительно 8%; полимеры (например, поликарбоксилаты и PVP) от 0% до приблизительно 5%; ферменты (из расчета на чистый белок фермента) 0,0001-0,1%; и вспомогательные ингредиенты (например, оптический отбеливатель, фотоотбеливатель, отдушка, пеногасители) 0-5%.

15) Детергентную композицию, изготовленную в виде гранулята, имеющего объемную плотность по меньшей мере 600 г/л, содержащего (C12 -C18)алкилсульфат от приблизительно 4% до приблизительно 8%; этоксилат спирта от приблизительно 11% до приблизительно 15%; мыло от приблизительно 1% до приблизительно 4%; цеолит MAP или цеолит A от приблизительно 35% до приблизительно 45%; карбонат натрия (в качестве Na2CO3) от приблизительно 2% до приблизительно 8%; растворимый силикат (например, Na 2O, 2SiO2) от 0% до приблизительно 4%; перкарбонат натрия от приблизительно 13% до приблизительно 22%; TAED 1-8%; карбоксиметилцеллюлозу (CMC) от 0% до приблизительно 3%; полимеры (например, поликарбоксилаты и PVP) от 0% до приблизительно 3%; ферменты (из расчета на чистый белок фермента) 0,0001-0,1%; и вспомогательные ингредиенты (например, оптический отбеливатель, фосфонат, отдушка) 0-3%.

16) Детергентные составы, как описано в 1)-15) выше, которые содержат стабилизированную или инкапсулированную перкислоту либо в качестве дополнительного компонента, либо в качестве замены для уже указанных систем для отбеливания.

17) Детергентные композиции, как описано выше в 1), 3), 7), 9) и 12), где перборат заменен перкарбонатом.

18) Детергентные композиции, как описано выше в 1), 3), 7), 9), 12), 14) и 15), которые дополнительно содержат марганцевый катализатор. Марганцевый катализатор, например, представляет собой одно из соединений, описанных в "Efficient manganese catalysts for low-temperature bleaching", Nature 369: 637-639 (1994).

19) Детергентную композицию, изготовленную в виде неводной детергентной жидкости, содержащей жидкое неионное поверхностно-активное вещество, например, такое как линейный алкоксилированный первичный спирт, систему наполнителя (например, фосфат), фермент(ы) и щелочи. Также детергент может содержать анионное поверхностно-активное вещество и/или систему для отбеливания.

варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -Амилазу штамма TS-23 Bacillus sp. или ее вариант можно включать в концентрациях, обычно используемых в детергентах. В настоящее время считается, что в детергентную композицию можно добавлять варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу штамма TS-23 Bacillus sp. или ее вариант в количестве, соответствующем 0,00001-1,0 мг (вычисленном в расчете на чистый белок фермента) фермента на литр моющего раствора.

В другом варианте осуществления в детергентные композиции можно включать 2,6-варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -D-фруктангидролазу и использовать для удаления биопленки/очистки от биопленки, присутствующей на бытовом и/или промышленном текстиле/белье для стирки.

Детергентную композицию, например, можно изготавливать в качестве детергентной композиции для ручной или машинной стирки, включая композицию добавки для стирки, пригодную для предварительной обработки испачканной ткани, и добавляемую при полоскании композицию для смягчения ткани, или ее можно изготавливать в качестве детергентной композиции для применения в основных действиях, направленных на очистку бытовых твердых поверхностей, или ее можно изготавливать для действий, связанных с ручной или машинной стиркой.

В конкретном аспекте детергентная композиция может дополнительно содержать 2,6-варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -D-фруктангидролазу, одну или несколько варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаз в дополнение к варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазе штамма TS-23 Bacillus sp. или ее варианту и один или несколько других ферментов для очистки, таких как протеаза, липаза, кутиназа, карбогидраза, целлюлаза, пектиназа, маннаназа, арабиназа, галактаназа, ксиланаза, оксидаза, лакказа и/или пероксидаза и/или их сочетания.

Как правило, свойства выбранного(ых) фермента(ов) должны быть совместимы с выбранным детергентом (например, оптимум pH, совместимость с другими ферментативными и неферментативными ингредиентами и т.д.), и фермент(ы) должен(ны) присутствовать в эффективных количествах.

4.2 Детергентные композиции для мытья посуды

варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -Амилазы по настоящему изобретению также можно использовать в детергентных композициях для мытья посуды, включая следующие:

1) ПОРОШКОВАЯ КОМПОЗИЦИЯ ДЛЯ АВТОМАТИЧЕСКОГО МЫТЬЯ ПОСУДЫ

Неионное поверхностно-активное вещество 0,4-2,5%
Метасиликат натрия0-20%
Дисиликат натрия 3-20%
Трифосфат натрия 20-40%
Карбонат натрия 0-20%
Перборат натрия 2-9%
Тетраацетилэтилендиамин (TAED)1-4%
Сульфат натрия5-33%
Ферменты0,0001-0,1%

2) ПОРОШКОВАЯ КОМПОЗИЦИЯ ДЛЯ АВТОМАТИЧЕСКОГО МЫТЬЯ ПОСУДЫ

Неионное поверхностно-активное вещество (например, этоксилат спирта)1-2%
Дисиликат натрия 2-30%
Карбонат натрия 10-50%
Фосфонат натрия 0-5%
Трицитрата натрия дигидрат 9-30%
Ацетат нитрилотринатрия (NTA)0-20%
Пербората натрия моногидрат 5-10%
Тетраацетилэтилендиамин (TAED)1-2%
Полиакрилатный полимер (например, сополимер малеиновая кислота/акриловая кислота)6-25%
Ферменты0,0001-0,1%
Отдушка0,1-0,5%
Вода5-10%

3) ПОРОШКОВАЯ КОМПОЗИЦИЯ ДЛЯ АВТОМАТИЧЕСКОГО МЫТЬЯ ПОСУДЫ

Неионное поверхностно-активное вещество 0,5-2,0%
Дисиликат натрия25-40%
Цитрат натрия30-55%
Карбонат натрия 0-29%
Бикарбонат натрия 0-20%
Пербората натрия моногидрат0-15%
Тетраацетилэтилендиамин (TAED) 0-6%
Сополимер малеиновая кислота/акриловая кислота0-5%
Глина1-3%
Полиаминокислоты0-20%
Полиакрилат натрия0-8%
Ферменты0,0001-0,1%

4) ПОРОШКОВАЯ КОМПОЗИЦИЯ ДЛЯ АВТОМАТИЧЕСКОГО МЫТЬЯ ПОСУДЫ

Неионное поверхностно-активное вещество 1-2%
Цеолит MAP15-42%
Дисиликат натрия30-34%
Цитрат натрия0-12%
Карбонат натрия 0-20%
Пербората натрия моногидрат 7-15%
Тетраацетилэтилендиамин (TAED)0-3%
Полимер0-4%
Сополимер малеиновая кислота/акриловая кислота 0-5%
Органический фосфонат 0-4%
Глина 1-2%
Ферменты 0,0001-0,1%
Сульфат натрияостальная часть

5) ПОРОШКОВАЯ КОМПОЗИЦИЯ ДЛЯ АВТОМАТИЧЕСКОГО МЫТЬЯ ПОСУДЫ

Неионное поверхностно-активное вещество 1-7%
Дисиликат натрия18-30%
Цитрат тринатрия10-24%
Карбонат натрия12-20%
моноперсульфат (2 KHSO5 ·KHSO4·K2SO4) 15-21%
Стабилизатор отбеливателя0,1-2%
Сополимер малеиновая кислота/акриловая кислота 0-6%
Пентаацетат диэтилентриамина, пентанатриевая соль0-2,5%
Ферменты0,0001-0,1%
Сульфат натрия, вода остальная часть

6) ПОРОШКОВАЯ И ЖИДКАЯ КОМПОЗИЦИЯ ДЛЯ МЫТЬЯ ПОСУДЫ С МОЮЩЕЙ СИСТЕМОЙ ПОВЕРХНОСТНО-АКТИВНЫХ ВЕЩЕСТВ

Неионное поверхностно-активное вещество 0-1,5%
Октадецилдиметиламина N-оксида дигидрат0-5%
80:20 масс. смесь C18/C16 октадецилдиметиламина N-оксида дигидрата и гексадецилдиметиламина N-оксида дигидрата 0-4%
70:30 масс. смесь C18/C16 безводного октадецилбис(гидроксиэтил)амина N-оксида и безводного гексадецилбис(гидроксиэтил)амина N-оксида 0-5%
C13-C15 алкилэтоксисульфат со средней степенью этоксилирования 3 0-10%
C 12-C15алкилэтоксисульфат со средней степенью этоксилирования 30-5%
C13-C15этоксилированный спирт со средней степенью этоксилирования 120-5%
Смесь C12-C15 этоксилированных спиртов со средней степенью этоксилирования 90-6,5%
Смесь C13-C15этоксилированных спиртов со средней степенью этоксилирования 300-4%
Дисиликат натрия 0-33%
Триполифосфат натрия 0-46%
Цитрат натрия0-28%
Лимонная кислота0-29%
Карбонат натрия0-20%
Пербората натрия моногидрат0-11,5%
Тетраацетилэтилендиамин (TAED) 0-4%
Сополимер малеиновая кислота/акриловая кислота 0-7,5%
Сульфат натрия 0-12,5%
Ферменты 0,0001-0,1%

7) НЕВОДНАЯ ЖИДКАЯ КОМПОЗИЦИЯ ДЛЯ АВТОМАТИЧЕСКОГО МЫТЬЯ ПОСУДЫ

Жидкое неионное поверхностно-активное вещество (например, этоксилат спирта) 2,0-10,0%
Силикат щелочного металла3,0-15,0%
Фосфат щелочного металла20,0-40,0%
Жидкий носитель, выбранный из высших гликолей, полигликолей, полиоксидов, простых эфиров гликолей 25,0-45,0%
Стабилизатор (например, неполный эфир фосфорной кислоты и C 16-C18алканол)0,5-7,0%
Пеногаситель (например, силикон) 0-1,5%
Ферменты 0,0001-0,1%

8) НЕВОДНАЯ ЖИДКАЯ КОМПОЗИЦИЯ ДЛЯ МЫТЬЯ ПОСУДЫ

Жидкое неионное поверхностно-активное вещество (например, этоксилаты спирта)2,0-10,0%
Силикат натрия 3,0-15,0%
Карбонат щелочного металла7,0-20,0%
Цитрат натрия0,0-1,5%
Стабилизирующая система (например, смесь тонкоизмельченного силикона и низкомолекулярных простых эфиров диалкилполигликоля) 0,5-7,0%
Низкомолекулярный полиакрилатный полимер5,0-15,0%
Гелеобразный загуститель на основе глины (например, бентонит) 0,0-10,0%
Полимер гидроксипропилцеллюлозы0,0-0,6%
Ферменты 0,0001-0,1%
Жидкий носитель, выбранный из высших гликолей, полигликолей, полиоксидов и простых эфиров гликолейостальная часть

9) ТИКСОТРОПНАЯ ЖИДКАЯ КОМПОЗИЦИЯ ДЛЯ АВТОМАТИЧЕСКОГО МЫТЬЯ ПОСУДЫ

C12-C14жирная кислота 0-0,5%
Блок-сополимерное поверхностно-активное вещество1,5-15,0%
Цитрат натрия 0-12%
Триполифосфат натрия 0-15%
Карбонат натрия0-8%
Тристеарат алюминия0-0,1%
Куменсульфонат натрия 0-1,7%
Полиакрилатный загуститель 1,32-2,5%
Полиакрилат натрия2,4-6,0%
Борная кислота 0-4,0%
Формиат натрия 0-0,45%
Формиат кальция 0-0,2%
Натрия н-децидифенилоксида дисульфонат0-4,0%
Моноэтаноламин (MEA) 0-1,86%
Гидроксид натрия (50%) 1,9-9,3%
1,2-пропандиол0-9,4%
Ферменты0,0001-0,1%
Пеногаситель, пигмент, отдушки, вода остальная часть

10) ЖИДКАЯ КОМПОЗИЦИЯ ДЛЯ АВТОМАТИЧЕСКОГО МЫТЬЯ ПОСУДЫ

Этоксилат спирта 0-20%
Сульфонат сложного эфира жирной кислоты0-30%
Додецилсульфат натрия0-20%
Алкилполигликозид 0-21%
Олеиновая кислота 0-10%
Дисиликата натрия моногидрат18-33%
Цитрата натрия дигидрат 18-33%
Натрия стеарат 0-2,5%
Пербората натрия моногидрат 0-13%
Тетраацетилэтилендиамин (TAED)0-8%
Сополимер малеиновая кислота/акриловая кислота 4-8%
Ферменты 0,0001-0,1%

11) ЖИДКАЯ КОМПОЗИЦИЯ ДЛЯ АВТОМАТИЧЕСКОГО МЫТЬЯ ПОСУДЫ, СОДЕРЖАЩАЯ ЗАЩИЩЕННЫЕ ЧАСТИЦЫ ОТБЕЛИВАТЕЛЯ

Силикат натрия 5-10%
Пирофосфат тетракалия 15-25%
Фосфат тринатрия0-2%
Карбонат калия4-8%
Защищенные частицы отбеливателя, например хлора 5-10%
Полимерный загуститель 0,7-1,5%
Гидроксид калия0-2%
Ферменты0,0001-0,1%
Водаостальная часть

11) Композиции для автоматического мытья посуды, как описано в 1), 2) 3), 4), 6) и 10), где перборат заменен перкарбонатом.

12) Композиции для автоматического мытья посуды, как описано в 1)-6), которые дополнительно содержат марганцевый катализатор. Марганцевый катализатор, например, может представлять собой одно из соединений, описанных в "Efficient manganese catalysts for low-temperature bleaching", Nature 369, 1994, 637-639.

4.3 Композиции для удаления биопленки и применение

Композиция может содержать варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу штамма TS-23 Bacillus sp. или ее вариант в качестве основного ферментативного компонента, например, в случае однокомпонентной композиции для применения в целях удаления биопленок. Альтернативно для удаления биопленок композиция может содержать множество ферментативных активных веществ, таких как несколько амилаз, или коктейль из ферментов, включающий любое сочетание из следующих ферментов: аминопептидаза, амилаза (варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -, или варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -, или глюко-амилаза), карбогидраза, карбоксипептидаза, каталаза, целлюлаза, хитиназа, кутиназа, циклодекстрин гликозилтрансфераза, дезоксирибонуклеаза, эстераза, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -галактозидаза, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -галактозидаза, глюкоамилаза, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -глюкозидаза, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -глюкозидаза, галопероксидаза, инвертаза, лакказа, липаза, маннозидаза, оксидаза, пектинолитический фермент, пептидоглутаминаза, пероксидаза, фитаза, полифенолоксидаза, протеолитический фермент, рибонуклеаза, трансглутаминаза и/или ксиланаза или любое их сочетание. Дополнительный фермент(ы) может быть получен с помощью микроорганизма, относящегося к родам Aspergillus, Trichoderma, Humicola (например, H. insolens) и Fusarium. Иллюстративные члены рода Aspergillus включают Aspergillus aculeatus , A. awamori, A. niger и A. oryzae. Иллюстративные члены рода Fusarium включают F. bactridioides, F. cerealis, F. crookwellense, F. culmorum, F.graminearum, F. graminum, F. heterosporum, F. negundinis, F. oxysporum, F. reticulatum, F. roseum, F. sambucinum, F. sarcochroum, F. sulphureum, F. torulosum, F. trichothecioides и F. venenatum.

Содержащие варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу штамма TS-23 Bacillus sp. или ее вариант композиции можно получать в соответствии со способами, известными в данной области, и она может быть предоставлена в форме жидкой или сухой композиции. Например, содержащая варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу штамма TS-23 Bacillus sp. или ее вариант композиция может быть представлена в форме гранулята или микрогранулята. Полипептид, подлежащий включению в композицию, можно стабилизировать в соответствии со способами, известными в данной области.

Ниже приведены примеры иллюстративных применений полипептидных композиций. Дозировку содержащей варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу штамма TS-23 Bacillus sp. или ее вариант композиции и другие условия, при которых используют композицию, можно определить с использованием способов, известных в данной области.

Кроме того, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы штамма TS-23 Bacillus sp. или их варианты предусмотрены для применения в композиции вместе с 2,6-варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -D-фруктангидролазой или ее вариантом.

Другой аспект предусматривает композиции и способы дезинтеграции и/или удаления биопленок. Термин "дезинтеграция", как используют в настоящем документе, следует понимать как гидролиз полисахаридов в матриксе биопленки, объединяющем и связывающем вместе отдельные микробные клетки биопленки, посредством чего микробные клетки могут высвобождаться и удаляться с биопленки. Биопленка, как правило, присутствует на поверхности и дезинтеграцию биопленки можно проводить контактированием поверхности, например погружением, покрытием или опрыскиванием поверхности, с водной средой, содержащей варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу штамма TS-23 Bacillus sp. или ее вариант, или один или несколько других ферментов, ответственных за разрушение биопленок, таких как, но не ограничиваясь ими, 2,6-варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -D-фруктангидролаза. Композицию можно использовать для гидролиза липкой грязи, например, во вспененной воде в целлюлозной и бумажной промышленности.

варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -Амилазы штамма TS-23 Bacillus sp. или ее варианты могут присутствовать в количестве от 0,0001 до 10000 мг/л; 0,001-1000 мг/л; 0,01-100 мг/л или 0,1-10 мг/л. Дополнительные ферменты и варианты ферментов могут присутствовать в сходных или меньших количествах.

Процесс можно пригодным образом проводить при температурах от приблизительно температуры окружающей среды до приблизительно 70°С. Иллюстративные диапазоны температур включают от приблизительно 30°С до приблизительно 60°С, например от приблизительно 40°С до приблизительно 50°С.

Пригодное значение pH для гидролиза биопленок находится в пределах от приблизительно 3,5 до приблизительно 8,5. Иллюстративные диапазоны pH включают от приблизительно 5,5 до приблизительно 8, например от приблизительно 6,5 до приблизительно 7,5. Время контакта или время реакции для эффективного удаления ферментом биопленки может значительно варьировать в зависимости от свойств биопленки и частоты, с которой поверхность обрабатывают ферментом отдельно или в сочетании с другими деградирующими биопленку ферментами, такими как 2,6-варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -D-фруктангидролаза. Иллюстративное время реакции может включать от приблизительно 0,25 до приблизительно 25 часов и от приблизительно 1 до приблизительно 10 часов, например приблизительно 2 часа.

Дополнительные деградирующие биопленку ферменты, которые можно комбинировать с варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазойштамма TS-23 Bacillus sp. или ее вариантами и 2,6-варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -D-фруктангидролазами, включают, но не ограничиваются ими, целлюлазы, гемицеллюлазы, ксиланазы, другие амилазы, включая другие варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, липазы, протеазы и/или пектиназы.

варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -Амилазу штамма TS-23 Bacillus sp. или ее варианты, кроме того, можно комбинировать с противомикробными средствами, такими как ферментные или неферментные биоциды. Ферментный биоцид, например, может представлять собой композицию, содержащую оксидоредуктазу, например лакказу или пероксидазу, особенно галопероксидазу, и необязательно усиливающее средство, такое как алкилсирингат, как описано, например, в международных заявках PCT WO 97/42825 и DK 97/1273.

Поверхность, с которой биопленку, например, можно удалять и/или очищать, представляет собой твердую поверхность, которая по определению относится к любой поверхности, которая является по существу непроницаемой для микроорганизмов. Примерами поверхностей являются поверхности, изготовленные из металла, например сплавов нержавеющей стали, пластмасс/синтетических полимеров, резины, картона, стекла, дерева, бумаги, ткани, бетона, камня, мрамора, гипса и керамических материалов, которые необязательно могут быть покрыты, например, краской, эмалью, полимерами и т.п. Таким образом, поверхность может быть частью системы, в которой содержатся, транспортируются, перерабатываются водные растворы или которая контактирует с ними, такой как системы водоснабжения, системы пищевой промышленности, охлаждающие системы, системы химической обработки или системы фармацевтической промышленности. Композиции и способы применения композиций пригодны для удаления биопленки в деревообрабатывающей промышленности, такой как целлюлозная и/или бумажная промышленность. Таким образом, фермент и композиции, содержащие фермент, пригодны в общепринятой системе мойки без разборки (C-I-P). Поверхность может быть частью системного модуля, такого как трубы, цистерны, насосы, мембраны, фильтры, теплообменники, центрифуги, выпариватели, смесители, оросительные колонны, клапаны и реакторы. Также поверхность может быть или является частью инструментов, используемых в медицинской науке и промышленности, таких как загрязненные эндоскопы, протезы или медицинские имплантаты.

Композиции для удаления биопленки также предназначены для профилактики так называемой биокоррозии, происходящей, когда металлическая поверхность, например трубопровод, подвергается воздействию микробной биопленки, то есть посредством дезинтеграции биопленки, таким образом, препятствуют созданию микробными клетками в биопленке среды биопленки, которая вызывает коррозию металлической поверхности, к которой она прикреплена.

Другим применением композиций против биопленки является уход за полостью рта. Однако поверхность также может быть биологического происхождения, такая как слизистые мембраны, кожа, зубы, волосы, ногти и т.д.

Поверхности включают зубы с зубным налетом, например, при включении ферментов в зубную пасту и загрязненные контактные линзы. Таким образом, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу штамма TS-23 Bacillus sp. или ее варианты можно использовать для композиций и процессов для получения лекарственного средства в целях дезинтеграции налета, присутствующего на зубах человека или животного. Следующим применением является дезинтеграция биопленки со слизистых мембран, такой как биопленка в легких у пациентов, страдающих кистозным фиброзом.

Таким образом, следующий аспект относится к композиции для ухода за полостью рта, содержащей рекомбинантный фермент, такой как очищенный фермент, который по существу не содержит каких-либо активных примесей. Композиция для ухода за полостью рта может содержать пригодное количество рекомбинантного фермента.

Другие деградирующие биопленку ферменты для применения в композициях для ухода за полостью рта включают, но не ограничиваются ими, активную 2,6-варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -D-фруктангидролазу в композиции для ухода за полостью рта. Предусмотренные активные ферменты включают активные ферменты из группы ферментов, включающей декстраназу; мутаназы; оксидазы, такие как глюкозооксидаза, оксидаза L-аминокислот, пероксидазы, например, такие как пероксидазы Coprinus sp., описанные в WO 95/10602, или лактопероксидаза, галопероксидазы, особенно галопероксидаза из Curvularia sp., в частности C. verruculosa и C. inaequalis; лакказы; протеазы, такие как папаин, кислая протеаза (например, кислые протеазы, описанные в WO 95/02044, эндоглюкозидазы, липазы, амилазы, включая амилоглюкозидазы, такие как AMG (Novo Nordisk A/S); противомикробные ферменты и их смеси.

Композиция для ухода за полостью рта может иметь любую пригодную физическую форму (т.е. порошок, паста, гель, жидкость, мазь, таблетка и т.д.). "Композиция для ухода за полостью рта" включает композицию, которую можно использовать для поддержания и улучшения гигиены полости рта во рту у человека и животных посредством профилактики зубного кариеса, профилактики образования зубного налета и зубного камня, удаления зубного налета и зубного камня, профилактики и/или лечения заболеваний зубов и т.д. По меньшей мере в этом контексте композиции для ухода за полостью рта также включают продукты для очистки зубных протезов, искусственных зубов и т.п. Примеры таких композиций для ухода за полостью рта включают зубную пасту, крем для зубов, гель или зубной порошок, жидкость для полоскания полости рта, составы для полоскания до или после чистки щеткой, жевательную резинку, пастилки и конфеты. Зубные пасты и зубные гели, как правило, включают абразивные полирующие материалы, пенообразующие вещества, вкусовые добавки, смачивающие средства, связующие вещества, загустители, подсластители, отбеливающие/осветляющие/удаляющие пятна средства, воду и необязательно дополнительные ферменты и сочетания ферментов.

Жидкости для полоскания рта, включая жидкости для удаления зубного налета, как правило, содержат раствор вода/спирт, вкусовую добавку, смачивающее вещество, подсластитель, пенообразующее средство, краситель и необязательно дополнительные ферменты или сочетания ферментов.

Также в композицию для ухода за полостью рта, такую как средство для чистки зубов, можно включать абразивный полирующий материал.

Таким образом, абразивный полирующий материал может включать оксид алюминия и его гидраты, такие как варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -тригидрат оксида алюминия; трисилицилат магния; карбонат магния; каолин; алюминосиликаты, такие как кальцинированный силикат алюминия и силикат алюминия; карбонат кальция; силикат циркония; а также порошковые пластмассы, такие как поливинилхлорид; полиамиды; полиметилметакрилат; полистирол; фенолформальдегидные смолы; меламин-формальдегидные смолы; мочевино-формальдегидные смолы; эпоксисмолы; порошковый полиэтилен; ксерогели из диоксида кремния; гидрогели и аэрогели и т.п. Также в качестве абразивных средств пригодны пирофосфат кальция; нерастворимые в воде щелочные метафосфаты; дикальцийфосфат и/или его дигидрат, дикальцийортофосфат; трикальцийфосфат; гидроксиапатит в виде твердых частиц и т.п. Также можно использовать смеси этих веществ.

В зависимости от композиции для ухода за полостью рта абразивный продукт может быть предоставлен в количестве от приблизительно 0% до приблизительно 70% по массе или от приблизительно 1% до приблизительно 70%. Для зубных паст содержание абразивного материала, как правило, находится в диапазоне от 10% до 70% по массе конечной зубной пасты.

Смачивающие вещества используют для предотвращения потери воды, например, из зубных паст. Пригодные смачивающие вещества для применения в композициях по уходу за полостью рта включают следующие соединения и их смеси: глицерин; полиол; сорбит; полиэтиленгликоли (PEG); пропиленгликоль; 1,3-пропандиол; 1,4-бутандиол; гидрогенизированные частично гидролизованные полисахариды и т.п. Смачивающие вещества, как правило, представлены в количестве от 0% до приблизительно 80% или от приблизительно 5% до приблизительно 70% по массе зубной пасты.

В качестве примеров пригодных загустителей и связующих веществ, которые способствуют стабилизации продукта для чистки зубов, можно упомянуть диоксид кремния, крахмал, трагакантовую камедь, ксантановую смолу, экстракты ирландского моха, альгинаты, пектин, производные целлюлозы, такие как гидроксиэтилцеллюлоза, карбоксиметилцеллюлозу натрия и гидроксипропилцеллюлозу, полиакриловую кислоту и ее соли, поливинилпирролидон. Загустители могут быть представлены в зубных кремах и гелях в количестве от приблизительно 0,1% до приблизительно 20% по массе, и связующие вещества могут быть представлены в количестве от приблизительно 0,01 до приблизительно 10% по массе конечного продукта.

В качестве пенообразующего средства можно использовать мыло, анионные, катионные, неионные, амфотерные и/или цвиттерионные поверхностно-активные вещества. Они могут быть представлены на уровнях от 0% до приблизительно 15%, от приблизительно 0,1% до приблизительно 13% или от приблизительно 0,25% до приблизительно 10% по массе конечного продукта.

Поверхностно-активные вещества пригодны только в той степени, чтобы они не оказывали эффекта инактивации варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы штамма TS-23 Bacillus sp. или ее вариантов. Поверхностно-активные вещества включают сульфаты жирных спиртов, соли сульфонатных моноглицеридов или жирных кислот, имеющих от 10 до 20 атомов углерода, продукты конденсации жирная кислота-альбумин, соли амидов жирных кислот и таурины и/или соли сложных эфиров жирных кислот с изэтионовой кислотой.

Пригодные для применения в составах подсластители включают сахарин.

Вкусовые добавки, такие как мята, обычно представлены в низких количествах, таких как от приблизительно 0,01% до приблизительно 5% по массе, особенно от приблизительно 0,1% до приблизительно 5%. Отбеливающие/осветляющие средства включают H2O 2, и их можно добавлять в количествах менее чем приблизительно 5% или от приблизительно 0,25% до приблизительно 4% в расчете на массу конечного продукта. Отбеливающие/осветляющие средства могут представлять собой фермент, такой как оксидоредуктаза. Примерами пригодных ферментов для осветления зубов являются такие ферменты, как описано в WO 97/06775.

Воду обычно добавляют в количестве, придающем, например, зубной пасте текучую форму.

Кроме того, также могут быть включены растворимые в воде антибактериальные средства, такие как хлоргексидина диглюконат, гексетидин, алексидин, Triclosan®, антибактериальные соединения на основе четвертичного аммония и растворимых в воде источников определенных ионов металлов, таких как цинк, медь, серебро и олово (например, хлорид цинка, меди и олова и нитрат серебра).

Также предусмотрено добавление соединений, которые можно использовать в качестве источника фторида, пигментов/красителей, консервантов, витаминов, pH-корректирующих средств, средств против кариеса, десенсибилизаторов и т. д.

Деградирующие биопленку ферменты обеспечивают несколько преимуществ, когда их используют для очистки полости рта. Протеазы разрушают белки слюны, которые адсорбируются на поверхности зуба и образуют тонкую пленку, первый слой конечного налета. Протеазы вместе с липазами разрушают бактерии посредством лизиса белков и липидов, которые формируют структурные компоненты клеточной стенки бактерий и мембран.

Декстраназа и другие карбогидразы, такие как 2,6-варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -D-фруктангидролаза, разрушают органическую скелетную структуру, продуцируемую бактериями, которая формирует матрикс для адгезии бактерий. Протеазы и амилазы не только препятствуют образованию налета, но также предотвращают развитие камня посредством разрушения углевод-белкового комплекса, который связывает кальций, препятствуя минерализации.

Зубная паста, как правило, может содержать следующие ингредиенты (в массовых % конечной композиции зубной пасты): до приблизительно 70% абразивного материала; смачивающее вещество: от 0% до приблизительно 80%; загуститель: от приблизительно 0,1% до приблизительно 20%; связующее вещество: от приблизительно 0,01% до приблизительно 10%; подсластитель: от приблизительно 0,1% до приблизительно 5%; пенообразующее вещество: от 0% до приблизительно 15%; отбеливатель: от 0% до приблизительно 5%; и ферменты: от приблизительно 0,0001% до приблизительно 20%.

В конкретном варианте осуществления зубная паста имеет pH в диапазоне от приблизительно 6,0 до приблизительно 8,0 и содержит: a) от приблизительно 10% до приблизительно 70% абразивного материала; b) от 0% до приблизительно 80% смачивающего вещества; c) от 0,1% до приблизительно 20% загустителя; d) от 0,01% до приблизительно 10% связующего вещества; e) от приблизительно 0,1% до приблизительно 5% подсластителя; f) от 0% до приблизительно 15% пенообразующего средства; g) от 0% до приблизительно 5% отбеливателя; i) от приблизительно 0,0001% до приблизительно 20% ферментов.

Указанные ферменты, обозначенные как i), включают варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу штамма TS-23 Bacillus sp. или ее варианты, отдельно или в сочетании с другими деградирующими биопленку ферментами, такими как 2,6-варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -D-фруктангидролаза, и необязательно другими типами ферментов, упомянутыми выше, о которых известно, что их применяют в зубных пастах и т.п.

Средство для полоскания рта, как правило, может содержать следующие ингредиенты (в массовых % конечной композиции для полоскания рта): от 0% до приблизительно 20% смачивающего средства; от 0% до приблизительно 2% поверхностно-активного вещества; от 0% до приблизительно 5% ферментов; от 0% до приблизительно 20% этанола; от 0% до приблизительно 2% других ингредиентов (например, вкусовой добавки, подсластителя, активных ингредиентов, таких как фториды). Также композиция может содержать от приблизительно 0% до приблизительно 70% воды.

Композиция для полоскания рта может быть забуферена соответствующим буфером, например цитратом натрия или фосфатом, в диапазоне pH от приблизительно 6,0 до приблизительно 7,5. Средство для полоскания рта может быть в неразбавленной форме (т.е. его необходимо разбавлять перед применением).

Композиции для ухода за полостью рта можно получать с использованием любого общепринятого способа ухода за полостью рта, известного в данной области.

4.4. Композиции для переработки крахмала и применение

В другом аспекте композиции с описанной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазой штамма TS-23 Bacillus sp. или ее вариантами можно использовать для разжижения или осахаривания крахмала.

В одном аспекте предусмотрены композиции и применения композиций для получения подсластителей из крахмала. "Традиционный" процесс превращения крахмала во фруктозные сиропы в норме состоит из трех последовательных ферментативных процессов, а именно процесса разжижения, за которым следует процесс осахаривания, и процесса изомеризации. В ходе процесса разжижения крахмал деградируется до декстринов варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазой штамма TS-23 Bacillus sp. или ее вариантами, при значениях pH между приблизительно 5,5 и приблизительно 6,2 и при температурах от приблизительно 95°С до приблизительно 160°С в течение приблизительно 2 часов. Для обеспечения оптимальной стабильности фермента в этих условиях можно добавлять 1 мМ кальций (по меньшей мере 40 ч./млн свободных ионов кальция). Переработка крахмала пригодна для получения спирта (например, разжижение хлебных злаков для топливного и пищевого спирта, пивоварение), разжижения крахмала для получения подсластителя, технологии тростниково-сахарного производства и других связанных с пищей целей переработки крахмала. Для других варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаз штамма TS-23 Bacillus sp. или их вариантов можно использовать другие условия.

После процесса разжижения декстрины превращают в декстрозу добавлением глюкоамилазы (например, AMGTM) и расщепляющего разветвленную структуру фермента, такого как изоамилаза или пуллуланаза (например, PROMOZYME®). Перед этой стадией pH снижают до значения ниже приблизительно 4,5, поддерживая высокую температуру (выше 95°С), и денатурируют активное вещество в виде разжижающей варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы штамма TS-23 Bacillus sp. или ее варианта. Температуру снижают до 60°С, и можно добавлять глюкоамилазу и расщепляющий разветвленную структуру фермент. Процесс осахаривания продолжается, как правило, в течение от приблизительно 24 до приблизительно 72 часов.

После процесса осахаривания pH повышают до значения в диапазоне от приблизительно 6,0 до приблизительно 8,0, например pH 7,5, и удаляют кальций посредством ионного обмена. Затем сироп декстрозы превращают в сироп с высоким содержанием фруктозы с использованием, например, иммобилизованной глюкозоизомеразы (такой, как Sweetzyme®).

Можно проводить по меньшей мере одно ферментативное усовершенствование этого процесса, например снижение зависимости от кальция разжижающей варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы штамма TS-23 Bacillus sp. или ее варианта. Для обеспечения достаточно высокой стабильности варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы штамма TS-23 Bacillus sp. или ее варианта требуется добавление свободного кальция, однако свободный кальций сильно ингибирует активность глюкозоизомеразы и его необходимо удалять, посредством дорогостоящего типового процесса в количестве, которое снижает уровень свободного кальция до менее чем 3-5 ч./млн. Можно было бы добиться снижения затрат, если бы можно было избежать такого действия, и процесс разжижения можно было бы проводить без добавления свободных ионов кальция.

Например, в композициях и способах можно использовать менее кальций-зависимый фермент, который является стабильным и высоко активным при низких концентрациях свободного кальция (<40 ч./млн). Такая варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза штамма TS-23 Bacillus sp. или ее вариант должны иметь оптимум pH при pH в диапазоне от приблизительно 4,5 до приблизительно 6,5 или в диапазоне от приблизительно 4,5 до приблизительно 5,5.

варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -Амилазу штамма TS-23 Bacillus sp. или ее вариант можно использовать в лабораторных и промышленных условиях для гидролиза крахмала или любого мальтодекстрин-содержащего соединения для различных целей. Эти варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы штамма TS-23 Bacillus sp. или их варианты можно использовать для обеспечения специфического гидролиза или их можно комбинировать с другими амилазами для получения "коктейля" с широким спектром активности. Иллюстративные способы применения включают удаление или частичный или полный гидролиз крахмала или любого мальтодекстрин-содержащего соединения из биологических образцов, образцов пищи, кормов для животных, фармацевтических или промышленных образцов.

Другой аспект предусматривает композиции и способы применения композиций для процесса ферментации, где крахмальный субстрат сжижают и/или осахаривают в присутствии варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы штамма TS-23 Bacillus sp. или ее варианта с получением глюкозы и/или мальтозы, пригодных для превращения в продукт ферментации ферментирующим организмом, таким как дрожжи. Такие процессы ферментации включают процесс получения этанола для топлива или пищевого этанола (спирта для пищевых целей), процесс получения напитков, процесс получения требуемых органических соединений (например, таких как лимонная кислота, итаконовая кислота, молочная кислота, глюконовая кислота, глюконат натрия, глюконат кальция, глюконат калия, глюконодельталактон или эриторбат натрия), кетонов, аминокислот (таких, как глутаминовая кислота, моноглутаминат натрия), а также более комплексных соединений (например, антибиотиков, таких как пенициллин, тетрациклин), ферментов, витаминов (например, рибофлавина, витамина B12 , варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -каротина) и гормонов, которые трудно получить синтетически.

Крахмал, подлежащий переработке, может представлять собой очищенный крахмал высокого качества, такой как крахмал, чистый по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 97% или по меньшей мере на 99,5%. Альтернативно крахмал может представлять собой менее очищенный содержащий крахмал материал, содержащий измельченное цельное зерно, включающее некрахмальные фракции, такие как остатки семян и волокна. Неочищенный материал, такой как цельное зерно, измельчают для открытия структуры и обеспечения последующей переработки. Можно использовать два процесса измельчения: влажное и сухое измельчение. Также можно применять кукурузную крупу, такую как измельченная кукурузная крупа.

Сухое измельченное зерно в дополнение к крахмалу может содержать значительные количества некрахмальных углеводных соединений. Когда такой гетерогенный материал обрабатывают посредством струйной тепловой обработки штамма TS-23 Bacillus sp., часто достигают только частичной желатинизации крахмала. Поскольку варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза штамма TS-23 Bacillus sp. или ее вариант имеет высокую активность в отношении нежелатинизированного крахмала, фермент(ы) можно преимущественно применять в процессе, включающем разжижение и/или осахаривание обработанного струйной тепловой обработкой измельченного крахмала.

Более того, вследствие превосходной активности в отношении гидролиза варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазштамма TS-23 Bacillus sp. или их вариантов значительно снижается потребность в глюкоамилазе в ходе стадии осахаривания. Это позволяет проводить осахаривание при очень низких уровнях активности глюкоамилазы. Активность глюкоамилазы либо отсутствует, либо, если она присутствует, то она присутствует в количестве не более или даже менее 0,5 AGU/г DS, или не более или даже менее чем 0,4 AGU/г DS, или не более чем или даже менее чем приблизительно 0,3 AGU/г DS, или менее чем 0,1 AGU, например не более или даже менее чем приблизительно 0,05 AGU/г DS крахмального субстрата. "DS" представляет собой единицу фермента, добавленного на грамм сухого твердого субстрата. Выраженный в мг белка фермента фермент, имеющий активность глюкоамилазы, либо отсутствует, либо присутствует в количестве не более или даже менее чем приблизительно 0,5 мг EP/г DS, или не более или даже менее чем приблизительно 0,4 мг EP/г DS, или не более или даже менее чем приблизительно 0,3 мг EP/г DS, или не более или менее чем даже приблизительно 0,1 мг EP/г DS (например, не более или даже менее чем приблизительно 0,05 мг EP/г DS или не более или даже менее чем 0,02 мг EP/г DS крахмального субстрата). Источником глюкоамилазы может быть штамм Aspergillus sp., Talaromyces sp., Pachykytospora sp. или Trametes sp., и иллюстративными примерами являются Aspergillus niger, Talaromyces emersonii, Trametes cingulata или Pachykytospora papyracea.

Способ может включать a) контактирование крахмального субстрата с варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазойштамма TS-23 Bacillus sp. или ее вариантом, содержащим каталитический модуль, имеющий активность варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы и углевод-связывающий модуль, например полипептидом первого аспекта; b) инкубацию указанного крахмального субстрата с указанным ферментом в течение периода времени и при температуре, достаточных для достижения превращения по меньшей мере 90%, по меньшей мере 91%, по меньшей мере 92%, по меньшей мере 93%, по меньшей мере 94%, по меньшей мере 95%, по меньшей мере 96%, по меньшей мере 97%, по меньшей мере 98%, по меньшей мере 99%, по меньшей мере 99,5% масс./масс. указанного крахмального субстрата в ферментируемые сахара; c) ферментацию с получением продукта ферментации; и d) необязательно выделение продукта ферментации. В ходе стадий процесса b) и/или c) фермент, имеющий активность глюкоамилазы, либо отсутствует, либо присутствует в количестве от 0,001 до 2,0 AGU/г DS, от 0,01 до 1,5 AGU/г DS, от 0,05 до 1,0 AGU/г DS, от 0,01 до 0,5 AGU/г DS. Фермент, имеющий активность глюкоамилазы, может либо отсутствовать, либо присутствовать в количестве не более или даже менее чем 0,5 AGU/г DS, или не более или даже менее чем 0,4 AGU/г DS, или не более или даже менее чем 0,3 AGU/г DS, или не более или даже менее чем 0,1 AGU/г DS (например, не более или даже менее чем 0,05 AGU/г DS крахмального субстрата). Выраженный в мг белка фермента фермент, имеющий активность глюкоамилазы, либо отсутствует, либо присутствует в количестве не более или даже менее чем 0,5 мг EP/г DS, или не более или даже менее чем 0,4 мг EP/г DS, или не более или даже менее чем 0,3 мг EP/г DS, или не более или даже менее чем 0,1 мг EP/г DS (например, не более или даже менее чем 0,05 мг EP/г DS или не более или даже менее чем 0,02 мг EP/г DS крахмального субстрата). Стадии a), b), c) и/или d) в процессе можно проводить по отдельности или одновременно.

В другом аспекте процесс может включать: a) контактирование крахмального субстрата с дрожжевой клеткой, трансформированной для экспрессии варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы штамма TS-23 Bacillus sp. или ее варианта, содержащего каталитический модуль, имеющий активность варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, и углевод-связывающий модуль; b) инкубацию указанного крахмального субстрата с указанными дрожжами в течение периода времени и при температуре, достаточных для обеспечения превращения по меньшей мере 90% масс./масс. указанного крахмального субстрата в ферментируемые сахара; c) ферментацию с получением этанола; d) необязательно выделение этанола. Стадии a), b) и c) можно проводить по отдельности или одновременно.

В другом аспекте способ включает гидролиз суспензии желатинизированного или гранулярного крахмала, в частности гидролиз гранулярного крахмала до растворимого гидролизата крахмала при температуре ниже исходной температуры желатинизации указанного гранулярного крахмала. В дополнение к контактированию с полипептидом, содержащим каталитический модуль, имеющий активность варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, и углевод-связывающий модуль, крахмал можно контактировать с любым одним или несколькими из следующих: варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза грибов (EC 3.2.1.1) и один или несколько из следующих: варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза (EC 3.2.1.2) и глюкоамилаза (EC 3.2.1.3). В следующем аспекте к варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазе штамма TS-23 Bacillus sp. или ее варианту можно добавлять другой амилолитический фермент или расщепляющий разветвленную структуру фермент, такой как изоамилаза (EC 3.2.1.68) или пуллуланаза (EC 3.2.1.41).

В одном варианте осуществления процесс проводят при температуре ниже исходной температуры желатинизации. Такие процессы часто проводят по меньшей мере при 30°С, по меньшей мере 31°С, по меньшей мере 32°С, по меньшей мере 33°С, по меньшей мере 34°С, по меньшей мере 35°С, по меньшей мере 36°С, по меньшей мере 37°С, по меньшей мере 38°С, по меньшей мере 39°С, по меньшей мере 40°С, по меньшей мере 41°С, по меньшей мере 42°С, по меньшей мере 43°С, по меньшей мере 44°С, по меньшей мере 45°С, по меньшей мере 46°С, по меньшей мере 47°С, по меньшей мере 48°С, по меньшей мере 49°С, по меньшей мере 50°С, по меньшей мере 51°С, по меньшей мере 52°С, по меньшей мере 53°С, по меньшей мере 54°С, по меньшей мере 55°С, по меньшей мере 56°С, по меньшей мере 57°С, по меньшей мере 58°С, по меньшей мере 59°С или по меньшей мере 60°С. Значение pH, при котором проводят процесс, может находиться в диапазоне от приблизительно 3,0 до приблизительно 7,0, или от приблизительно 3,5 до приблизительно 6,0, или от приблизительно 4,0 до приблизительно 5,0. В одном аспекте предусмотрен способ, включающий ферментацию, например, с дрожжами с получением этанола, например, при температуре приблизительно 32°С, такой как от 30°С до 35°С.

В другом аспекте способ включает одновременное осахаривание и ферментацию, например, с дрожжами с получением этанола или другого пригодного ферментирующего организма с получением требуемого органического соединения, например, при температуре от 30°С до 35°С, например при приблизительно 32°С.

В указанных выше способах ферментации содержание этанола достигает по меньшей мере приблизительно 7%, по меньшей мере приблизительно 8%, по меньшей мере приблизительно 9%, по меньшей мере приблизительно 10%, по меньшей мере приблизительно 11%, по меньшей мере приблизительно 12%, по меньшей мере приблизительно 13%, по меньшей мере приблизительно 14%, по меньшей мере приблизительно 15%, например по меньшей мере приблизительно 16% этанола.

Крахмальная суспензия, подлежащая применению в любом из указанных выше аспектов, может иметь от приблизительно 20% до приблизительно 55% сухого твердого гранулярного крахмала, от приблизительно 25% до приблизительно 40% сухого твердого гранулярного крахмала или от приблизительно 30% до приблизительно 35% сухого твердого гранулярного крахмала. После контактирования с варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазой штамма TS-23 Bacillus sp. или ее вариантом фермент превращает растворимый крахмал в растворимый гидролизат крахмала гранулярного крахмала в количестве по меньшей мере 85%, по меньшей мере 86%, по меньшей мере 87%, по меньшей мере 88%, по меньшей мере 89%, по меньшей мере 90%, по меньшей мере 91%, по меньшей мере 92%, по меньшей мере 93%, по меньшей мере 94%, по меньшей мере 95%, по меньшей мере 96%, по меньшей мере 97%, по меньшей мере 98% или по меньшей мере 99%.

В другом варианте осуществления варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаза штамма TS-23 Bacillus sp. или ее вариант содержит каталитический модуль, имеющий активность варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, и углевод-связывающий модуль, например, полипептид первого аспекта используют в способе разжижения, осахаривания желатинизированного крахмала, например, но не ограничиваясь ими, желатинизации струйной тепловой обработкой. Способ может включать ферментацию для получения продукта ферментации, например этанола. Такой способ получения этанола из крахмалсодержащего материала посредством ферментации включает: (i) разжижение указанного крахмалсодержащего материала посредством полипептида, содержащего каталитический модуль, имеющий активность варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, и углевод-связывающий модуль, например полипептида первого аспекта; (ii) осахаривание полученной разжиженной массы; и (iii) ферментацию материала, полученного на стадии (ii), в присутствии ферментирующего организма. Необязательно способ дополнительно включает выделение этанола. Способы осахаривания и ферментации можно проводить в качестве одновременного способа осахаривания и ферментации (способа SSF). В ходе ферментации содержание этанола достигает по меньшей мере приблизительно 7%, по меньшей мере приблизительно 8%, по меньшей мере приблизительно 9%, по меньшей мере приблизительно 10%, например по меньшей мере приблизительно 11%, по меньшей мере приблизительно 12%, по меньшей мере приблизительно 13%, по меньшей мере приблизительно 14%, по меньшей мере 15%, например по меньшей мере 16% этанола.

Крахмал, подлежащий обработке в способах указанных выше аспектов, в частности, можно получать из клубней, корней, стеблей, стручков, злаков или цельного зерна. Более конкретно, гранулярный крахмал можно получать из кукурузы, початков кукурузы, пшеницы, ячменя, ржи, проса, саго, маниоки, тапиоки, сорго, риса, гороха, бобов, банана или картофеля. Также предусмотрены как восковидные, так и невосковидные типы кукурузы и ячменя.

Композицию, описанную выше, можно использовать для разжижения и/или осахаривания желатинизированного или гранулярного крахмала и частично желатинизированного крахмала. Частично желатинизированный крахмал представляет собой крахмал, который является в некоторой степени желатинизированным, т.е. где часть крахмала является необратимо набухшей и желатинизированной, а часть крахмала все еще присутствует в гранулярном состоянии.

Композиция, описанная выше, может содержать вариант кислой варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, присутствующий в количестве от 0,01 до 10,0 AFAU/г DS, или от 0,1 до 5,0 AFAU/г DS, или от 0,5 до 3,0 AFAU/AGU, или от 0,3 до 2,0 AFAU/г DS. Композицию можно применять в любом из видов переработки крахмала, описанных выше.

Как используют в настоящем документе, термин "разжижение" или "разжижать" означает процесс, посредством которого крахмал превращается в декстрины с более короткой цепью и с меньшей вязкостью. Как правило, этот процесс вовлекает желатинизацию крахмала одновременно с добавлением варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы штамма TS-23 Bacillus sp. или ее варианта или после него. Также можно добавлять дополнительные индуцирующие разжижение ферменты.

Как используют в настоящем документе, термин "первичное разжижение" относится к стадии разжижения, когда температуру суспензии поднимают до уровня температуры ее желатинизации или до температуры, близкой к этой. После повышения температуры суспензию пропускают через теплообменник или инжектор при температурах от 200-300°F (93-149°С), например 220-235°F (104-113°С). После применения температуры теплообмена или температуры струи суспензию держат в течение 3-10 минут при этой температуре. Стадия поддержания суспензии при 200-300°F (93-149°С) представляет собой первичное разжижение.

Как используют в настоящем документе, термин "вторичное разжижение" относится к стадии разжижения после первичного разжижения (нагревания до 200-300°F (93-149°С)), когда суспензии позволяют охладиться до атмосферной температуры. Эта стадия охлаждения может составлять от 30 минут до 180 минут (3 часов), например от 90 минут до 120 минут (2 часов).

Как используют в настоящем документе, термин "количество минут вторичного разжижения" относится ко времени, которое прошло от начала вторичного разжижения до времени, когда измеряют DE.

Другой аспект предусматривает дополнительное применение варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы в композиции, содержащей варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазу штамма TS-23 Bacillus sp. или ее вариант. варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -Амилазы (EC 3.2.1.2) представляют собой экзодействующие мальтогенные амилазы, которые катализируют гидролиз 1,4-варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -глюкозидных связей в амилозе, амилопектине и сходных полимерах глюкозы, высвобождая, таким образом, мальтозу.

варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы выделены из различных растений и микроорганизмов (W.M. Fogarty and C.T. Kelly, PROGRESS IN INDUSTRIAL MICROBIOLOGY, vol. 15, pp. 112-115, 1979). Эти варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы характеризуются наличием оптимальных температур в диапазоне от 40°С до 65°С и оптимальным значением pH в диапазоне от приблизительно 4,5 до приблизительно 7,0. Предусмотренные варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы включают, но не ограничиваются ими, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы SPEZYME® BBA 1500, SPEZYME® DBA, OPTIMALT® ME, OPTIMALT® BBA (Genencor International Inc.) и NOVOZYM TM WBA (Novozymes A/S) из ячменя.

Другим ферментом, предусмотренным для применения в композиции, является глюкоамилаза (EC 3.2.1.3). Глюкоамилазы получают из микроорганизма или растения. Иллюстративными глюкоамилазами являются глюкоамилазы грибов или бактерий. Иллюстративными глюкоамилазами бактерий являются глюкоамилазы Aspergillus, в частности глюкоамилаза G1 или G2 A. niger (Boel et al., EMBO J. 3(5): 1097-1102 (1984), или ее варианты, такие как описаны в WO 92/00381 и WO 00/04136; глюкоамилаза A. awamori (WO 84/02921); A. oryzae (Agric. Biol. Chem., 55(4): 941-949 (1991)) или их варианты или фрагменты.

Другие предусмотренные варианты глюкоамилазы Aspergillus включают варианты, усиливающие термическую стабильность: G137A и G139A (Chen et al., Prot. Eng. 9: 499-505 (1996)); D257E и D293E/Q (Chen et al., Prot. Eng. 8: 575-582 (1995)); N182 (Chen et al., Biochem. J. 301: 275-281 (1994)); дисульфидные связи, A246C (Fierobe et al., Biochemistry, 35: 8698-8704 (1996)); и внесение остатков Pro в положения A435 и S436 (Li et al., Protein Eng. 10: 1199-1204 (1997)). Другие предусмотренные глюкоамилазы включают глюкоамилазы Talaromyces , в частности, из Talaromyces emersonii (WO 99/28448), Talaromyces leycettanus (патент США № RE 32153), Talaromyces duponti, Talaromyces thermophilus (патент США № 4587215). Предусмотренные глюкоамилазы бактерий включают глюкоамилазы из рода Clostridium, в частности C. thermoamylolyticum (EP 135138) и C. thermohydrosulfuricum (WO 86/01831). Иллюстративные глюкоамилазы включают глюкоамилазы из Aspergillus oryzae. Также предусмотрены коммерческие глюкоамилазы, такие как AMG 200L; AMG 300L; SANTM SUPER и AMGTM E (Novozymes); OPTIDEX®300 (от Genencor International, Inc.); AMIGASE® и AMIGASE® PLUS (DSM); G-ZYME® G900 (Enzyme Bio-Systems); G-ZYME® G990 ZR (глюкоамилаза A. Niger с низким содержанием протеазы).

Глюкоамилазы можно добавлять в количестве 0,02-2,0 AGU/г DS или 0,1-1,0 AGU/г DS, таком как 0,2 AGU/г DS.

Также предусматривается включение в композицию дополнительных ферментов и вариантов ферментов. В дополнение к варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазештамма TS-23 Bacillus sp. или ее варианту можно использовать одну или несколько варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилаз или, кроме того, можно включать другие ферменты, рассмотренные в настоящем документе.

Другой фермент, который необязательно можно добавлять, представляет собой расщепляющий разветвленную структуру фермент, такой как изоамилаза (EC 3.2.1.68) или пуллуланаза (EC 3.2.1.41). Изоамилаза гидролизует варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -1,6-D-глюкозидную связь ветвления в амилопектине и варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -ограниченных декстринах, и ее можно отличить от пуллуланаз по неспособности изоамилазы воздействовать на пуллулан и ограниченному действию на варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -ограниченные декстрины. Расщепляющие разветвленную структуру ферменты можно добавлять в эффективных количествах, хорошо известных специалисту в данной области.

Точный состав продуктов способа зависит от сочетания применяемых ферментов, а также от типа перерабатываемого гранулярного крахмала. Например, растворимый гидролизат может представлять собой мальтозу с чистотой по меньшей мере приблизительно 85%, по меньшей мере приблизительно 90%, по меньшей мере приблизительно 95,0%, по меньшей мере приблизительно 95,5%, по меньшей мере приблизительно 96,0%, по меньшей мере приблизительно 96,5%, по меньшей мере приблизительно 97,0%, по меньшей мере приблизительно 97,5%, по меньшей мере приблизительно 98,0%, по меньшей мере приблизительно 98,5, по меньшей мере приблизительно 99,0% или по меньшей мере приблизительно 99,5%. Альтернативно растворимый гидролизат крахмала может представлять собой глюкозу, или гидролизат крахмала имеет DX (процент глюкозы от всех растворенных сухих твердых веществ) по меньшей мере 94,5%, по меньшей мере 95,0%, по меньшей мере 95,5%, по меньшей мере 96,0%, по меньшей мере 96,5%, по меньшей мере 97,0%, по меньшей мере 97,5%, по меньшей мере 98,0%, по меньшей мере 98,5%, по меньшей мере 99,0% или по меньшей мере 99,5%. Способ может включать продукт, который представляет собой специализированный сироп, такой как специализированный сироп, содержащий смесь глюкозы, мальтозы, DP3 и DPn для применения в изготовлении мороженого, пирожных, конфет, консервированных фруктов.

Два способа измельчения представляют собой влажное и сухое измельчение. При сухом измельчении цельные зерна измельчают и используют. Влажное измельчение обеспечивает хорошее разделение семян и муки (крахмальных гранул и белка), и его за некоторыми исключениями применяют в областях, где гидролизат крахмала используют для получения сиропов. Как сухое, так и влажное измельчение хорошо известно в области переработки крахмала, и они в равной степени предусмотрены для применения с описанными композициями и способами. Способ можно выполнять в системе для ультрафильтрации, где ретентат подвергают рециркуляции в присутствии ферментов, необработанного крахмала и воды и где фильтрат представляет собой растворимый гидролизат крахмала. В равной степени предусмотрен способ, проводимый в реакторе с непрерывной мембраной с ультрафильтрационными мембранами, где ретентат подвергают рециркуляции в присутствии ферментов, необработанного крахмала и воды и где фильтрат представляет собой растворимый гидролизат крахмала. Также предусмотрен способ, проводимый в реакторе с непрерывной мембраной с микрофильтрационными мембранами, где ретентат подвергают рециркуляции в присутствии ферментов, необработанного крахмала и воды и где фильтрат представляет собой растворимый гидролизат крахмала.

В одном аспекте растворимый гидролизат крахмала, полученный этими способами, подвергают превращению в сироп на основе крахмала с высоким содержанием фруктозы (HFSS), такой как фруктозный кукурузный сироп (HFCS). Это превращение можно проводить с использованием глюкозоизомеразы и посредством иммобилизованной глюкозоизомеразы, фиксированной на твердой подложке. Предусмотренные изомеразы включают коммерческие продукты Sweetzyme®, IT (Novozymes AJS); G-ZYME® IMGI и G-ZYME® G993, KETOMAXTM, G-ZYME® G993 (Rhodia); жидкость G-ZYME® G993, GENSWEET® IGI (Genencor International, Inc.).

В другом аспекте растворимый гидролизат крахмала, получаемый этими способами, можно использовать для получения топлива или этанола для пищевых целей. В способе третьего аспекта ферментацию можно проводить одновременно или отдельно/последовательно относительно гидролиза гранулярной суспензии крахмала. Когда ферментацию проводят одновременно с гидролизом, температура составляет между 30°С и 35°С или между 31°С и 34°С. Способ можно выполнять в системе для ультрафильтрации, где ретентат подвергают рециркуляции в присутствии ферментов, сырого крахмала, дрожжей, питательных веществ для дрожжей и воды и где фильтратом является содержащая этанол жидкость. В равной степени предусмотрен способ, проводимый в реакторе с непрерывной мембраной с ультрафильтрационными мембранами, где ретентат подвергают рециркуляции в присутствии ферментов, сырого крахмала, дрожжей, питательных веществ для дрожжей и воды и где фильтратом является содержащая этанол жидкость.

Растворимый гидролизат крахмала, полученный этими способами, также можно использовать для получения продукта ферментации, включающего ферментацию обработанного крахмала до продукта ферментации, такого как лимонная кислота, моноглутамат натрия, глюконовая кислота, глюконат натрия, глюконат кальция, глюконат калия, глюконодельталактон или эриторбат натрия.

Амилолитическую активность варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы штамма TS-23 Bacillus sp. или ее варианта можно определять с использованием в качестве субстрата картофельного крахмала. Этот способ основан на разрушении модифицированного картофельного крахмала ферментом, за которым следует реакция со смешиванием образцов крахмал/раствор фермента с раствором иода. Сначала образуется черновато-синий цвет, однако по мере разрушения крахмала синий цвет слабеет и постепенно превращается в красновато-коричневый, который сравнивают со стандартным цветным стеклом.

5. Способы

5.1 Скрининговые анализы на фильтрах

Анализы, рассмотренные ниже, можно использовать для скрининга вариантов варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы AmyTS23, имеющих измененную стабильность при высоких или низких значениях pH и/или в условиях истощения Ca2+ по сравнению с исходным ферментом варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы.

5.2 Анализ на фильтре с высоким pH

Библиотеки Bacillus высевают на многослойный материал из ацетата целлюлозы (OE 67, Schleicher & Schuell, Dassel, Germany) и нитроцеллюлозных фильтров (Protran-Ba 85, Schleicher & Schuell, Dassel, Germany) на планшетах с агаром TY с 10 мкг/мл канамицина при 37°C по меньшей мере на 21 час. Слой ацетата целлюлозы расположен на планшете с агаром TY.

Каждый многослойный фильтр определенным образом маркируют с помощью иглы после высевания, но перед инкубацией, для того чтобы можно было локализовать положительные варианты на фильтре, и нитроцеллюлозный фильтр со связанными с ним вариантами переносят в контейнер с буфером глицин-NaOH, pH 8,6-10,6, и инкубируют при комнатной температуре (можно изменять от 10-60°С) в течение 15 мин. Фильтры из ацетата целлюлозы с колониями хранят на TY-планшетах при комнатной температуре до применения. После инкубации выявляют остаточную активность на планшетах, содержащих 1% агарозу, 0,2% крахмал в буфере глицин-NaOH, pH 8,6-10,6. Планшеты для анализа с нитроцеллюлозными фильтрами маркируют таким же образом, как и многослойные фильтры, и инкубируют в течение 2 часов при комнатной температуре. После удаления фильтров планшеты для анализа окрашивают 10% раствором Люголя. Деградирующие крахмал варианты выявляют в виде белых пятен на темно-синем фоне, а затем идентифицируют на планшетах для хранения. Положительные варианты два раза подвергают повторному скринингу в таких же условиях, как и в случае первого скрининга.

5.3 Анализ на фильтре с низким содержанием кальция

Библиотеки Bacillus высевают на многослойный материал из ацетата целлюлозы (OE 67, Schleicher & Schuell, Dassel, Germany) и нитроцеллюлозных фильтров (Protran-Ba 85, Schleicher & Schuell, Dassel, Germany) на планшетах с агаром TY, например канамицина или хлорамфеникола, при 37°C по меньшей мере на 21 час. Слой ацетата целлюлозы расположен на планшете с агаром TY.

Каждый многослойный фильтр определенным образом маркируют с помощью иглы после высевания, но перед инкубацией, для того чтобы можно было определить локализацию положительных вариантов на фильтре, и нитроцеллюлозный фильтр со связанными с ним вариантами переносят в контейнер с карбонатным/бикарбонатным буфером, pH 8,5-10, и с различными концентрациями EDTA (0,001 мМ-100 мМ). Фильтры инкубируют при комнатной температуре в течение 1 часа. Фильтры из ацетата целлюлозы с колониями хранят на TY-планшетах при комнатной температуре до применения. После инкубации выявляют остаточную активность на планшетах, содержащих 1% агарозу, 0,2% крахмал в карбонатном/бикарбонатном буфере, pH 8,5-10. Планшеты для анализа с нитроцеллюлозными фильтрами маркируют таким же образом, как и многослойные фильтры, и инкубируют в течение 2 часов при комнатной температуре. После удаления фильтров планшеты для анализа окрашивают 10% раствором Люголя. Деградирующие крахмал варианты выявляют в виде белых пятен на темно-синем фоне, а затем идентифицируют на планшетах для хранения. Положительные варианты два раза подвергают повторному скринингу в таких же условиях, как и в случае первого скрининга.

5.4 Анализ на фильтре с низким значением pH

Библиотеки Bacillus высевают на многослойный материал из ацетата целлюлозы (OE 67, Schleicher & Schuell, Dassel, Germany) и нитроцеллюлозных фильтров (Protran-Ba 85, Schleicher & Schuell, Dassel, Germany) на планшетах с агаром TY с 10 мкг/мл канамицина при 37°C по меньшей мере на 21 час. Слой ацетата целлюлозы расположен на планшете с агаром TY.

Каждый многослойный фильтр определенным образом маркируют с помощью иглы после высевания, но перед инкубацией, для того чтобы можно было локализовать положительные варианты на фильтре, и нитроцеллюлозный фильтр со связанными с ним вариантами переносят в контейнер с цитратным буфером, pH 4,5 и инкубируют при 80°С в течение 20 минут (при скрининге вариантов с основной цепью дикого типа) или 85°C в течение 60 минут (при скрининге вариантов исходной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы). Фильтры из ацетата целлюлозы с колониями хранят на TY-планшетах при комнатной температуре до применения. После инкубации выявляют остаточную активность на планшетах, содержащих 1% агарозу, 0,2% крахмал в цитратном буфере, pH 6,0. Планшеты для анализа с нитроцеллюлозными фильтрами маркируют таким же образом, как и многослойные фильтры, и инкубируют в течение 2 часов при 50°С. После удаления фильтров планшеты для анализа окрашивают 10% раствором Люголя. Деградирующие крахмал варианты выявляют в виде белых пятен на темно-синем фоне, а затем идентифицируют на планшетах для хранения. Положительные варианты два раза подвергают повторному скринингу в таких же условиях, как и в случае первого скрининга.

5.5 Вторичный скрининг

Положительные трансформанты после повторного скрининга отбирают с планшета для хранения и тестируют во вторичном анализе на планшете. Положительные трансформанты выращивают в течение 22 часов при 37°C в 5 мл LB+хлорамфеникол. Культуру Bacillus каждого положительного трансформанта и в качестве контроля клон, экспрессирующий соответствующую основную цепь, инкубируют в цитратном буфере, pH 4,5, при 90°С, и образцы отбирают через 0, 10, 20, 30, 40, 60 и 80 минут. На планшет для анализа наносят 3 микролитра образца. Планшет для анализа окрашивают 10% раствором Люголя. Улучшенные варианты выявляют в качестве вариантов с более высокой остаточной активностью (выявляемой в качестве ободков на планшете для анализа), чем у основной цепи. Улучшенные варианты определяют секвенированием нуклеотидов.

5.6 Анализ стабильности неочищенных вариантов

Стабильность вариантов можно анализировать следующим образом: культуры Bacillus, экспрессирующие варианты, подлежащие анализу, выращивают в течение 21 часа при 37°C в 10 мл LB+хлорамфеникол. 800 микролитров культуры смешивают с 200 микролитрами цитратного буфера, pH 4,5. Делают количество аликвот объемом 70 микролитров, соответствующее количеству моментов времени забора образцов в пробирках для ПЦР, и инкубируют при 70°С или 90°С для различных моментов времени (как правило, 5, 10, 15, 20, 25 и 30 минут) в устройстве для ПЦР. Образец, соответствующий 0 мин, не инкубируют при высокой температуре. Активность образца измеряют переносом 20 микролитров в 200 микролитров субстрата варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы PNP-G7 MPR3 (Boehringer Mannheim, каталожный № 1660730), как описано ниже в разделе "Анализ активности варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы". Результаты наносят на график в качестве процентной активности (относительно 0 момента времени) против времени или указывают в качестве процентной остаточной активности после инкубации в течение определенного периода времени.

5.7 Ферментация и очистка вариантов варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы

Штамм B. subtilis , обладающий соответствующей экспрессирующей плазмидой, можно ферментировать и очищать следующим образом: штамм наносят штрихами на планшет с LB-агаром с 10 мкг/мл канамицина из исходного материала при -80°С и выращивают в течение ночи при 37°C. Колонии переносят в 100 мл среды PS-1, дополненной 10 мкг/мл хлорамфиникола в 500-мл встряхиваемой колбе.

Состав среды PS-1

гранулированный сахар 100 г/л
мука из соевых бобов 40 г/л
Na 2HPO4, 12 H2O 10 г/л
PluronicTM PE 61000,1 г/л
CaCO35 г/л

Культуру встряхивают при 37°C при 270 об/мин в течение 5 суток.

Клетки и клеточный дебрис удаляют из бульона для ферментации центрифугированием при 4500 об/мин в течение 20-25 минут. После этого супернатант фильтруют с получением полностью прозрачного раствора. Фильтрат концентрируют и промывают на УФ-фильтре (мембрана с пределом 10000) и буфер заменяют 20 мМ ацетатом, pH 5,5. УФ-фильтрат наносят на S-sepharose F.F. и элюирование проводят посредством пошагового элюирования с помощью 0,2M NaCl в том же буфере. Элюент подвергают диализу против 10 мМ Tris, pH 9,0, наносят на Q-sepharose F.F. и элюируют с линейным градиентом 0-0,3M NaCl в 6 объемах колонки. Фракции, которые обладают активностью (измеренной посредством анализа Phadebas), объединяют, pH доводят до pH 7,5 и оставшийся цвет удаляют обработкой 0,5% масс./об. активного активированного угля в течение 5 минут.

5.8 Определение удельной активности

Удельную активность определяют с использованием анализа PHADEBAS® (Pharmacia) в качестве активности/мг фермента. Следуют инструкциям изготовителя (также см. ниже в разделе "Анализ активности варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы").

5.9 Определение изоэлектрической точки

pI определяют посредством изоэлектрического фокусирования (например: Pharmacia, Ampholine, pH 3,5-9,3).

5.10 Ускоренный анализ стабильности

В 50-мл пропиленовые пробирки добавляли 10 мл представляющего интерес детергента. Проводили соответствующее разведение как AmyTS23t, так и AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS, чтобы 180 ч./млн каждого из них отмерялось с помощью пипетки в отдельные пробирки, содержащие детергент. Детергент с каждым мутантным ферментом встряхивали в течение 30 с, а затем помещали на RotaMix (ATR RKVS Model) на 10 минут. 100 микролитров детергента с мутантным ферментом отмеряли с помощью пипетки и разбавляли 1:651. Исходную активность мутантов анализировали с использованием субстрата с блокированной P-нитрофенилмальтогептаозой (Blocked PBNPG7) на Konelab, Model 20XT. Затем образцы детергента инкубировали в инкубаторе с постоянной температурой, установленной на 37ºC. Образцы извлекали через 1, 2, 4, 7 и 17 суток и анализировали активность фермента.

5.11 Анализы активности варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы

5.11.1 Анализ Phadebas

Активность варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы определяют способом с использованием таблеток PHADEBAS® в качестве субстрата. Таблетки Phadebas (PHADEBAS® Amylase Test, поставляемые Pharmacia Diagnostic) содержат поперечно-сшитый нерастворимый окрашенный синим цветом полимер крахмала, который смешан с бычьим сывороточным альбумином и буферным веществом и таблетирован.

Для каждого отдельного измерения одну таблетку суспендируют в пробирке, содержащей 5 мл 50 мМ буфера Бриттона-Робинсона (50 мМ уксусная кислота, 50 мМ фосфорная кислота, 50 мМ борная кислота, 0,1 мМ CaCl2, значение pH, доведенное до представляющей интерес величины с помощью NaOH). Тест проводят на водяной бане при представляющей интерес температуре. варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -Амилазу, подлежащую тестированию, разбавляют в X мл 50 мМ буфера Бриттона-Робинсона. К 5 мл 50 мМ буфера Бриттона-Робинсона добавляют 1 мл этого раствора варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы. Крахмал гидролизуют с помощью варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы, дающей растворимые синие фрагменты. Поглощение полученного синего раствора, измеренное спектрофотометрически при 620 нм, является функцией активности варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы.

Важно, что измеренное поглощение при 620 нм после 10 или 15 минут инкубации (время тестирования) находится в диапазоне от 0,2 до 2,0 единиц поглощения при 620 нм. В этом диапазоне поглощения существует линейность между активностью и поглощением (закон Ламберта-Бера). Разбавление фермента, таким образом, необходимо проводить, чтобы удовлетворялся этот критерий. В указанном наборе условий (температура, pH, время реакции, условия буфера) 1 мг данной варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы будет гидролизовать определенное количество субстрата и будет образовываться синий цвет. Интенсивность цвета измеряют при 620 нм. Измеренное поглощение прямо пропорционально удельной активности (активность/мг чистого белка варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы) представляющей интерес варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы в данном наборе условий.

5.11.2 Альтернативный способ

Активность варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы определяют способом с использованием субстрата PNP-G7. PNP-G7, который является сокращением для п-нитрофенил-варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -D-мальтогептаозида, представляет собой блокированный олигосахарид, который можно расщеплять эндоамилазой. После расщепления варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -глюкозидаза, включенная в набор, расщепляет субстрат с высвобождением свободной молекулы PNP, которая имеет желтый цвет, и, таким образом, ее можно измерить видимой спектрофотометрией при варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 =405 нм (400-420 нм). Наборы, содержащие субстрат PNP-G 7 и варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -глюкозидазу, изготавливаются Boehringer-Mannheim (каталожный № 1054635).

Для получения раствора реагента 10 мл раствора субстрат/буфер добавляют к 50 мл раствора фермент/буфер, как рекомендовано изготовителем. Анализ проводят переносом 20 микролитров образца в 96-луночный микропланшет для титрования и инкубацией при 25°C. Добавляют 200 микролитров раствора реагента, предварительно уравновешенного до 25°C. Раствор перемешивают и предварительно инкубируют в течение 1 минуты и поглощение измеряют каждые 30 секунд на протяжении 4 минут при OD 405 нм в устройстве для считывания для ELISA.

Наклон кривой зависимости поглощения от времени прямо пропорционален активности представляющей интерес варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы при данном наборе условий.

5.12 Определение характеристик фермента в детергентных композициях

5.12.1 Условия US

С использованием Terg-o-tometer, United States Testing, Hoboken, N.J. для имитации теста мытья в условиях промывания US получали кривую эффективности дозы (DEC) представляющего интерес мутантного фермента при 20°С с использованием стандартных детергентов, таких как жидкость AATCC 2003 без оптического отбеливателя и/или порошок AATCC 1993 (American Association of Textile Chemists and Colorists). Затем получали соответствующую DEC сравниваемой варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы для сравнения характеристики удаления пятен мутантного фермента по изобретению. Этот процесс повторяли при 40°С. Как правило, 4 образца с пятном крахмала риса CS-28 (CFT of Holland) помещали в стальной контейнер устройства Terg-o-tometer, которое заполняли 1 литром DI-воды и 1,5 г жидкого AATCC. Когда использовали порошок AATCC, взвешивали 1,5 г детергентного порошка на аналитических весах (Model PM4800, Mettler Instrument Corp., Highstown, NJ. 08520) и добавляли в Terg-o-tometer. Одновременно проводили два повторных анализа. Если нет иных указаний, тесты проводили в течение 12 минут и промывание проводили в течение 3 минут. После промывания образцы сушили воздухом и отражающую способность образцов измеряли с помощью Chroma Meter Model CR-410, изготовленного Konica Minolta. Полученные данные обрабатывали с помощью подходящего статистического анализа.

5.12.2 Европейские условия

С использованием Launder-O-meter, изготовленного Atlas Company, Atlanta, Georgia- для имитации теста мытья в европейских условиях мытья, получали кривую эффективности дозы (DEC) представляющего интерес мутантного фермента при 40°С с использованием стандартных европейских детергентов для тестирования, IEC A и IEC A с отбеливателем (TAED - тетраацетилэтилендиаминацетат) и перборатом натрия. Затем получали соответствующую DEC сравниваемой варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы для сравнения характеристик удаления пятен мутантного фермента по изобретению. Если было желательно, этот процесс повторяли при более высокой температуре. Как правило, 4 образца EMPA 161, крахмал маиса (EMPA, Switzerland) помещали в стальной контейнер с 250 мл DI-воды, содержащей 6,8 г/л детергента IEC A или 8,0 г/л детергента IEC A с отбеливателем. Одновременно повторяли два повторных анализа. Если нет иных указаний, тесты проводили в течение 45 минут и промывание проводили в течение 5 минут. После промывания образцы сушили воздухом и отражающую способность образцов измеряли с помощью Chroma Meter Model CR-410. Полученные данные обрабатывали с помощью подходящего статистического анализа.

5.12.3 Способ оценки детергентных композиций с помощью микрообразцов

Существует множество анализов очистки варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазой. Иллюстративное описание тестирования очистки включает следующее.

"Образец" представляет собой кусок материала, такого как ткань, на который нанесено пятно. Материал может представлять собой, например, ткани, сделанные из хлопка, полиэфира или смесей природных и синтетических волокон. Кроме того, образец может представлять собой бумагу, такую как фильтровальная бумага или нитроцеллюлоза, или кусок твердого материала, такой как керамика, металл или стекло. Для амилаз основой пятна является крахмал, однако оно может включать кровь, молоко, чернила, траву, чай, вино, шпинат, соус, шоколад, яйцо, сыр, глину, краситель, масло или смеси этих соединений.

"Образец меньших размеров" представляет собой срез образца, который нарезан с помощью дырокола с одним отверстием или нарезан с помощью изготовленного по заказу устройства с 96 пуансонами, где их расположение совпадает со стандартными 96-луночными микропланшетами для титрования, или срез, который иным образом получен из образца. Образец может представлять собой ткань, бумагу, металл или другой пригодный материал. Образец меньших размеров может иметь пятно, прикрепленное либо до, либо после того, как он помещен в лунку 24-, 48- или 96-луночного микропланшета для титрования. "Образец меньших размеров" также можно изготовить нанесением пятна на небольшой фрагмент материала. Например, образец меньших размеров может представлять собой окрашенный кусок ткани диаметром 5/8" или 0,25". Изготовленный на заказ дырокол сконструирован так, чтобы он доставлял 96 образцов одновременно во все лунки 96-луночного планшета. Устройство позволяет доставлять более одного образца в лунку просто помещением того же 96-луночного планшета несколько раз. Дыроколы с множеством пуансонов можно разработать для доставки одновременно образцов в планшет любого формата, включая, но не ограничиваясь ими, 24-луночные, 48-луночные и 96-луночные планшеты. В другом возможном способе загрязненная тестируемая платформа может представлять собой гранулы, изготовленные либо из металла, пластика, стекла, керамики, либо из другого пригодного материала, который покрыт загрязняющим субстратом, для применения при тестировании моющих композиций для материалов, отличных от тканей. Затем одну или несколько покрытых гранул помещают в лунки 96-, 48- или 24-луночных планшетов или в планшеты более крупных форматов, содержащие пригодный буфер и фермент. В этом случае супернатант можно исследовать в отношении высвобождаемой грязи либо посредством прямого определения поглощения, либо после вторичной реакции цветного проявления. Анализ высвобождаемой грязи также можно проводить с помощью масс-спектрального анализа. Дополнительным микроскрининговым анализом может быть доставка и фиксация образца, например окрашенного посредством индиго денима, в лунку многолуночного планшета и добавление частиц, таких как песок или более крупные частицы, например, такие как гранат, просеянный для включения частиц калибра от 6 до 8 или 9, и встряхивание планшета для обеспечения абразивной обработки образца добавленными частицами. Этот анализ применим для оценки целлюлаз для применения в окраске одежды из грубых тканей. Об эффективности фермента можно судить либо по высвобождению цвета (например, высвобождаемый индиго растворяют в диметилсульфоксиде и измеряют поглощение при A600 нм) в реакционный буфер, либо посредством измерения коэффициента поглощения подвергнутого абразивной обработке образца.

Когда, например, необработанные посредством BMI (кровь/молоко/чернила) образцы промывают в детергенте без отбеливателя, большая часть чернил высвобождается даже без помощи протеазы. Добавление протеазы приводит к небольшому повышению высвобождения чернил, которое может быть трудным количественно определить относительного большого фона. В одном аспекте предоставлен протокол обработки, который позволяет контролировать степень фиксации пятна. В результате можно получить образцы, которые, например, высвобождают варьирующие количества пятен при промывании в отсутствие тестируемого фермента. Применение фиксированных образцов ведет к резкому повышению отношения сигнала к шуму в анализах промывания. Более того, варьируя степень фиксации, можно получить пятна, которые дают оптимальные результаты в различных условиях очистки.

Образцы, имеющие пятна известной "прочности" на различных материалах, коммерчески доступны (EMPA, St. Gallen, Switzerland; wfk-Testgewebe GmbH, Krefeld Germany; или Center for Test Materials, Vlaardingen, The Netherlands) и/или их может изготовить специалист (Morris and Prato, Textile Research Journal 52(4): 280 286 (1982)). Другие тестируемые образцы включают, но не ограничиваются ими, пятно(а) кровь/молоко/чернила (BMI) на содержащей хлопок ткани, пятна шпината на содержащей хлопок ткани или пятна травы на содержащей хлопок ткани и шоколад/молоко/сажа на содержащей хлопок ткани.

Пятно BMI можно фиксировать на хлопке с помощью от 0,0003% до 0,3% пероксида водорода. Другие сочетания включают траву или шпинат, фиксированные с помощью от 0,001% до 1% глутаральдегида, желатин и пятна кумасси бриллиантового синего, фиксированного с помощью от 0,001% до 1% глутаральдегида, или шоколад, молоко и сажу, фиксированные с помощью от 0,001% до 1% глутаральдегида.

Также образец можно встряхивать в ходе инкубации с ферментом и/или детергентным составом. Технические данные при промывании зависят от ориентации образцов в лунках (горизонтальная против вертикальной), в частности в 96-луночном планшете. Это может указывать на то, что смешивание было недостаточным в ходе периода инкубации. Несмотря на то что существует ряд способов обеспечить достаточное встряхивание в ходе инкубации, можно сконструировать держатель планшета, в котором микропланшет для титрования вставлен между двумя плитами из алюминия. Это можно осуществить просто, поместив, например, адгезивное приспособление для закрывания планшетов над лунками, а затем скрепление двух планшетов из алюминия с 96-луночным планшетом с помощью пригодных коммерчески доступных зажимов. Затем его можно помещать в коммерческое устройство для встряхивания в инкубаторе. Установка устройства для встряхивания на приблизительно 400 об/мин приводит к очень эффективному смешению, в то время как вытеканию или перекрестному загрязнению эффективно препятствует держатель.

Тринитробензолсульфоновую кислоту (TNBS) можно использовать для количественного определения концентрации аминогрупп в моющем растворе. Это может служить мерой количества белка, который удален с образца (см., например, Cayot and Tainturier, Anal. Biochem. 249: 184-200 (1997)). Однако если образец детергента или фермента приводит к образованию необычно малых пептидных фрагментов (например, вследствие присутствия пептидаз в образце), тогда будет получен больший сигнал TNBS, т.е. больший "шум".

Существует другой способ определения характеристик отмывания крови/молока/чернил или другого пятна, который основан на высвобождении чернил. Протеолиз белка на образцах приводит к высвобождению частиц чернил, которые можно количественно определить посредством измерения поглощения моющего раствора. Поглощение можно измерять при любой длине волны между 350 и 800 нм. Длину волны измеряют при 410 нм или 620 нм. Моющий раствор также можно исследовать для определения характеристик промывания на пятнах, содержащих траву, шпинат, желатин или краску кумасси бриллиантовый синий. Иллюстративные длины волн для этих пятен включают 670 нм для шпината или травы и 620 нм для желатина или кумасси бриллиантового синего. Например, аликвоту моющего раствора (как правило, например, от 100 до 150 мкл из 96-луночного микропланшета) удаляют и помещают в кювету или многолуночный микропланшет. Его можно помещать в спектрофотометр и поглощение считывать при соответствующей длине волны.

Также систему можно использовать для определения улучшенной ферментной и/или детергентной композиции для мытья посуды, например, с использованием пятна кровь/молоко/чернила на пригодном субстрате, таком как ткань, пластмасса или керамика.

В одном аспекте пятно BMI фиксируют на хлопке нанесением 0,3% пероксида водорода на образец BMI/хлопок в течение 30 минут при 25°С или нанесением 0,03% пероксида водорода на образец BMI/хлопок в течение 30 минут при 60°С. Образцы меньших размеров приблизительно 0,25" вырезают из образца BMI/хлопок и помещают в лунки 96-луночного микропланшета для титрования. В каждую лунку помещают известную смесь детергентной композиции и фермента, такого как вариант белка. После помещения адгезивного приспособления для заклеивания планшетов на верхнюю часть микропланшета для титрования микропланшет для титрования прикрепляют к пластине из алюминия и встряхивают на орбитальном устройстве для встряхивания при приблизительно 250 об/мин в течение приблизительно от 10 до 60 минут. В конце этого времени супернатанты переносят в лунки нового микропланшета для титрования и измеряют поглощение чернил при 620 нм. Также можно сходным образом тестировать пятна шпината или пятна от травы, фиксированные на хлопке нанесением 0,01% глутаральдегида на образец шпинат/хлопок или образец трава/хлопок в течение 30 минут при 25°С. То же самое можно проводить для пятен от шоколада, молока и/или сажи. Дополнительные способы анализа с кровью/молоком/чернилами и условия предоставлены в патенте США № 7122334 (Genencor International, Inc.).

5.13 Определение чувствительности к LAS

Вариант инкубируют с различными концентрациями LAS (линейный алкилбензолсульфонат; Nansa 1169/P) в течение 10 минут при 40°С.

Остаточную активность определяют с использованием способа анализа Phadebas® или альтернативного способа с использованием субстрата PNP-G7.

LAS разбавляют в 0,1M фосфатном буфере, pH 7,5.

Используют следующие концентрации: 500 ч./млн, 250 ч./млн, 100 ч./млн, 50 ч./млн, 25 ч./млн и 10 ч./млн или без LAS.

Вариант разбавляют в различных буферах LAS до концентрации 0,01-5 мг/л в общем объеме 10 мл и инкубируют в течение 10 минут на водяной бане с контролируемой температурой. Инкубацию останавливают переносом небольшой аликвоты в холодный буфер для анализа. Важно, чтобы в ходе измерения активности концентрация LAS составляла менее 1 ч/млн, чтобы она не влияла на измерение активности.

Затем определяют остаточную активность два раза с использованием указанного выше анализа PHADEBAS® или альтернативного способа.

Активность измеряют после вычитания результатов для отрицательного контроля.

Активность без LAS составляет 100%.

Настоящая заявка организована в виде ряда разделов для простоты прочтения; однако читатель поймет, что утверждения, приведенные в одном разделе, могут быть отнесены к другим разделам. Таким образом, заголовки, используемые для различных разделов описания, не следует истолковывать, как ограничивающие.

Для дальнейшей иллюстрации вариантов осуществления и их преимуществ приведены следующие конкретные примеры, с учетом того что они предназначены для дальнейшей иллюстрации настоящего изобретения и их никоим образом не следует истолковывать как ограничивающие формулу изобретения.

ПРИМЕРЫ

В описании и экспериментальном разделе, который следует далее, используются следующие сокращения: % масс. (массовый процент); °С (градусы Цельсия); H2O (вода); dH 2O или DI (деионизированная вода); dIH2O (деионизированная вода, фильтрация Milli-Q); г (грамм); мкг (микрограмм); мг (миллиграмм); кг (килограмм); мкл (микролитры); мл (миллилитры); мм (миллиметры); мкм (микрометры); M (молярный); мМ (миллимолярный); мкМ (микромолярный); Е (единиц); ММ (молекулярная масса); с (секунды); мин (минута, минуты); ч (час, часы); DO (растворенный кислород); масс./об. (масса к объему); масс./масс. (масса к массе); об./об. (объем к объему); Genencor (Danisco US Inc, Genencor Division, Palo Alto, CA); Нсм (Ньютон на сантиметр) и ETOH (этанол), экв. (эквиваленты); N (нормальный); ds или DS (содержание сухих твердых веществ).

ПРИМЕР 1

Экспрессия AmyTS23 в B. subtilis

Для тестирования экспрессии AmyTS23 полноразмерную синтетическую последовательность ДНК, представленную на фиг.3 (изготовлена Geneart, Regensburg, Germany), клонировали позади промотора LAT (амилаза B. licheniformis ) и подвергали встраиванию в рамке считывания с последовательностью, кодирующей сигнальный пептид LAT (фиг.5) в вектор pHPLT (см., например, WO 2005111203 и [Solingen et al. (2001) Extremophiles 5: 333-341]), и трансформировали в штамм B. subtilis с 9 удаленными протеазами (degUHy32, oppA, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 spoII3501, amyE::xylRPxylAcomK-ermC, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 aprE, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 nprE, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 epr, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 ispA, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 bpr, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 vpr, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 wprA, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 mpr-ybfJ, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 nprB) (см. US 20050202535A1). Устойчивые к неомицину трансформанты (10 мкг/мл) секретируют амилазу AmyTS23, исходя из образования гало на крахмальных чашках после окрашивания иодом (см. WO2005111203). Один из этих положительных по амилазе трансформантов отобрали и обозначили BG6006 (pHPLT-AmyTS23). Культуры этого штамма, главным образом, выращивали при 37°С в течение от 60 до 72 часов при 250 об/мин в следующей среде (на литр): 10 г сойтона, 75 г глюкозы, 7,2 г мочевины, 40 мМ MOPS, 4 мМ трицин, 3 мМ двухосновный фосфат калия, 21,4 мМ KOH, 50 мМ NaCl, 276 мкМ сульфат калия, 528 мкМ хлорид магния, 50 мкМ трицитрата натрия дигидрат, 100 мкМ кальция хлорида дигидрат, 14 мкМ сульфата железа гептагидрат, 5,9 мкМ сульфата марганца дигидрат, 5,7 мкМ сульфата цинка моногидрат, 2,9 мкМ хлорида меди дигидрат, 4,2 мкМ хлорида кобальта гексагидрат, 4,5 мкМ молибдата натрия дигидрат. Для объема 1 л все компоненты за исключением сойтона смешивали в объеме 500 мл, подвергали стерильной фильтрации и добавляли к равной части 2X сойтона, который стерилизовали автоклавированием. Металлические микроэлементы и цитрат могли быть изготовлены в качестве 100X или 1000X исходных растворов. Буферы, гидроксид калия, хлорид натрия, сульфат калия, хлорид магния и металлические микроэлементы можно изготавливать в качестве 10X исходных растворов. После смешивания всех компонентов pH доводили до 7,3. Перед использованием эту среду дополняли 20 мМ хлоридом кальция.

Культура экспрессировала амилазу в двух основных формах. Высокомолекулярную форму наблюдали на уровне маркера размером 66 кДа на 10% геле SDS-PAGE. Более короткую форму наблюдали на уровне 55 кДа.

Высокомолекулярный компонент выделяли из культурального бульона обработкой 500 мл бульона установленным объемом, равным 10 мл, смолы аффинного матрикса варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -циклодекстрин-сефароза, синтезированной в собственной лаборатории по стандартному протоколу из варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -циклодекстрина (Sigma Aldrich, каталожный № c4767) и эпокси-активированной сефарозы 6B (GE Healthcare, N.J., каталожный № 17-0480-01), в течение ночи при 4°C при осторожном встряхивании, сбором смолы и промыванием 25 мМ бис-Tris-пропановым буфером (pH 8,5), содержащим 2 мМ хлорид кальция (CaCl2 ). Высокомолекулярный фермент элюировали промыванием смолы тем же буфером, дополненным 50 мМ варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -циклодекстрином. Фракции анализировали посредством SDS-PAGE и те фракции, которые содержали фермент, объединяли и подвергали диализу для удаления варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -циклодекстрина. Концентрацию белка фермента оценивали денситометрией в геле с помощью амилазы OxAm (Genencor), служащей в качестве белкового стандарта.

ПРИМЕР 2

Экспрессия AmyTS23t в B. subtilis

Для тестирования экспрессии генетически укороченной AmyTS23 (AmyTS23t) синтетический фрагмент ДНК, представленный на фиг.4, клонировали в pHPLT и трансформировали в штамм B. subtilis с 9 удаленными протеазами, как описано в примере 1. Устойчивые к неомицину трансформанты секретируют амилазу AmyTS23 исходя из образования гало на крахмальных чашках после окрашивания иодом. Один из этих положительных по амилазе трансформантов отобрали и обозначили BG6006 (pME622.1). Этот штамм культивировали для продукции амилазы AmyTS23t, как описано в примере 1. Культуральный супернатант исследовали посредством SDS-PAGE, и показано, что он продуцирует продукт ожидаемого размера 55 кДа.

Белок амилазы частично очищали добавлением NH4SO 4 к 500 мл культуры до конечной концентрации 1M. Далее добавляли установленный объем, равный 10 мл, смолы фенил-сефароза и смесь осторожно встряхивали в течение ночи при 4°C. Смолу собирали и промывали 25 мМ бис-Tris-пропановым буфером (pH 8,5), содержащим 1M NH4SO4 и 2 мМ хлорид кальция (CaCl2). Активность фермента анализировали в том же буфере без NH4SO4. Фракции анализировали посредством SDS-PAGE и те фракции, которые содержали фермент, объединяли и подвергали диализу для удаления остаточного NH 4SO4. Концентрацию белка фермента оценивали денситометрией в геле с амилозой OxAm (Genencor International Inc.), служащей в качестве белкового стандарта.

ПРИМЕР 3

AmyTS23 в скрининговом анализе очистки

Частично очищенную полноразмерную AmyTS23, описанную в примере 1, анализировали в микроанализе очистки в 96-луночном планшете образца ткани CS28 с загрязнением рисовым крахмалом, окрашенным оранжевым красителем. Для проведения этого анализа в 96-луночный планшет помещают образцы тканей размером 1/4 дюйма, которые нарезаны из ткани, предварительной промытой в воде с комнатной температурой в течение 1 часа и высушенной воздухом. Это промывание устраняет значительное количество слабосвязанных загрязнителей. Альтернативно образцы также предварительно промывают после того, как их помещают в планшет. Оба способа дают сходные результаты. В лунки планшета добавляют выбранный буфер и температуру планшета доводят до предпочтительной температуры. В данном примере анализ проводили в 25 мМ буфере HEPES (pH 8,0) и в 25 мМ буфере CAPS (pH 10,3) и инкубацию проводили при 40°C. После периода уравновешивания добавляют фермент до требуемой концентрации и инкубацию продолжают в течение от 30 минут до 1 часа при встряхивании при 750 об/мин в блоке Eppendorf Thermomix с контролируемой температурой. Эффективность определяют по величине зависимого от фермента высвобождения красителя в раствор. Высвобождение красителя количественно определяли спектрофотометрически при 488 нм. Для дополнительной информации об анализе см. патент США № 7122334.

Данные по очистке для этого фермента в данном анализе представлены на фиг.6 (20°С) и фиг.7 (40°С). Полноразмерная AmyTS23 (AmyTS23fl) была высоко эффективна в отношении удаления пятен при pH 8,0, но также она показала неожиданное удаление пятен при pH 10,3.

Данные указывают на то, что AmyTS23fl более эффективна, чем контроль (OxAm), при обоих значениях pH.

Этот анализ образцов можно модифицировать несколькими способами для различных целей. Анализ в 96-луночном планшете является в высокой степени пригодным в качестве высокопроизводительного анализа очистки посредством спектрофотометрического измерения поглощения после инкубации фермента с образцами, в то время как, например, 24-луночный планшет с образцами, нарезанными так, чтобы они соответствовали лункам, можно использовать для мытья образцов больших размеров, для которых можно измерять отражение, как известно в данной области. Два измерения, поглощение супернатанта и отражение от образца, показали практически полную корреляцию.

Корреляция отражения от промытого образца с поглощением супернатанта была высокой; коэффициент смешанной корреляции, r2, имел значение 0,99. Этот анализ, в принципе, можно масштабировать до 384-луночного планшета. Анализ можно проводить на любом загрязненном образце, помимо образца CS28 также можно тестировать образцы CS26, CS27 и CS29 (например, кукурузный крахмал, картофельный крахмал, крахмал тапиоки соответственно; Testfabrics, Inc., West Pittiston, PA), чтобы показать эффективность способа измерения, описанного в примере 3. Также анализ можно использовать с детергентными композициями и проводить при различных температурах и при различных значениях pH. Эти анализы были адаптированы из анализов патента США № 7122334.

ПРИМЕР 4

Скрининговый анализ очистки для AmyTS23t

Частично очищенную укороченную AmyTS23 (AmyTS23t), описанную в примере 2, анализировали в микроанализе очистки в 96-луночном планшете образца ткани CS28 с загрязнением рисовым крахмалом, окрашенным оранжевым красителем, как описано в примере 3. Данные по очистке для этого фермента в данном анализе представлены на фиг.8 (20°С) и фиг.9 (40°С). Данные указывают на то, что AmyTS23t функционирует лучше, чем контрольная амилаза (OxAm, коммерческая амилаза, полученная от Genencor), при обоих значениях рН. Сравнение фиг.6 и 8 отчетливо показывает, что укороченная AmyTS23 функционирует лучше при 20°С, чем полноразмерная зрелая молекула AmyTS23. Таким образом, укороченная молекула может быть лучшей молекулой для применения в стирке.

ПРИМЕР 5

Экспрессия вариантов AmyTS23 в B. subtilis

В этом примере описано конструирование штаммов Bacillus subtilis, экспрессирующих варианты AmyTS23t. Синтетический фрагмент ДНК 056426 (продуцированный Geneart GmbH, Josef-Engert-strasse 11, D-93053 Regensburg, Germany), содержащий кодон-оптимизированный ген AmyTS23 (фиг.3), служил в качестве матричной ДНК. Для экспрессии вариантов AmyTS23t использовали вектор pHPLT (Solingen et al., Extremophiles 5:333-341, 2001), который содержит промотор варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы (LAT) Bacillus licheniformis и сигнальный пептид LAT (при-LAT), с последующими участками рестрикции PstI и HpaI для клонирования.

Продуцировали три фрагмента ДНК посредством ПЦР с использованием праймеров ДНК, приведенных ниже:

1. AmyTS23t с удаленными CGG кодона 180 и AGC кодона 181 (AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS)

2. AmyTS23t с заменой ATG кодона 201 на CTG (AmyTS23t(M201L))

3. AmyTS23t как с заменой кодона ATG 201 на CTG, так и с удалением CGG кодона 180 и AGC кодона 181 (AmyTS23t(M201L+варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS))

варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516

Эти праймеры ДНК были синтезированы и обессолены Sigma (Sigma-Aldrich Chemie B.V., 27 Postbus 3330 AA Zwijndrecht, The Netherlands).

Для всех реакций ПЦР, описанных ниже, использовали праймеры ДНК в конечной концентрации 0,2 мкМ (прямой и обратный праймер) и 0,1-10 нг ДНК-матрицы (фрагмент ДНК 056426 или pDNA pHPLT). Кроме того, все реакции ПЦР проводили в объеме 50 мкл, с использованием Finnzymes (Finnzymes OY, Keilaranta 16 A, 02150 Espoo, Finland) высоко точной ДНК-полимеразы Phusion High-Fidelity DNA Polymerase (каталожный № F-530L). Также все реакционные смеси для ПЦР содержали 10 мкл буфера 5x Phusion HF, 1 мкл смеси 10 мМ dNTP, 0,75 мкл ДНК-полимеразы Phusion (2 единицы/мкл), 1 мкл 100% ДМСО и деионизированную автоклавированную воду до конечного объема 50 мкл. Программы ПЦР с использованием термоблока MJ Research PTC-200 Peltier thermal cycler (MJ Research, 590 Lincoln Street, Waltham, MA 02451, USA) проводили, как описано Finnzymes (протокол изготовителя): 30 с при 98°C, 30x (10 с при 98°C, 20 с при 55°C, 22 с/т.п.н. при 72°C), 5 мин 72°C.

1. Получение варианта AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS:

Проводили две реакции ПЦР с использованием праймеров TS-delRS-FW и pHPLT-HpaI-RV на синтетическом фрагменте ДНК 056426 и праймеров TS-delRS-RV и pHPLT-PstI-FW на синтетическом фрагменте ДНК 056426. Для слияния этих двух полученных фрагментов ДНК 1 мкл неочищенной смеси ПЦР из каждой реакционной смеси добавляли в третий образец для реакции ПЦР, в который были добавлены праймеры pHPLT-PstI-FW и pHPLT-HpaI-RV.

Амплифицированный линейный фрагмент ДНК размером 1,5 т.п.н. очищали (с использованием набора для очистки продуктов ПЦР Qiagen® Qiaquick PCR purification kit, каталожный № 28106) и расщепляли ферментами рестрикции PstI и HpaI. Затем как фрагмент ДНК AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS (также обозначаемой в настоящем документ как AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS), так и pHPLT pDNA (порядка 50 нг/мкл, расщепленный ферментами PstI и HpaI) очищали (с использованием набора для очистки продуктов ПЦР Qiagen® Qiaquick PCR, каталожный № 28106), а затем концы лигировали с помощью PstI и HpaI. Условия реакции представляют собой:

4 мкл очищенного продукта расщепления посредством PstI и HpaI фрагмента ДНК AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS, 2 мкл очищенного и расщепленного посредством PstI и HpaI фрагмента ДНК pHPLT, 8 мкл буфера для ДНК-лигазы T4 (Invitrogen, каталожный № 46300-018), 25 мкл дистилированной автоклавированной воды и 1 мкл ДНК-лигазы T4, 1 единица/мкл (Invitrogen, каталожный № 15224-017). Реакцию лигирования проводили в течение 16-20 часов при 20°С.

Затем лигированную смесь трансформировали в штамм B. subtilis (варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 aprE, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 nprE, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 epr, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 ispA, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 bpr) и (degUHy32, oppA, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 spoII3501, amyE::xylRPxylAcomK-ermC, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 vpr, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 wprA, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 mpr-ybfJ, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 nprB). Трансформацию в B. subtilis проводили, как описано в WO 02/14490. Трансформанты B. subtilis подвергали селекции на чашках с агаром, содержащих агар с сердечным настоем (Difco, каталожный № 244400) и 10 мг/л неомицина. Селективное выращивание трансформантов B. subtilis, содержащих вектор pHPLT-AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS, проводили во вращающихся флаконах, как описано в примере 1. Это выращивание приводило к продукции секретируемой амилазы AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS с активностью гидролиза крахмала, визуализируемой точечным нанесением культурального супернатанта на чашку с агаром с последующим окрашиванием иодом.

2. Получение AmyTS23t(M201L):

Выполняли тот же протокол, который описан для "получения AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS" за исключением первых двух реакций ПЦР.

Две реакции ПЦР проводили с использованием праймеров TS-M201L-FW и pHPLT-HpaI-RV для синтетического фрагмента ДНК 056426 и праймеров TS-M201L-RV и pHPLT-PstI-FW для синтетического фрагмента ДНК 056426.

3. Получение AmyTS23t(M201L)-RSdelete:

Выполняли тот же протокол, который описан для "получения AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS", за исключением первых двух реакций ПЦР.

Две реакции ПЦР проводили с использованием праймеров TS-delRS/M201L-FW и pHPLT-HpaI-RV для синтетического фрагмента ДНК 056426 и праймеров TS-delRS/M201L-RV и pHPLT-PstI-FW для синтетического фрагмента ДНК 056426.

ПРИМЕР 6

Повышенная стабильность AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS в детергенте

Стабильность AmyTS23t и AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS тестировали в ускоренном тесте стабильности при 37°C в буфере MOPS, инактивированном нагреванием Tide и прототипном детергенте (Prototype Formula A). Образцы ферментов инкубировали при 37°С в инактивированном нагреванием Tide или прототипном жидком детергенте (Prototype Formula A) и остаточную активность определяли при помощи анализа Megazyme. Результаты представлены на фиг.10. В присутствии любой из двух детергентных основ (Inactivated Tide или Prototype A detergent) только AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS является стабильным без каких-либо дополнительных добавок. Как представлено на фиг.10, AmyTS23t утрачивает основную часть его активности после первых суток и полностью утрачивает активность после 2 суток при ускоренном тестировании при 37°С. AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS является стабильным при тех же условиях и сохраняет приблизительно 90% исходной активности фермента после 17 суток.

Таблица 6-1
варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 Процент сохраненной активности фермента
Обработка Сутки 0Сутки 1 Сутки 2Сутки 3 Сутки 7Сутки 17
Инактивированный Tide + AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS100106 89,594,8 87,588,9
Инактивированный Tide + AmyTS23t100 0варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516
Инактивированный Tide + STZ100100 99,1100 96,588,3
Prototype Formula A + AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS10086,9 86,682,8 79,079,3
Prototype Formula A + AmyTS23t100 0варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516
Prototype Formula A + STZ 10086,5 88,786,577,7 78,2

ПРИМЕР 7

Окислительная стабильность AmyTS23 и мутантов AmyTS23

Амилазы варьируют с точки зрения их ответа на воздействие пероксиуксусной кислоты (PAA). Таким образом, этот пример был предназначен для определения окислительной стабильности амилаз AmyTS23 и мутантов AmyTS23. Условия приведены ниже:

Условия нагрузки Анализ Megazyme
30 мМ ферментБлокированный PNPG7
25 мМ борат, pH 8,65 25 мМ BTP/CaCl2, pH 6,9
1 мМ PAA, 40°C, 5 минкинетика: 40°C 45 мин
Гашение: 25 мМ BTP, pH 8,5варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516

Разведения ферментов приготавливали в 25 мМ боратном буфере, pH 8,64, 2 мМ Ca +2 путем обмена буфера на 1-мл вращающихся обессоливающихся колонках. К 25 мкл раствора фермента добавляли пероксиуксусную кислоту, содержащуюся в объеме 5 мкл, с получением от 0 до 1 мМ пероксиуксусной кислоты и образцы инкубировали в течение 5 минут при 40°С в устройстве для ПЦР (DNA Engine, BioRad). Реакционную смесь гасили с использованием 25 мМ BTP, pH 8,5. Остаточную активность амилазы измеряли с использованием стандартного набора для анализа амилазы от Megazyme (Wicklow, Ireland).

Как представлено на фиг.11, TS23t(M201L) обладает более чем 100% стабильностью при низких концентрациях PAA, а затем при более высоких концентрациях стабильность снижается. TS23t (M201L+варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS) обладает 25% повышением стабильности при низких концентрациях PAA, которая снижается до менее 100%, в конечном итоге сохраняя окислительную стабильность при более высоких концентрациях PAA. TS23t, TS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS, и Amy707 являются нестабильными в присутствии PAA со снижением стабильности при низких концентрациях до исходного уровня.

ПРИМЕР 8

Моющие характеристики в детергенте

Кривую "доза-эффект" выбранных концентраций AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS строили с использованием способа, описанного в разделе 5.12.1 данной патентной заявки. Оценку эффективности проводили как при 20°С, так и при 40°С с использованием Tergotometer. Те же условия использовали для построения кривых "доза-эффект" для Stainzyme и Stainzyme Plus. Как можно видеть из данных (фиг.12), AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS значительно превосходит оба продукта Stainzyme при 20°С и умеренно лучше их при 40°С. Эти данные указывают на уникальную пользу AmyTS23tварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 RS в качестве уникального высоко эффективного в холодной воде фермента.

ПРИМЕР 9

Продукция амилазы в B. subtilis

В этом примере описана продукция TS-23t Bacillus sp. и ее вариантов в B. subtilis. Трансформацию проводили, как известно в данной области (см., например, WO 02/14490). В кратком изложении ген, кодирующий исходные амилазы, клонировали в экспрессирующий вектор pHPLT, который содержит промотор LAT (PLAT), последовательность, кодирующую сигнальный пептид LAT (preLAT), а затем участки рестрикции PstI и HpaI.

Кодирующая область для сигнального пептида LAT представлена ниже:

atgaaacaacaaaaacggctttacgcccgattgctgacgctgttatttgcgctcatcttcttgctgcctcattctgcagcttcagca (SEQ ID NO:5).

Аминокислотная последовательность сигнального пептида LAT представлена ниже:

MKQQKRLYARLLTLLFALIFLLPHSAASA (SEQ ID NO:6).

Кодирующая область для зрелой амилазы AmyTS-23t представлена на фиг.4.

Аминокислотную последовательность зрелой варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы AmyTS-23t использовали в качестве основы для получения библиотек вариантов, описанных в настоящем документе, как показано на фиг.2.

Продукты ПЦР очищали с использованием колонок Qiaquik от Qiagen и ресуспендировали в 50 мкл деионизированной воды. 50 мкл очищенной ДНК расщепляли HpaI (Roche) и PstI (Roche) и полученную ДНК ресуспендировали в 30 мкл деионизированной воды. 10-20 нг/мкл ДНК клонировали в плазмиду pHPLT с использованием участков клонирования PstI и HpaI. Смеси после лигирования прямо трансформировали в компетентные клетки B. subtilis (генотип: варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 vpr, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 wprA, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 mpr-ybfJ, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 nprB). Клетки B. subtilis имеют ген компетентности (т.е. comK), который расположен ниже индуцируемого ксилозой промотора, так что для индукции компетентности для связывания и захвата ДНК использовали ксилозу (см. Hahn et al., Mol. Microbiol., 21: 763-775 [1996]).

Элементы плазмиды pHPLT-AmyS включают: pUB110 = фрагмент ДНК из плазмиды pUB110 (McKenzie et al., Plasmide 15: 93-103 [1986]). Основные признаки плазмиды включают: ori-pUB110 = ориджин репликации из pUB110; neo = ген устойчивости к неомицину из pUB110; Plat = промотор транскрипции из амилазы B. licheniformis; Pre-LAT = сигнальный пептид из амилазы B. licheniformis; SAMY 425ss = кодирующая область для укороченной последовательности гена AmyTS-23 (замененная кодирующими областями для каждого из укороченных вариантов AmyTS-23, экспрессированных в этом исследовании); и терминатор = терминатор транскрипции из амилазы B. licheniformis.

Экспрессия амилазы - масштаб 2 мл.

Клоны B. subtilis, содержащие экспрессирующие векторы AmyTS23t, реплицировали с помощью стального 96-луночного репликатора из глицериновых исходных культур в 96-луночных культуральных планшетах (BD, 353075), содержащих 150 мкл среды LB и 10 мкг/мл неомицина, выращенных при 37°C, 220 об/мин с увлажнением. Аликвоты ночной культуры объемом 100 мкл использовали для инокуляции 2000 мкл среды с определенным химическим составом и 10 мкг/мл неомицина в пластмассовых культуральных пробирках объемом 5 мл. Среда для культивирования представляла собой обогащенную среду с наполовину определенным химическим составом на основе буфера MOPS, с мочевиной в качестве основного источника азота, глюкозой в качестве основного источника углерода и дополненную 1% сойтоном и 5 мМ кальцием для активного роста клеток. Культуральные пробирки инкубировали при 37°С, 250 об/мин, в течение 72 часов. После этой инкубации культуральные бульоны центрифугировали в течение 10 минут при 3000×g. Раствор супернатанта сливали в 15 мл полипропиленовые конические пробирки и 80 мкл каждого образца разделяли на аликвоты в 96-луночные планшеты для количественного определения белка.

Получение комбинаторной библиотеки заряженных вариантов AmyTS23t Bacillus sp.

Несколько вариантов белка, охватывающих представляющий интерес диапазон физических свойств, отбирают из существующих библиотек или получают способами сайт-направленного мутагенеза, как известно в данной области (см., например, патентную заявку США с серийными № 10/576331, 11/581102 и 11/583334). Затем этот определенный набор образцов белков анализируют в представляющем интерес тесте.

AmyTS23t представляет собой укороченную форму варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы TS-23 Bacillus sp. (см. Lin et al., 1998, Production and properties of a raw-starch-degrading amylase from the thermophilic and alkaliphilic Bacillus sp. TS-23, Biotechnol. Appl. Biochem. 28: 61-68). Экспрессия AmyTS23t в штамме B. subtilis с несколькими удаленными протеазами (degU Hy32, oppA, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 spoII3501, amyE::xylRPxylAcomK-ermC, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 aprE, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 nprE, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 epr, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 ispA, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 bpr, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 vpr, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 wprA, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 mpr-ybfJ, варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 nprB) была такой, как описано в настоящем документе (см., например, US 2005/0202535A1). Плазмидную ДНК AmyTS23t, выделенную из трансформированных клеток B. Subtilis, отправляли в DNA2.0 Inc. (Menlo Park, CA) в качестве матрицы для конструирования CCL. Фирму DNA 2.0 просили приготовить исходную конструкцию для CCL путем внесения следующих семи мутаций в AmyTS23t, которую затем назвали AmyTS23t-7mut: Q98R, M201L, S243Q, R309A, Q320R, Q359E и K444E. Варианты были предоставлены в качестве исходных культур в глицерине в 96-луночных планшетах. Затем в DNA2.0 Inc. был сделан запрос на получение позиционных библиотек в каждом из четырех участков амилазы AmyTS23t-7mut, которые представлены в таблице 9-1.

Комбинаторную библиотеку заряженных вариантов AmyTS23t-7mut конструировали путем идентификации следующих четырех остатков в AmyTS23t-7mut: Gln 87, Asn 225, Asn 272 и Asn 282. 81-членный CCL с четырьмя участками создавали, получая все комбинации из трех возможных в каждом участке: дикий тип, аргинин или аспарагиновая кислота.

Таблица 9-1
Варианты CCL AmyTS23t-7mut
№ вариантаQ87 N225N272N282 Заряд A
Исходный 1-- --0
2Q87E N225EN272EN282E -4
3 Q87EN225EN272E N282R-2
4Q87E N225EN272E- -3
5 Q87EN225EN272R N282E-2
6Q87E N225EN272RN282R 0
7 Q87EN225EN272R --1
8Q87EN225E -N282E -3
9Q87E N225E- N282R-1
10Q87EN225E -- -2
11 Q87EN225RN272E N282E-2
12Q87E N225RN272EN282R 0
13 Q87EN225RN272E --1
14Q87EN225R N272RN282E 0
15Q87E N225RN272R N282R+2
16Q87EN225R N272R- +1
17 Q87EN225R- N282E-1
18Q87E N225R-N282R +1
19 Q87EN225R --0
20Q87E -N272EN282E -3
21 Q87E- N272EN282R-1
22Q87E -N272E --2
23 Q87E- N272RN282E-1
24Q87E -N272R N282R+1
25Q87E- N272R-0
26Q87E --N282E -2
27 Q87E-- N282R0
28Q87E- ---1
29Q87R N225EN272EN282E -2
30 Q87RN225E N272EN282R0
31Q87R N225EN272E --1
32 Q87RN225E N272RN282E0
33Q87R N225EN272R N282R+2
34Q87RN225E N272R- +1
35 Q87RN225E- N282E-1
36Q87R N225E-N282R +1
37 Q87RN225E --0
38Q87R N225RN272EN282E 0
39 Q87RN225RN272E N282R+2
40Q87R N225RN272E- +1
41 Q87RN225R N272RN282E+2
42Q87R N225RN272R N282R+4
43Q87RN225R N272R- +3
44 Q87RN225R- N282E+1
45Q87R N225R-N282R +3
46 Q87RN225R --+2
47Q87R -N272EN282E -1
48 Q87R- N272EN282R+1
49Q87R -N272E -0
50 Q87R- N272RN282E+1
51Q87R -N272R N282R+3
52Q87R- N272R-+2
53Q87R -- N282E0
54Q87R- -N282R+2
55Q87R -- -+1
56 -N225E N272EN282E-3
57- N225EN272EN282R -1
58 -N225E N272E--2
59- N225EN272RN282E -1
60 -N225E N272RN282R+1
61- N225EN272R- 0
62 -N225E- N282E-2
63-N225E -N282R 0
64- N225E- --1
65 -N225R N272EN282E-1
66- N225RN272EN282R +1
67 -N225R N272E-0
68- N225RN272RN282E +1
69 -N225R N272RN282R+3
70- N225RN272R- +2
71 -N225R -N282E0
72- N225R-N282R +2
73 -N225R --+1
74- -N272EN282E -2
75 -- N272EN282R0
76- -N272E- -1
77 --N272R N282E0
78-- N272RN282R+2
79- -N272R- +1
80 --- N282E-1
81-- -N282R+1

ПРИМЕР 10

Индекс эффективности

Анализ микрообразцов с рисовым крахмалом

Тестируемые детергенты получали, как описано в настоящем документе. Использованное оборудование включало устройство для встряхивания/инкубатор New Brunswick Innova 4230 и устройство для считывания микропланшетов для титрования (MTP) SpectraMAX (тип 340). MTP получали от Corning (тип 3641). Образцы ткани со старыми пятнами рисового крахмала с оранжевым пигментом (CS-28) получали от Center for Test Materials (Vlaardingen, Netherlands). Перед нарезанием 0,25-дюймовых круглых микрообразцов ткань промывали водой. Микрообразцы помещали в каждую лунку 96-луночного микропланшета для титрования. Тестируемый детергент уравновешивали при 20°С (североамериканский) или 40°С (восточноевропейский). 190 мкл раствора детергента добавляли в каждую лунку MTP, содержащую микрообразцы. К этой смеси добавляли 10 мкл разбавленного раствора фермента. MTP накрывали адгезивной фольгой и помещали в инкубатор на 1 час при встряхивании при 750 об/мин при требуемой температуре тестирования (как правило, 20°С или 40°С). После инкубации 150 мкл раствора из каждой лунки переносили в свежий MTP. Этот MTP подвергали считыванию при 488 нм с использованием устройства для считывания SpectraMax MTP для количественного определения очистки. Также были включены пустые контроли, а также контроли, содержащие микрообразцы и детергент, но не фермент.

Инактивация детергента нагреванием

Инактивация нагреванием коммерческих детергентных составов служит для уничтожения ферментативной активности любых белковых компонентов при сохранении свойств неферментативных компонентов. Таким образом, этот способ был пригоден для приготовления коммерчески приобретенных детергентов при тестировании вариантов ферментов. Для североамериканских (NA) и восточноевропейских (WE) усиленных жидких детергентов для стирки (HDL) инактивацию нагреванием проводили, помещая предварительно взвешенный жидкий детергент (в стеклянной бутылке) на водяную баню при 95°C в течение 2 часов. Время инкубации для инактивации нагреванием североамериканского (NA) и японского (JPN) усиленного гранулярного детергента для стирки (HDG) составляло 8 часов, а время инкубации для восточноевропейского (WE) детергента HDG составляло приблизительно 5 часов. Время инкубации для инактивации нагреванием NA и WE детергентов для автоматического мытья посуды (ADW) составляло приблизительно 8 часов. Детергенты приобретали в местных супермаркетах. Как не подвергнутые нагреванию, так и подвергнутые нагреванию детергенты анализировали при растворении детергента в течение 5 минут для точного определения процента дезактивированного детергента. Активность фермента тестировали в анализе AAPF с использованием 1 мг/мл AAPF (т.е. субстрата аланин-аланин-пролин-фенилаланина).

Для тестирования активности фермента в инактивированных нагреванием детергентах получали рабочие растворы детергентов из инактивированных нагреванием исходных материалов. Обеспечивали соответствующую жесткость воды (6 gpg или 12 gpg) в растворах детергентах и к ним добавляли буфер для того, чтобы они соответствовали требуемым условиям (таблица 10-1). Растворы смешивали встряхиванием или переворачиванием бутылей.

Таблица 10-1
Условия стирки и мытья посуды
РегионФорма ДозаДетергент* БуферGpg pHT(°C)
Стирка (усиленный жидкий и гранулярный)
NAHDL0,78 г/л P&G TIDE® 2X 5 мМ HEPES68,0 20
WE HDL5,0 г/л Henkel Persil5 мМ HEPES 128,240
WEHDG 8,0 г/лP&G Ariel 2 мМ Na2CO312 10,540
JPNHDG 0,7 г/лP&G TIDE® 2 мМ Na2CO36 10,020
NAHDG 1,0 г/лP&G TIDE® 2 мМ Na2CO36 10,020
Automatic Dishwashinq
WEADW 3,0 г/лRB Calgonit 2 мМ Na2CO321 10,040
NAADW 3,0 г/лP&G Cascade 2 мМ Na2CO39 10,040
* Сокращения: Proctor & Gamble (P&G); и Reckitt Benckiser (RB).

Вычисление эффективности фермента

Полученную величину поглощения корректировали по значению пустого образца (т.е. полученному после инкубации микрообразцов в отсутствие фермента). Полученное поглощение было показателем гидролитической активности. Результаты представлены в таблицах 10-2 и 10-3. Эффективность фермента оценивали с использованием инактивированных нагреванием детергентов, как описано выше. Наилучшие ферменты определяли как ферменты, имеющие индекс эффективности (PI) более 1. PI представляет собой отношение остаточной активности мутанта к остаточной активности WT.

Таблица 10-2
TS23t-7mut CCL - наилучшие ферменты для микрообразцов тканей с рисовым крахмалом CS-28, Tide 2x
№ варианта87 225272282 Относительный заряд PI
11 Q87EN225RN272E N282E-2 1,24
12 Q87EN225RN272E N282R0 1,20
13 Q87EN225RN272E варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -11,16
14Q87E N225RN272R N282E01,15
17Q87E N225Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E-1 1,34
18 Q87EN225R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282R1 1,26
19 Q87EN225R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 01,34
20Q87E варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272EN282E -31,17
21Q87E варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272EN282R -11,34
22Q87E варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272Eварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -21,13
27Q87E варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282R0 1,22
28 Q87Eварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -11,22
29Q87R N225EN272E N282E-21,44
30Q87R N225EN272E N282R01,15
31Q87R N225EN272E варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -11,36
35Q87R N225Eварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E-1 1,15
40 Q87RN225R N272Eварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 11,27
44Q87R N225Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E1 1,38
45 Q87RN225R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282R3 1,21
47 Q87Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272EN282E -11,65
48Q87R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272EN282R 11,52
49Q87R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272Eварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 01,28
50Q87R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272RN282E 11,10
53Q87R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E0 1,47
54 Q87Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282R2 1,25
55 Q87Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 11,51
64варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N225Eварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -11,15
65варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N225RN272E N282E-1 1,26
66 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N225RN272E N282R1 1,22
67 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N225RN272E варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 01,19
74варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272EN282E -21,21
76варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272Eварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -11,13
80варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E-1 1,27
81 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282R1 1,49

Таблица 10-3
TS-23t-7mut CCL - наилучшие ферменты для микрообразцов тканей с рисовым крахмалом CS-28, Percil
№ варианта87 225272 282Относительный заряд PI
4Q87EN225E N272E0 -3 1,13
6 Q87EN225E N272RN282R 01,11
9Q87EN225E варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282R -11,20
10Q87EN225E варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 0 -21,17
11Q87EN225R N272EN282E -2 1,41
13 Q87EN225R N272E0 -11,40
14Q87EN225R N272RN282E 0 1,28
15 Q87EN225R N272RN282R 21,13
16Q87EN225R N272R0 1 1,17
17 Q87EN225R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E -11,51
18Q87EN225R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282R 11,47
19Q87EN225R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 0 01,48
20Q87Eварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272E N282E-3 1,46
21 Q87Eварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272E N282R-1 1,40
22 Q87Eварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272E 0-2 1,42
25 Q87Eварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272R 00 1,18
26 Q87Eварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E -21,54
27Q87Eварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282R 01,47
28Q87Eварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 0 -11,40
29Q87RN225E N272EN282E -2 1,46
30 Q87RN225E N272EN282R 01,59
31Q87RN225E N272E0 -11,14
34Q87R N225EN272R 01 1,29
35 Q87RN225Eварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E -11,47
36Q87RN225E варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282R 11,62
37Q87RN225E варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 0 01,53
38Q87RN225R N272EN282E 01,13
39Q87R N225RN272E N282R2 1,13
40 Q87RN225RN272E 01 1,17
41Q87RN225R N272RN282E 21,31
44Q87R N225Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E 11,26
47Q87Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272E N282E-1 1,45
48 Q87Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272E N282R1 1,50
49 Q87Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272E 00 1,17
50 Q87Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272R N282E1 1,16
53 Q87Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E 01,21
54Q87Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282R 21,30
55Q87Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 0 11,33
56варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N225EN272E N282E-3 1,29
57варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N225EN272E N282R-1 1,12
58варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N225EN272E 0-2 1,41
59варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N225EN272R N282E-1 1,16
61варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N225EN272R 00 1,20
66варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N225RN272E N282R1 1,27
67варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N225RN272E 00 1,34
71варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N225Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E 01,17
73варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N225Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 0 11,12
74варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272E N282E-2 1,29
75 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272E N282R0 1,24
76 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272E 0-1 1,20
78 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272R N282R2 1,18
79 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272R 01 1,11
80 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E -11,11
81варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282R 11,33

ПРИМЕР 11

Комбинированная устойчивость к LAS/хелатирующим агентам

В этом примере описано определение взаимосвязи между зарядом белка и стабильностью в реакционной среде, содержащей анионное поверхностно-активное вещество и хелатирующий агент. Устойчивость к LAS измеряли после инкубации тестируемых амилаз в присутствии 0,1% LAS (додецилбензолсульфоната натрия) и 10 мМ EDTA путем измерения остаточной активности в анализе BODIPY в соответствии со способами, описанными выше. Для определения активности варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 -амилазы в образцах с нагрузкой и без нагрузки использовали анализ BODIPY-крахмал. Остаточные LAS и EDTA из планшетов с нагрузкой не влияют на анализы BODIPY-крахмал.

Использованные реагенты включали: контрольный буфер (50 мМ HEPES, 0,005% Tween-80, pH 8,0) и буфер с нагрузкой (50 мМ HEPES, 0,1% (масс./об.) LAS (додецилбензолсульфонат, натриевая соль, Sigma D-2525), 10 мМ EDTA, pH 8,0). Варианты фермента (20 ч./млн) разбавляли 1:20 в 96-луночном несвязывающем планшете с плоским дном, содержащем либо контрольный буфер, либо буфер с нагрузкой, и перемешивали. Контрольный планшет инкубировали при комнатной температуре, а планшет с нагрузкой сразу помещали на 37°C в течение 30-60 мин (в зависимости от стабильности тестируемого фермента). После инкубации измеряли активность фермента с использованием анализа BODIPY-крахмал для амилаз. Фракция остающейся или остаточной активности равна скорости реакции образца с нагрузкой, деленной на скорость реакции контрольного образца. Исходные ферменты и варианты являются стабильными в течение 60 мин в контрольном буфере.

В таблице 11-1 представлены данные для этих вариантов, имеющих повышенную устойчивость к LAS/EDTA в качестве функции суммарного изменения заряда относительно TS-23t-7mut дикого типа для библиотеки, содержащей 80 вариантов. Эту библиотеку разрабатывали и конструировали в соответствии со способами, описанными в примере 2, чтобы она охватывала несколько суммарных зарядов относительно исходной молекулы TS-23t-7mut. Индекс эффективности (PI), превышающий 1, указывает на то, что вариант обладает более высокой удельной активностью, чем исходный S242Q, на этом крахмальном субстрате (т.е. кукурузном крахмале).

Таблица 11-1
TS23t-7mut CCL - наилучшие варианты, устойчивые к LAS/EDTA
№ варианта87 225272282 ЗарядОстаточная активность мутанта/остаточная активность дикого типа (PI))
2Q87E N225EN272EN282E -41,39
5Q87E N225EN272RN282E -21,51
8Q87E N225Eварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E-3 1,29
11 Q87EN225R N272EN282E-2 1,38
14 Q87EN225R N272RN282E0 1,64
17 Q87EN225R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E-1 1,39
20 Q87Eварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272EN282E -31,39
23Q87E варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272RN282E -11,65
26Q87E варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E-2 1,41
29 Q87RN225E N272EN282E-2 2,02
31 Q87RN225E N272E0-1 1,39
32 Q87RN225E N272RN282E0 2,21
33 Q87RN225E N272RN282R2 1,29
34 Q87RN225E N272R01 1,47
35 Q87RN225Eварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E-1 2,08
37 Q87RN225E варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 00 1,41
38 Q87RN225R N272EN282E0 1,85
40 Q87RN225R N272E01 1,38
41 Q87RN225RN272R N282E2 2,15
43 Q87RN225RN272R 03 1,63
44 Q87RN225Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E1 2,33
46 Q87RN225R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 02 1,62
47 Q87Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272EN282E -12,38
48Q87R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272EN282R 11,24
49Q87R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272E0 01,53
50Q87R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272RN282E 12,14
51Q87R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272RN282R 31,25
52Q87R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272R0 21,60
53Q87R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E0 2,27
54 Q87Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282R2 1,34
55 Q87Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 01 1,62
56 0N225E N272EN282E-3 1,69
59 0N225E N272RN282E-1 1,77
62 0N225E варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E-2 1,50
65 0N225R N272EN282E-1 1,66
67 0N225R N272E00 1,24
68 0N225RN272R N282E1 1,80
70 0N225RN272R 02 1,25
71 0N225Rварианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E0 1,48
73 0N225R варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 01 1,29
74 0варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272EN282E -21,54
770 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N272RN282E 01,78
800 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 варианты альфа-амилазы ts-23 с измененными свойствами, патент № 2526516 N282E-1 1,52

Для ASP (кислая сериновая протеаза) и FNA (другая протеаза) существует зависимость от заряда для устойчивости к LAS/EDTA (См. WO/2008/153925, поданную 6 июня 2008 года, имеющую номер в реестре поверенного Genencor No 30974 WO-2). Добавление отрицательного заряда приводит к повышению стабильности. Однако даже в случае более положительного варианта на один или два заряда, чем исходная форма, можно найти способом авторов изобретения расположение мутаций с изменением заряда, которое обеспечивает равную или большую устойчивость, чем у исходной формы. Этот подход также эффективен в более крупных ферментах, таких как TS23t', представленный на фиг.13, где неблагоприятный эффект добавления положительных зарядов на стабильность может быть компенсирован оптимальным расположением зарядов, которое приводит к повышению устойчивости.

Все публикации и патенты, упомянутые выше, включены в настоящий документ в виде ссылок для любых целей. Специалистам в данной области будут понятны различные модификации и варианты описанных способов и системы без отклонения от объема и сущности изобретения. Несмотря на то что изобретение описано в связи с конкретными предпочтительными вариантами осуществления, следует понимать, что заявленные варианты осуществления не должны чрезмерно ограничиваться конкретными примерами. Действительно, подразумевается, что различные модификации описанных способов осуществления вариантов осуществления и аспектов, которые понятны специалистам в данной области, находятся в объеме представленной ниже формулы изобретения.

ФОРМУЛА ИЗОБРЕТЕНИЯ

1. Вариант исходной альфа-амилазы AmyTS23, имеющий альфа-амилазную активность, где указанный вариант имеет укорочение С-конца и аминокислотную последовательность, которая обладает по меньшей мере 90% идентичностью с аминокислотной последовательностью SEQ ID NO:2, и содержит мутацию S243Q и делецию остатков R180 и S181, где исходная альфа-амилаза имеет аминокислотную последовательность SEQ ID NO:1 и где нумерация указанных аминокислотных остатков представлена относительно SEQ ID NO:1.

2. Вариант исходной альфа-амилазы AmyTS23 по п.1, где вариант обладает по меньшей мере 95% идентичностью с аминокислотной последовательностью SEQ ID NO:2.

3. Вариант исходной альфа-амилазы AmyTS23 по п.1, где вариант обладает повышенной активностью очистки пятен крахмала в холодной воде по сравнению с исходной амилазой.

4. Вариант исходной альфа-амилазы AmyTS23 по п.1, где вариант обладает повышенной детергентной стабильностью по сравнению с исходной амилазой.

5. Вариант исходной альфа-амилазы AmyTS23 по п.1, дополнительно содержащий замену остатка в положении 201, где положение аминокислотного остатка относится к аминокислотной последовательности SEQ ID NO:1.

6. Вариант исходной альфа-амилазы AmyTS23 по п.5, где вариант обладает повышенной окислительной стабильностью по сравнению с исходной амилазой.

7. Вариант исходной альфа-амилазы AmyTS23 по п.5, где замена представляет собой M201L.

8. Вариант исходной альфа-амилазы AmyTS23 по п.1, дополнительно содержащий замену одного или нескольких остатков, выбранных из группы, состоящей из остатка 87, остатка 225, остатка 272 и остатка 282.

9. Нуклеиновая кислота, кодирующая вариант по любому из пп.1-8.

10. Экспрессирующий вектор, содержащий нуклеиновую кислоту по п.9 под контролем пригодного промотора.

11. Клетка-хозяин для продукции варианта альфа-амилазы AmyTS23 по любому из пп.1-8, содержащая экспрессирующий вектор по п.10.

12. Композиция для ручного или автоматического мытья посуды, содержащая вариант по любому из пп.1-8 и один или несколько из: поверхностно-активного вещества, моющего детергентного компонента, комплексообразующего вещества, полимера, системы для отбеливания, стабилизатора, пенообразователя, пеногасителя, антикоррозионного вещества, суспендирующего грязь вещества, вещества против повторного осаждения грязи, красителя, бактерицидного вещества, гидротропного вещества, ингибитора потускнения и отдушки.

13. Детергентная добавка для стирки, содержащая вариант по любому из пп.1-8 и одно или несколько из: поверхностно-активного вещества, моющего детергентного компонента, комплексообразующего вещества, полимера, системы для отбеливания, стабилизатора, пенообразователя, пеногасителя, антикоррозионного вещества, суспендирующего грязь вещества, вещества против повторного осаждения грязи, красителя, бактерицидного вещества, гидротропного вещества, оптического отбеливателя, кондиционера для ткани и отдушки.

14. Способ удаления крахмала из ткани, включающий инкубацию ткани в присутствии варианта исходной альфа-амилазы AmyTS23 по любому из пп.1-8 и где указанная инкубация приводит к удалению крахмала из ткани.

15. Способ переработки крахмала, включающий инкубацию ткани в присутствии варианта исходной альфа-амилазы AmyTS23 по любому из пп.1-8 и где указанная инкубация приводит к гидролизу указанного крахмала.


Скачать патент РФ Официальная публикация
патента РФ № 2526516

patent-2526516.pdf
Патентный поиск по классам МПК-8:

Класс C12N9/28 альфа-амилаза микробного происхождения, например бактериальная амилаза

Патенты РФ в классе C12N9/28:
варианты альфа-амилазы с измененными свойствами -  патент 2499044 (20.11.2013)
штамм дрожжей saccharomyces cerevisiae, обладающий амилазной активностью для получения кормового белкового продукта, и способ производства кормового белкового продукта -  патент 2478701 (10.04.2013)
варианты альфа-амилазы bacillus licheniformis с повышенной термостабильностью и/или сниженной кальциевой зависимостью -  патент 2469087 (10.12.2012)
композиции на основе полипептида -амилазы из bacillus, вид 195, и их применение -  патент 2459867 (27.08.2012)
штамм bacillus amyloliquefaciens - продуцент альфа-амилазы bacillus amyloliquefaciens -  патент 2455352 (10.07.2012)
штамм мицелиального гриба aspergillus oryzae - продуцент кислой альфа-амилазы -  патент 2354697 (10.05.2009)
штамм бактерий bacillus licheniformis вкм в-2396 d - продуцент термостабильной альфа-амилазы -  патент 2324734 (20.05.2008)
вариант мальтогенной -амилазы -  патент 2258739 (20.08.2005)
варианты альфа-амилазы -  патент 2231547 (27.06.2004)
способ изготовления выпечного продукта (варианты), выпечной продукт (варианты), применение немальтогенной экзоамилазы, улучшающая композиция для теста и тесто для выпечного продукта -  патент 2225118 (10.03.2004)


Наверх