способ прогнозирования риска возникновения переломов

Классы МПК:G01N33/50 химический анализ биологических материалов, например крови, мочи; испытания, основанные на способах связывания биоспецифических лигандов; иммунологические испытания
Автор(ы):, , , , ,
Патентообладатель(и):Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования "Башкирский государственный университет" (RU),
Общество с ограниченной ответственностью "Академические инновационные технологии" (RU),
Федеральное государственное бюджетное учреждение науки "Институт биохимии и генетики Уфимского научного центра Российской академии наук (RU)
Приоритеты:
подача заявки:
2012-09-24
публикация патента:

Изобретение относится к медицине. Способ прогнозирования риска возникновения переломов заключается в том, что выделяют ДНК из лейкоцитов периферической венозной крови, методом полимеразной цепной реакции с флуоресцентной детекцией, генотипируют 3 полиморфных варианта -1997G>T (g.3011T>G, rs1107946), -1663IndelT (g.3344_3345delTT, rs2412298) и +1245G>T (c.104-441G>T (rs1800012), расположенных в регуляторном регионе гена COLIA1. При идентификации сочетания генотипов: 1997способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T/-1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 D/ +1245способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T прогнозируют категорию лиц с повышенным риском развития возникновения переломов. Использование заявленного способа позволяет получить критерии оценки риска возникновения переломов с высокой прогностической значимостью. 1 табл., 3 пр.

Формула изобретения

Способ прогнозирования риска возникновения переломов, заключающийся в том, что выделяют ДНК из лейкоцитов периферической венозной крови, методом полимеразной цепной реакции с флуоресцентной детекцией, генотипируют 3 полиморфных варианта -1997G>T (g.3011T>G, rs1107946), -1663IndelT (g.3344_345delTT, rs2412298) и +1245G>T (c.104-441G>T (rs1800012), расположенных в регуляторном регионе гена COLIA1 и при идентификации сочетания генотипов: -1997способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T/-1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 D/ +1245способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T прогнозируют категорию лиц с повышенным риском возникновения переломов.

Описание изобретения к патенту

Изобретение относится к медицине и биологии и может быть использовано для прогнозирования риска возникновения переломов.

Переломы вследствие нарушения костного метаболизма являются тяжелой медицинской и социальной проблемой и приводят к значительному снижению качества жизни. Основной причиной переломов являются нарушения в функции коллагена I типа - основного структурного белка костной ткани. Коллаген I типа состоит из 3-х полипептидных способ прогнозирования риска возникновения переломов, патент № 2526189 -цепей: 2-х способ прогнозирования риска возникновения переломов, патент № 2526189 1 (I) и одной способ прогнозирования риска возникновения переломов, патент № 2526189 2 (I) и кодируется генами COLIA1 и COLIA2 [Barnes A.M., Chang W., Morello R., Cabral W.A., Weis M., Eyre D.R., Leikin S. et al. Deficiency of Cartilage-Associated Protein in Recessive Lethal Osteogenesis Imperfecta // N Engl J Med. - 2006. - Vol.355. - P.2757-64; Witecka J., Auguoeciak-Duma A.M., Kruczek A., Szydlo A. Two novel COLIA1 mutations in patients with osteogenesis imperfecta (OI) affect the stability of the collagen type I triple-helix // J Appl Genet. - 2008. - Vol.49(3). - P.283-295].

Мутации в генах коллагена 1 типа вызывают тяжелое наследственное заболевание - несовершенный остеогенез (HO), основным клиническим признаком которого являются множественные переломы костей у детей с раннего возраста, а полиморфные варианты этого гена ассоциированы с развитием остеопороза, который также сопровождается переломами у взрослых и пожилых людей. HO встречается с частотой от 1:10000 до 1:30000 новорожденных в различных странах мира, тяжесть заболевания варьирует от легкой (HO 1 тип) до внутриутробной летальной (НО 2 тип) и приводит к инвалидности детей с раннего возраста [Bodian D.L., Chan T-F., Poon A., Schwarze U., Yang K., Byers P.H., Kwok P-Y., Klein Т.Е. Mutation and Polymorphism spectrum in OI type II: implication for genotype-phenotype relatioships // HMG. - 2009. - Vol.18. - P.463-471; Zhang Y.Y., Lei S.F., Mo X.Y., Wang Y.B., Li M.X., Deng H.W. The - 1997 G/T polymorphism in the COLIA1 upstream regulatory region is associated with hip bone mineral density (BMD) in Chinese nuclear families // Calcif. Tissue Int. -2005. - Vol.76. - P.107-112; Swinnen F.K., De Leenheer E.M., Coucke P.J. et al. Audiometric, surgical, and genetic findings in 15 ears of patients with osteogenesis imperfect // Laryngoscope. - 2009. - V.119(6). - P.1171-1179]. Остеопороз по данным Всемирной Организации Здравоохранения (ВОЗ) по частоте и причинам инвалидности и смертности больных занимает четвертое место после таких заболеваний, как сердечно-сосудистые, онкологические и сахарный диабет. Показано, что риск возникновения остеопоретических переломов - на 50-60% обусловлен генетическими факторами [Ralston SH, Uitterlinden AG, Brandi ML, Balcells S, Langdahl BL, et al. Large-scale evidence for the effect of the COLIA1 SpI polymorphism on osteoporosis outcomes: The GENOMOS Study // PloS Med. 2006. Vol.3. № 4. P.515-523; Ralston, S.H. Genetic determinants of susceptibility to osteoporosis / S.H. Ralston // Curr. Opin. Pharmacol. - 2003. - Vol.3, № 3. - P.286-290].

Ввиду высокой распространенности переломов, значительной смертности от осложнений болезни и инвалидности при остеопорозе и несовершенном остеогенезе прогнозирование возникновения переломов, а также пресимптоматическая и пренатальная диагностика с целью предотвращения рождения больных детей в отягощенных семьях с НО является важной социальной и медицинской задачей.

Научная новизна предлагаемой разработки заключается в создании новой технологии тест-системы, позволяющей с высокой точностью прогнозировать риск возникновения переломов, доступной для всех слоев населения, вне зависимости от возраста. Основными характеристиками разработки являются высокая эффективность метода и экономическая выгода для населения. Преимущества перед существующими аналогами заключаются в оптимальности разрабатываемых подходов ДНК-диагностики заболеваний, основанных на выявлении существующих структурных особенностей генофонда народов Волго-Уральского региона, а также в высоко чувствительном, надежном и быстром методе, позволяющем прогнозировать риск возникновения переломов у индивидуумов с наследственной предрасположенностью к остеопорозу и семейной отягощенностью по HO.

Существуют аналоги определения риска развития остеопороза, которые основаны на диагностике и терапевтическом лечении остеопороза, а также на определении носителей гаплотипа и генотипа гена интерлейкина 1 (IL-1) [патент US 20090023147, опубл. 22.01.2009; патент US 20100255475, опубл. 07.10.2010; патент US 20050084882, опубл. 21.04.2005].

Известны методы диагностики с наборами реагентов (праймеры, киты и биочипы), направленные на определение предрасположенности к остеопорозу, основанные на анализе ассоциаций полиморфных вариантов нуклеиновой кислоты, изложенные в SEQ ID NO:1 [патент US 20050221306, опубл.06.10.2005].

Получен американский патент на диагностику остеопороза или предрасположенность к остеопорозу, основанный на использовании определенных генетических маркеров, ассоциированных с геномным регионом, локализованном на 20 хромосоме, который определяет экспрессию морфогенетического белка кости человека - BMP2. Генетические маркеры могут быть определены на уровне нуклеиновых кислот, например, прямым секвенированием или аминокислотном уровне с использованием иммунологического анализа, основанного на антителах, которые узнают белок BMP2, если генетические маркеры затрагивают кодирующую последовательность BMP2 [патент US 20060057612, опубл. 16.03.2006].

Известен способ диагностики развития системного остеопороза у мужчин, основанный на выявлении фенотипических признаков. Изобретение относится к области медицины и предлагается для быстрого выявления лиц мужского пола старше 50 лет с высоким риском развития системного остеопороза или с его наличием, для их дальнейшего обследования и лечения [патент РФ № 2398509, кл. A61B 5/107, A61B 10/00, опубл. 10.09.2010].

Существует способ диагностики развития остеопороза у женщин с первичным гипотериозом, включающий выявление факторов риска развития остеопороза на основе определения тиреотропных гормонов [патент РФ № 2270612, кл. A61B 10/00, опубл. 27.02.2006].

Известен способ прогнозирования остеопороза у женщин постменопаузального возраста путем вычисления прогностического индекса F1 на основании возраста, длительности менопаузы, наличия резекции яичников и значения индекса массы тела [патент РФ № 2381751, кл. A61B 10/00, опубл. 20.02.2010].

Все эти методы позволяют повысить эффективность и целенаправленность профилактических и лечебных мероприятий в группах с высоким риском развития переломов.

Существует набор для диагностики, предотвращения развития остеопороза, основанный на ассоциации локуса CNR2, кодирующего белок каннабиноидного рецептора 2, с остеопорозом. Изобретение предлагает методы и наборы для определения предрасположенности к остеопорозу, улучшает диагностику заболевания у индивидуумов с подозрением на остеопороз [патент US 20050260608, опубл. 24.11.2005].

Разработан отечественный диагностический набор «ОстеоГЕН-М» производства группы компаний Алкор Био, предназначенный для диагностики генетической предрасположенности к остеопорозу, получивший регистрационное удостоверение Росздравнадзора, который основан на определении полиморфного варианта +1245G>T гена COLIA1 и TagI полиморфного варианта гена VDR методом мультиплексной полимеразной цепной реакции ( № ФСР 2010/09538).

Таким образом, патенты, которые направлены на диагностику риска развития возникновения переломов на основе генетических технологий на российском и зарубежных рынках, единичны и основаны на трудоемких методах диагностики и, как правило, ориентированы на определенную категорию населения (к примеру, на группу лиц, старше 50 лет или только на определенную гендерную принадлежность). Кроме того, следует отметить, что существующие патенты основаны на исследовании лишь одного локуса кандидатного гена, не учитывающие сочетания генотипов сразу по нескольким полиморфным вариантам одного гена, которые имеют большее прогностическое значение для определения риска развития переломов.

Технической задачей предлагаемого изобретения является разработка способа прогнозирования риска возникновения переломов с помощью прогностической модели, основанной на результатах исследования трех локусов кандидатного гена - COLIA1.

Технический результат изобретения - получение критериев оценки риска возникновения переломов с высокой прогностической значимостью.

Указанный технический результат достигается тем, что выделяют ДНК из лейкоцитов периферической венозной крови, методом полимеразной цепной реакции с флуоресцентной детекцией, генотипируют 3 полиморфных варианта -1997G>T (g.3011T>G, rs1107946), -1663IndelT (g.3344_3345delTT, rs2412298) и +1245G>T (c.104-441G>T (rs1800012), расположенных в регуляторном регионе гена COLIA1 и при идентификации сочетания генотипов: -1997способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T/-1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 D/+1245способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T прогнозируют категорию лиц с повышенным риском развития возникновения переломов.

Способ реализуется следующим образом: выделяют ДНК методом последовательной фенольно-хлороформной экстракции по Мэтью из цельной венозной крови [Mathew С.С. The isolation of high molecular weight eucariotic DNA // methods in molecular biology / ED. Walker J.M. - N.Y.: Haman press. - 1984. - P.31-34]. В пробирку с предварительно добавленными 2 мл консерванта (глюгицир) набирали 8 мл крови (соотношение консерванта и крови 1:4) и хорошо перемешивали. Хранение осуществляли при 4°C не более двух недель. Для выделения геномной ДНК к 8-10 мл крови добавляли 50 мл лизирующего буфера, содержащего 320 мМ сахарозы, 1% тритон X-100, 5 мМ MgCl2, 10 мМ трис-HCl, pH 7,6. Полученную смесь перемешивали и центрифугировали при 4°C, 4000 об/мин в течение 20 минут. Надосадочную жидкость сливали, к осадку добавляли 8 мл раствора, содержащего 25 мМ ЭДТА, pH 8,0 и 75 мМ NaCl, ресуспензировали, добавляли 0,8 мл 10% SDS, 50 мкл протеиназы K (10 мг/мл) и инкубировали образец при 37°C в течение 16 часов. Экстракцию ДНК проводили равными объемами фенола, фенол-хлороформа (1:1) и хлороформа с центрифугированием при 4000 об/мин в течение 10 минут и отбором водной фазы после каждого этапа. ДНК осаждали из раствора 2-3 мл охлажденного 96% этанола (преципитация). Осажденную ДНК растворяли в деионизированной воде и хранили при -20°C.

Исследование полиморфных вариантов -1997G>T, -1663indelT и +1245G>T гена COLIA1 может осуществляться с помощью разнообразных молекулярно-генетических подходов: анализа полиморфного варианта длин рестрикционных фрагментов после полимеразной цепной реакции (ПЦР-ПДРФ), ПЦР с использованием аллель-специфичных праймеров, ПЦР в реальном времени, анализ конформации одноцепочечных фрагментов ДНК (SSCP), с применением биочипов и секвенирования.

Предлагается метод определения маркеров повышенного риска развития переломов с помощью метода ПЦР в режиме реального времени, который считается существенно более чувствительным и качественным по чистоте работы. Преимущества флуоресцентной детекции по сравнению с обычными методами: сокращение времени анализа до 1-2 часов; меньшая стоимость в расчете на одну пробу; более высокая воспроизводимость и надежность результатов; удобный формат поставки "в одной пробирке".

Наборы с флуоресцентной детекцией результатов ПЦР позволяют обходиться без этапов рестрикции и электрофореза и регистрировать результаты амплификации с помощью амплификатора в реальном времени, не открывая пробирку с амплификационной смесью, сводя к минимуму риск контаминации и резко сокращая время и трудоемкость проведения анализа.

Интерпретация результатов проводится с помощью программных средств реал-тайм амплификатора (Allelic Discrimination) в автоматическом режиме.

Для проведения амплификации и флуоресцентной детекции требуется амплификатор с возможностью проведения анализа флуоресценции по конечной точке (Endpoint Analysis, Allelic Discrimation и т.д.) - «Rotor-Gene» 3000/6000 («Corbett Research)), Австралия); «iQ iCycler», «iQ5», «CFX96» («BioRad», США), ABI 7300/7500/7900 («Applied Biosystems», США) или аналогичные. Прибор должен позволять использование красителей со следующими длинами волн поглощения/испускания (нм):

FAM/GreenEx495 Em520

VIC/HEX/JOE/R6G/Yellow Ex535Em556

После перемешивания смесь разливается по амплификационным пробиркам/плашкам, после чего в них добавляются исследуемые образцы ДНК и проводится амплификация согласно программе:

первая денатурация 95°C - 2:00

40 циклов 94°C - 0:10

отжиг - 1:00

При необходимости проведения ПЦР в реальном времени измерение сигнала флуоресценции следует проводить на втором этапе реакции.

После проведения амплификации необходимо провести детекцию флуоресценции «по конечной точке» согласно протоколу используемого прибора.

Диагностическую чувствительность и специфичность тест-системы определяли на выборке заранее охарактеризованных методом секвенирования образцов, как минимум по 100 образцов на тест-систему (но с обнаружением не менее одного генотипа каждого вида). Показана 100% диагностическая чувствительность и специфичность (все генотипы, определенные при помощи ПЦР-тест-системы, совпали с генотипами, определенными при помощи секвенирования и ПЦР-ПДРФ анализа).

Критерии предлагаемого способа оценки риска развития переломов были разработаны на основании анализа данных молекулярно-генетических исследований больных с переломами, среди которых 41 больных с установленным клиническим диагнозом «несовершенный остеогенез» из 33 семей из Республики Башкортостан и 70 их родственников (в качестве контроля для больных НО была использована выборка, состоящая из 50 здоровых индивидов с нормальным уровнем минеральной плотности костной ткани (МПКТ), а также 447 женщин в возрасте от 48 до 77 лет, среди них: русские - 372 женщины (175 с переломами, 197 без переломов), татары - 105 (42 с переломами и 63 без переломов). В группу с переломами вошли женщины с наличием низкотравматичных переломов (возникающих при падении с высоты собственного тела, при незначительной нагрузке или без видимых причин), произошедших в постменопаузе. Все переломы были подтверждены рентгенологически. Для популяционных исследований использованы выборки, состоящие из неродственных жителей Волго-Уральского региона русской (106 человек), татарской (80 человек) и башкирской этнической принадлежности (113 человек).

Генотипирование образцов проводилось с помощью полимеразной цепной реакции (ПЦР) в реальном времени с флуоресцентной детекцией. Нами сконструированы праймеры и зонды, последовательность которых представлена в таблице 1. Математическую обработку результатов проводили с использованием пакета программ: MS Office Excel 2003 (Microsoft). При попарном сравнении частот аллелей и генотипов в группах больных и контроля использовали критерий способ прогнозирования риска возникновения переломов, патент № 2526189 2 (p) для таблиц сопряженности 2×2 с поправкой Иэйтса на непрерывность [http://www.biometrica.tomsk.ru/]. Силу ассоциаций оценивали в значениях показателя соотношения шансов Odds Ratio (OR).

Был проведен анализ распределения частот аллелей и генотипов полиморфных локусов -1997G>T, -1663indelT и +1245G>T гена COLIA1 в трех этнических группах Волго-Уральского региона. Преобладающим в изученных популяциях был генотип -1997способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 G, частота которого варьировала от 52,2% у татар до 68,5% у русских. Генотип -1997способ прогнозирования риска возникновения переломов, патент № 2526189 Tспособ прогнозирования риска возникновения переломов, патент № 2526189 T встречался с частотой 3,7% у башкир, 2,7% у русских и 2,2% у татар, различия в распределении частот генотипов статистически незначимы (способ прогнозирования риска возникновения переломов, патент № 2526189 2=3,93; p=0,41). В европейских популяциях частота генотипа -1997способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 G составила 76% у испанцев и 75,9% у голландцев, тогда как у китайцев отмечается снижение частоты генотипа -1997способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 G до 38,9%. Частота генотипа -1997способ прогнозирования риска возникновения переломов, патент № 2526189 Tспособ прогнозирования риска возникновения переломов, патент № 2526189 T составила 2% у испанцев, 1,6% у голландцев и 11,2% у китайцев. По распределению частот генотипов -1997G>T полиморфного варианта татары и башкиры отличались от испанцев (способ прогнозирования риска возникновения переломов, патент № 2526189 2=10,59; p=0,005 и способ прогнозирования риска возникновения переломов, патент № 2526189 2=7,1; p=0,028, соответственно), голландцев (способ прогнозирования риска возникновения переломов, патент № 2526189 2=11,97; p=0,002 и способ прогнозирования риска возникновения переломов, патент № 2526189 2=8,63; p=0,01, соответственно), китайцев (способ прогнозирования риска возникновения переломов, патент № 2526189 2=6,S; p=0,033 и способ прогнозирования риска возникновения переломов, патент № 2526189 2=8,7; p=0,013, соответственно), тогда как русские отличались только от китайцев (p<0,001).

В изученных этнических группах преобладающим был генотип -1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 I, частота которого составила 68,3% у русских, 84,8% у татар и 79,6% у башкир. Генотип -1663способ прогнозирования риска возникновения переломов, патент № 2526189 Dспособ прогнозирования риска возникновения переломов, патент № 2526189 D встретился с частотой 2,7% у русских и не был обнаружен у татар и башкир, различия в распределении частот генотипов -1663indelT полиморфного варианта не были статистически значимыми (способ прогнозирования риска возникновения переломов, патент № 2526189 2=4,74; p=0,314). В европейских популяциях отмечается снижение частоты генотипа -1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 I и повышение частот генотипов -1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 D и -1663способ прогнозирования риска возникновения переломов, патент № 2526189 Dспособ прогнозирования риска возникновения переломов, патент № 2526189 D по сравнению с этническими группами Волго-Уральского региона. На сегодняшний день не опубликованы данные о распределении частот аллелей и генотипов -1663indelT полиморфного варианта в азиатских популяциях. По распределению частот генотипов популяции русских, татар и башкир статистически значимо отличались от популяций Западной Европы (p<0,05).

Преобладающим в исследованных группах был генотип +1245способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 G, частота которого варьировала от 79% у татар до 85% у башкир. Частота гетерозиготного генотипа +1245способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T составила 15% у башкир, 17,9% у русских и 21% у татар. Генотип +1245способ прогнозирования риска возникновения переломов, патент № 2526189 Тспособ прогнозирования риска возникновения переломов, патент № 2526189 T встречался с частотой 0,9% у русских и не был выявлен у татар и башкир, различия в распределении частот генотипов в исследованных нами этнических группах не были статистически значимыми (способ прогнозирования риска возникновения переломов, патент № 2526189 2=3,55; p=0,47). В европейских популяциях отмечается повышение частоты генотипа +1245способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T (30% у испанцев, 29,8% у голландцев), а также повышение частоты генотипа +1245способ прогнозирования риска возникновения переломов, патент № 2526189 Tспособ прогнозирования риска возникновения переломов, патент № 2526189 T (3,6% у англичан, 7% у испанцев). По распределению частот генотипов обнаружены статистически значимые отличия трех этнических групп Волго-Уральского региона от азиатских и европейских популяций (p<0,05).

Таким образом, при изучении полиморфных локусов -1997G>T, -1663indelT и +1245G>T гена COLIA1 не выявлено статистически значимых различий по распределению частот аллелей и генотипов изученных локусов между популяционными выборками башкир, татар и русских, проживающих на территории Волго-Уральского региона, и обнаружены отличия исследованных этнических групп от популяций Западной Европы и Восточной Азии.

При анализе частот распределения аллелей и генотипов полиморфного варианта +1245G>T в группе больных НО гомозиготный генотип способ прогнозирования риска возникновения переломов, патент № 2526189 TT встречался у одного больного НО, гетерозиготный генотип способ прогнозирования риска возникновения переломов, патент № 2526189 GT выявлен у 21,2% пациентов, тогда как в контрольной выборке аллель способ прогнозирования риска возникновения переломов, патент № 2526189 T не встречался в гомозиготном состоянии и обнаружен у 10% индивидов в гетерозиготном состоянии, не достигая статистически значимых различий из-за малочисленности выборки больных НО.

Было показано, что гаплотипы в промоторном регионе -1997G>T, -1663indelT имеют высокую транскрипционную активность. Эти исследования подкрепляют гипотезу о том, что механизмы, лежащие в основе ассоциаций гаплотипов гена COLIA1 с переломами, связаны с повышенной транскрипцией гена COLIA1. Это приводит к аномальному соотношению способ прогнозирования риска возникновения переломов, патент № 2526189 1 и способ прогнозирования риска возникновения переломов, патент № 2526189 2 цепей, которые поражают минерализацию кости и прочность костной ткани [Scheer U., Hinssen Н., Franke W.W., Jockusch В.М. Microinjection of actin-binding proteins and actin antibodies demonstrates involvement of nuclear actin in transcription of lampbrush chromosomes // Cell. - 1984. - Vol.39. - P.111-122; Stewart TL, Roschger P, Misof BM, Mann V et al. Association of COLIA1 Sp1 alleles with defective bone nodule formation in vitro and abnormal bone mineralization in vivo // Calcif Tissue Int. 2005. Vol.77. P.113-118; Jin H., Stewart T.L., Hof R.V., Reid D.M., Aspden R.M., Ralston S. A rare haplotype in the upstream regulatory region of COLIA1 is associated with reduced bone quality and hip fracture // J. Bone Miner. Res. - 2009. - Vol.24. - P.448-454; Garcia-Giralt N, Enjuanes A, Bustamante M et al. In vitro functional assay of alleles and haplotypes of two COLIA1- promoter SNPs // Bone. 2005. Vol.36. № 5. P.902-908].

Был проведен анализ распределения частот аллелей полиморфного варианта -1997G>T гена COLIA1 в выборке больных НО и в группе контроля. Так, частота аллеля способ прогнозирования риска возникновения переломов, патент № 2526189 T у больных НО составила 0,35, тогда как в группе контроля она была несколько выше (0,38). При этом наблюдается повышение частоты гомозиготного генотипа способ прогнозирования риска возникновения переломов, патент № 2526189 TT у больных НО (0,1), по сравнению с контролем (0,08), однако различия не достигают статистических значений.

Анализ распределения частот аллелей и генотипов полиморфного варианта -1663indelT у больных НО показал, что тенденцию повышения частоты делеции T до 12%, по сравнению с контролем. У больных НО делеция способ прогнозирования риска возникновения переломов, патент № 2526189 T в гомозиготном состоянии была выявлена у одного больного (3%), в то время как в группе здоровых индивидов она совсем не встречалась.

Полногеномные исследования ассоциаций подтвердили роль -1997G>T, -1663indelT и +1245G>T полиморфных вариантов в регуляторном регионе гена COLIA1 на уровень МПКТ и развитие переломов [Richards J.B., Rivadeneira F., Inouye M., Pastinen T.M., Soranzo N., Wilson S.G., Andrew Т., Falchi M., Gwilliam R., Ahmadi K.R., et al. Bone mineral density, osteoporosis, and osteoporotic fractures: a genome-wide association study // Lancet - 2008. - Vol.371. - P.1505-1512; Styrkarsdottir U., Halldorsson B.V., Gretarsdottir S., Gudbjartsson D.F., Walters G.B., Ingvarsson Т., Jonsdottir Т., Saemundsdottir J., Snorradottir S., Center J.R., et al. New sequence variants associated with bone mineral density // Nat. Genet. - 2009. - Vol.41. - P.15-17; Styrkarsdottir U., Halldorsson B.V., Gretarsdottir S., Gudbjartsson D.F., Walters G.B., Ingvarsson Т., Jonsdottir Т., Saemundsdottir J., Center J.R., Nguyen T.V., et al. Multiple genetic loci for bone mineral density and fractures // N. Engl. J. Med. - 2008. - Vol.358. - P.2355-2365]. Так, анализ гаплотипов по трем полиморфным вариантам регуляторного региона гена COLIA1 у больных НО и в группе контроля показал, что гаплотип способ прогнозирования риска возникновения переломов, патент № 2526189 Tспособ прогнозирования риска возникновения переломов, патент № 2526189 delспособ прогнозирования риска возникновения переломов, патент № 2526189 T, ассоциированный с низким значением МПКТ и повышенным количеством переломов, был обнаружен у 5 пациентов с НО (15%) и отсутствовал в группе контроля. Значения достигают статистически значимых различий способ прогнозирования риска возникновения переломов, патент № 2526189 2=4,99 p=0,025 (OR=3,53 (1,23-10,11).

Наши результаты согласуются с результатами других исследований, где показано, что транскрипция гаплотипа способ прогнозирования риска возникновения переломов, патент № 2526189 Tспособ прогнозирования риска возникновения переломов, патент № 2526189 delспособ прогнозирования риска возникновения переломов, патент № 2526189 T полиморфных локусов -1997G>T, -1663indelT и +1245G>T, ассоциированного с повышенным риском переломов, в два раза выше, чем гаплотипа способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 G; и гаплотип способ прогнозирования риска возникновения переломов, патент № 2526189 Tспособ прогнозирования риска возникновения переломов, патент № 2526189 Dспособ прогнозирования риска возникновения переломов, патент № 2526189 T встречается в группе пациентов, имеющих большое количество переломов [Huilin Jin, Rob J. vanспособ прогнозирования риска возникновения переломов, патент № 2526189 t Hof, Omar M.E. Albagha and Stuart H. Ralston. Promoter and intron 1 polymorphisms of COLIA1 interact to regulate transcription and susceptibility to osteoporosis // Human Molecular Genetics. - 2009. - Vol.15. - P.2729-2738; Jin H., Stewart T.L., Hof R.V., Reid D.M., Aspden R.M., Ralston S. A rare haplotype in the upstream regulatory region of COLIA1 is associated with reduced bone quality and hip fracture // J. Bone Miner. Res. - 2009. - Vol.24. - P.448-454].

Было проведено исследование -1997G>T, -1663indelT и +1245G>T полиморфных локусов и гаплотипов гена COLIA1 в выборках женщин с остеопоретическими переломами и без переломов русской и татарской этнической принадлежности. Анализ распределения частот аллелей и генотипов -1997G>T полиморфного варианта гена COLIA1 у женщин с переломами и без переломов русской этнической принадлежности не выявил статистически значимых различий. Преобладающим был аллель -1997способ прогнозирования риска возникновения переломов, патент № 2526189 G, частота которого составила 81,43% у женщин с переломами и 81,72% в контрольной группе. Генотип -1997способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 G встречался с частотой 66,9% в группе с переломами и 65,9% в контроле, частота генотипа -1997способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T составила 29,1% и 31,5%, соответственно.

У женщин татарской этнической принадлежности в группе с переломами частота аллеля -1997способ прогнозирования риска возникновения переломов, патент № 2526189 G составила 72,6%, в контроле - 75,39%. У женщин с переломами отмечалось повышение частоты генотипа -1997способ прогнозирования риска возникновения переломов, патент № 2526189 Tспособ прогнозирования риска возникновения переломов, патент № 2526189 T (7,14%) и снижение частоты генотипа -1997способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T (40,5%) по сравнению с контрольной группой (1,59% и 46,03%, соответственно). Различия в распределении частот аллелей и генотипов -1997G>T полиморфного варианта гена COLIA1 у женщин татарской этнической принадлежности статистически незначимы.

В группе с переломами отмечается повышение частоты аллеля -1663способ прогнозирования риска возникновения переломов, патент № 2526189 D до 23,1% по сравнению с контролем (15,7%; способ прогнозирования риска возникновения переломов, патент № 2526189 2=6,08; p=0,014). Величина относительного риска для носителей аллеля -1663способ прогнозирования риска возникновения переломов, патент № 2526189 D составила 1,61 (95% Cl 1,12-2,33). В группе с переломами отмечается повышение частоты генотипа -1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 D (38,3%) по сравнению с контролем (27,4%; способ прогнозирования риска возникновения переломов, патент № 2526189 2=4,51; p=0,034), и снижение частоты генотипа -1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 I (57,7% и 79,6%, соответственно; способ прогнозирования риска возникновения переломов, патент № 2526189 2=6,13; p=0,013). Генотип -1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 D является маркером повышенного риска развития переломов (OR=l,64; 95% Cl 1,06-2,54), генотип -1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 I можно рассматривать как протективный (OR=0,56; 95% Cl 0,371-0,874).

У женщин татарской этнической принадлежности выявлена сходная тенденция к повышению частот аллеля -1663способ прогнозирования риска возникновения переломов, патент № 2526189 D и генотипа -1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 D в группе с переломами по сравнению с контролем, однако различия не достигли уровня статистической значимости. Так, частота аллеля -1663способ прогнозирования риска возникновения переломов, патент № 2526189 D у женщин с переломами составила 14,3%, в группе без переломов - 9,5% (способ прогнозирования риска возникновения переломов, патент № 2526189 2=0,71; p=0,4). Частота генотипа -1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 I в контрольной группе была 82,5%, у женщин с переломами - 71,43%, генотип -1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 D встречался с частотой 28,6% и 15,9%, соответственно.

Таким образом, проведенное нами исследование -1663indelT полиморфного варианта гена COLIA1 показало, что генотип -1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 D (OR=l,64) и аллель -1663способ прогнозирования риска возникновения переломов, патент № 2526189 D (OR=l,61) являются маркерами повышенного риска, а генотип -1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 I - протективным (OR=0,56) в отношении риска развития переломов у женщин русской этнической принадлежности.

Распределение частот аллелей и генотипов полиморфного варианта +1245G>Тгена COLIA1 у женщин русской и татарской этнической принадлежности было следующим. У женщин с переломами русской этнической принадлежности выявлено повышение частоты аллеля +1245способ прогнозирования риска возникновения переломов, патент № 2526189 T (20,43%) по сравнению с контрольной группой (14,21%; способ прогнозирования риска возникновения переломов, патент № 2526189 2=4,01; p=0,045), показатель относительного риска для носителей аллеля +1245способ прогнозирования риска возникновения переломов, патент № 2526189 T составил 1,5 (95% Cl 1,03-2,22). При сравнении частот генотипов в исследуемых выборках женщин русской этнической принадлежности в группе с переломами обнаружено повышение частоты генотипа +1245способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T (33,14%) и снижение частоты генотипа +1245способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 G (64,43%) по сравнению с контролем (24,4% и 73,6%, соответственно), различия не были статистически значимыми. У женщин татарской этнической принадлежности также выявлено повышение частоты аллеля +1245способ прогнозирования риска возникновения переломов, патент № 2526189 T (14,28%) и генотипа +1245способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T (28,57%) в группе с переломами по сравнению с контролем (9,52% и 15,87%, соответственно). Генотип +1245способ прогнозирования риска возникновения переломов, патент № 2526189 Tспособ прогнозирования риска возникновения переломов, патент № 2526189 T не встречался у женщин татарской этнической принадлежности. Различия в распределении частот аллелей и генотипов в исследуемых группах татарской этнической принадлежности не были статистически значимыми.

Таким образом, проведенное исследование +1245G>T полиморфного варианта гена COLIA1 показало, что среди женщин русской этнической принадлежности носители аллеля +1245способ прогнозирования риска возникновения переломов, патент № 2526189 T подвержены большей вероятности развития переломов (OR=1,5). Полученные данные согласуются с результатами других работ. Ассоциация аллеля +1245способ прогнозирования риска возникновения переломов, патент № 2526189 T с повышенным риском переломов была показана у женщин из Испании [Bandres E, Pombo I, Gonzalez-Huarriz М, Rebollo A et al. Association between bone mineral density and polymorphisms of the VDR, ER alpha, COLIA1 and CTR genes in Spanish postmenopausal women // J Endocrinol Invest. 2005. Vol.28. № 4.P.312-321; Navarro M.C., Sosa M., del Pino-Montes J. Collagen type 1 (COLIA1) Sp1 binding site polymorphism is associated with osteoporotic fractures but not with bone density in post-menopausal women from the Canary Islands: a preliminary study // Aging. Clin. Exp. Res. - 2007. - Vol.19, № 1. - P.4-9; Bandres, 2005; Navarro, 2007], Великобритании [Grant S.F., David M. Reid, Glen Blake et al. Reduced bone density and osteoporosis associated with a polymorphic Sp1 binding site in the collagen type I способ прогнозирования риска возникновения переломов, патент № 2526189 1 gene // Nature genetics. 1996. Vol.l4. P.203-205; McGuigan FE, Reid DM, Ralston SH. Susceptibility to osteoporotic fracture is determined by allelic variation at the Sp1 site, rather than other polymorphic sites at the COLIA1 locus // Osteoporos Int. 2000. Vol.11. № 4. P.338-343Grant, 1996; McGuigan, 2000], Голландии [Yazdanpanah N., Rivadeneira F., van Meurs J.B., Zillikens M.C., Arp P., Hofman A., van Duijn C.M., Pols H.A., Uitterlinden A.G. The - 1997 G/T and Sp1 polymorphisms in the collagen type I alphal (COLIA1) gene in relation to changes in femoral neck bone mineral density and the risk of fracture in the elderly: the Rotterdam study // Calcif. Tissue Int. - 2007. - Vol.81. - P.18-25; Uittelinden AG, van Meurs JB, Rivadeneira F, Pols HA. Identifying genetic risk factors for osteoporosis // J Musculoskelet Neuranal Interact. 2006. Vol.6. № 1. P.16-26], Греции [Weichetova M, Bohuslavova R, Skodova Z, J J, Adamkova V. No association between genetic polymorphisms of TGFss, PAI-1, and COLIA1, and bone mineral density in Caucasian females. // Endocr Regul. 2006. Vol.40. № 4. P.107-112]. Однако не было обнаружено влияние +1245G>T полиморфного варианта на риск развития переломов в у женщин из Ирландии [McClean Е, Archbold GP, Taggart HM. Do the COLIA1 and Taq 1 vitamin D receptor polymorphisms have a role in identifying individuals at risk of developing osteoporosis? // Ulster Med J. 2003. Vol.72. № 1. P.26-33] и Бельгии [Aerssens J., J. Dequeker, J. Peeters. Polymorphisms of the VDR, ER and COLIA1 genes and osteoporotic hip fracture in elderly postmenopausal women // Osteoporos. Int. - 2000. - Vol.11, № 7. - P.583-591]. Самое масштабное на сегодняшний день многоцентровое исследование, проведенное в ряде европейских стран, показало, что риск развития переломов позвоночника у женщин с генотипом +1245способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T или +1245способ прогнозирования риска возникновения переломов, патент № 2526189 Tспособ прогнозирования риска возникновения переломов, патент № 2526189 T в 1,4 раза выше по сравнению с носителями генотипа +1245способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 G [Ralston SH, Uitterlinden AG, Brandi ML, Balcells S, Langdahl BL, et al. Large-scale evidence for the effect of the COLIA1 SpI polymorphism on osteoporosis outcomes: The GENOMOS Study // PloS Med. 2006. Vol.3. № 4. P.515-523].

Был проведен анализ гаплотипов -1997G>T, -1663indelT и +1245G>T полиморфных локусов гена COLIA1 в выборках женщин с переломами и без переломов русской и татарской этнической принадлежности. Наиболее частыми были гаплотипы -1997способ прогнозирования риска возникновения переломов, патент № 2526189 G/-1663способ прогнозирования риска возникновения переломов, патент № 2526189 I/+1245способ прогнозирования риска возникновения переломов, патент № 2526189 G, -1997способ прогнозирования риска возникновения переломов, патент № 2526189 T/-1663способ прогнозирования риска возникновения переломов, патент № 2526189 I/+1245способ прогнозирования риска возникновения переломов, патент № 2526189 G и -1997способ прогнозирования риска возникновения переломов, патент № 2526189 G/-1663способ прогнозирования риска возникновения переломов, патент № 2526189 D/+1245способ прогнозирования риска возникновения переломов, патент № 2526189 . Сравнительный анализ групп женщин без переломов показал, что гаплотип -1997способ прогнозирования риска возникновения переломов, патент № 2526189 T/-1663способ прогнозирования риска возникновения переломов, патент № 2526189 I/+1245способ прогнозирования риска возникновения переломов, патент № 2526189 G встречается чаще (23,7%), а гаплотип -1997способ прогнозирования риска возникновения переломов, патент № 2526189 G/-1663способ прогнозирования риска возникновения переломов, патент № 2526189 D/+1245способ прогнозирования риска возникновения переломов, патент № 2526189 T - реже (7,4%) у татар по сравнению с русскими (18,3% и 13,9%, соответственно), однако различия не являются статистически значимыми (способ прогнозирования риска возникновения переломов, патент № 2526189 2=4,31; p=0,366; df=4). Кроме того, у женщин татарской этнической принадлежности выявлены гаплотипы -1997способ прогнозирования риска возникновения переломов, патент № 2526189 T/-1663способ прогнозирования риска возникновения переломов, патент № 2526189 D/+1245способ прогнозирования риска возникновения переломов, патент № 2526189 G и -1997способ прогнозирования риска возникновения переломов, патент № 2526189 T/-1663способ прогнозирования риска возникновения переломов, патент № 2526189 D/+1245способ прогнозирования риска возникновения переломов, патент № 2526189 T, которые не встретились у женщин русской этнической принадлежности.

Анализ распределения частот гаплотипов у женщин русской этнической принадлежности показал, что гаплотип -1997способ прогнозирования риска возникновения переломов, патент № 2526189 G/-1663способ прогнозирования риска возникновения переломов, патент № 2526189 I/+1245способ прогнозирования риска возникновения переломов, патент № 2526189 G чаще встречался в контроле (65,2%) по сравнению с группой с переломами (57,9%; p=0,043), однако различия не были статистически значимы после применения поправки на множественность сравнений (p=0,21). Также у женщин с переломами отмечается повышение частоты гаплотипа -1997способ прогнозирования риска возникновения переломов, патент № 2526189 G/-1663способ прогнозирования риска возникновения переломов, патент № 2526189 D/+1245способ прогнозирования риска возникновения переломов, патент № 2526189 T по сравнению с контрольной группой (19,1% и 13,9%, p=0,057).

При сравнении частот гаплотипов у лиц татарской этнической принадлежности выявлено, что у женщин с переломами гаплотип -1997способ прогнозирования риска возникновения переломов, патент № 2526189 G/-1663способ прогнозирования риска возникновения переломов, патент № 2526189 D/+1245способ прогнозирования риска возникновения переломов, патент № 2526189 T встречается чаще по сравнению с контролем (14,3% и 7,4%, соответственно), а гаплотип -1997способ прогнозирования риска возникновения переломов, патент № 2526189 G/-1663способ прогнозирования риска возникновения переломов, патент № 2526189 I/+1245способ прогнозирования риска возникновения переломов, патент № 2526189 G - реже (58,3% и 66,8%, соответственно), различия не были статистически значимы.

Согласно полученным данным, гаплотипы -1997G>T, -1663indelT и +1245G>T полиморфных локусов гена COLIA1 не ассоциированы с риском развития переломов у женщин русской и татарской этнической принадлежности. Показано, что гаплотип -1997способ прогнозирования риска возникновения переломов, патент № 2526189 G/+1245способ прогнозирования риска возникновения переломов, патент № 2526189 G ассоциирован с пониженным, а гаплотип -1997способ прогнозирования риска возникновения переломов, патент № 2526189 G/+1245способ прогнозирования риска возникновения переломов, патент № 2526189 T - с повышенным риском развития переломов у женщин из Голландии [Yazdanpanah N., Rivadeneira F., van Meurs J.B., Zillikens M.C., Arp P., Hofrman A., van Duijn СМ., Pols H.A., Uitterlinden A.G. The - 1997 G/T and Spl polymorphisms in the collagen type I alphal (COLIA1) gene in relation to changes in femoral neck bone mineral density and the risk of fracture in the elderly: the Rotterdam study // Calcif. Tissue Int. - 2007. - Vol.81. - P.18-25].

Таким образом, в результате проведенного исследования -1997G>T, -1663indelT и +1245G>T полиморфных локусов и гаплотипов гена COLIA1 выявлена ассоциация -1663indelT и +1245G>T полиморфизмов с риском развития переломов у женщин русской этнической принадлежности. Аллели +1245способ прогнозирования риска возникновения переломов, патент № 2526189 T, -1663способ прогнозирования риска возникновения переломов, патент № 2526189 D и генотип -1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 D являются маркерами повышенного риска развития переломов.

На основании полученных результатов можно сделать вывод о том, что сочетание генотипов или гаплотипов всех трех полиморфных вариантов -1997G>T, -1663indelT и +1245G>T, расположенных в регуляторном регионе гена COLIA1, позволяет с большей вероятностью прогнозировать риск развития переломов у индивидуумов с предрасположенностью к переломам.

Примеры прогнозирования риска развития переломов.

Пример 1. Пациент 1992 года рождения.

Клинический диагноз: несовершенный остеогенез. За 5 лет жизни у пробанда зарегистрировано 19 переломов, которые привели к деформации конечностей и инвалидизации пациента. Пациент характеризуется голубыми склерами, деформациями конечностей, грудной клетки, гиперобильностью суставов кистей и стоп.

Для проведения анализа полиморфных вариантов -1997G>T, -1663indelT и +1245G>T у больного было взято 5 мл венозной крови с последующим выделением ДНК и амплификацией в режиме реального времени с флуоресцентной детекцией по конечной точке. В результате было выявлено, что пациент является носителем сочетания генотипов -1997способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T/-1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 D/+1245способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T и гаплотипа способ прогнозирования риска возникновения переломов, патент № 2526189 Tспособ прогнозирования риска возникновения переломов, патент № 2526189 delспособ прогнозирования риска возникновения переломов, патент № 2526189 T, являющегося маркером повышенного риска развития переломов.

Пример 2. Пациентка 54 лет.

Диагноз: первичный постменопаузальный остеопороз. Пациент 54 лет без сопутствующих заболеваний и состояний, которые могут привести к потере костной массы (инсулинзависимый сахарный диабет, ревматоидный артрит, системная красная волчанка, хроническая почечная недостаточность, удаление яичников, резекция желудка, длительный прием глюкокортикоидов, иммунодепрессантов). В анамнезе переломы XI и XI ребер слева, лучевой кости правой руки, возникших при падении с высоты собственного тела, при незначительной нагрузке или без видимых причин (низкотравматичные переломы) произошедшие в постменопаузальном возрасте.

В целях проведения анализа трех полимофрных вариантов -1997G>T, -1663indelT и +1245G>T гена COLIA1 у пациентки было взято 5 мл венозной крови, из которой была выделена ДНК методом фенольно-хлороформной экстракции. Амплификация полиморфных вариантов проводилась с помощью ПЦР в реальном времени с флуоресцентной детекцией по конечной точке. Таким образом, было определено, что пациент является носителем сочетания рисковых генотипов -1997способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T/-1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 D/+1245способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T.

Пример 3. Пациентка 64 лет.

Диагноз: первичный постменопаузальный остеопороз, без сопутствующих заболеваний и состояний, которые могут привести к потере костной массы (инсулинзависимый сахарный диабет, ревматоидный артрит, системная красная волчанка, хроническая почечная недостаточность, удаление яичников, резекция желудка, длительный прием глюкокортикоидов, иммунодепрессантов). В анамнезе переломы позвонков (L1, L2), возникших при падении с высоты собственного тела, при незначительной нагрузке или без видимых причин (низкотравматичные переломы), произошедшие в постменопаузальном возрасте.

В целях проведения анализа трех полиморфных вариантов -1997G>T, -1663indelT и +1245G>T гена COLIA1 у больного было взято 5 мл венозной крови, из которой была выделена ДНК методом фенольно-хлороформной экстракции. Амплификация полиморфных вариантов проводилась с помощью ПЦР в реальном времени с флуоресцентной детекцией по конечной точке. В результате проведенных исследований у пациентов выявлено сочетание рисковых генотипов -1997способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T/-1663способ прогнозирования риска возникновения переломов, патент № 2526189 Iспособ прогнозирования риска возникновения переломов, патент № 2526189 D/+1245способ прогнозирования риска возникновения переломов, патент № 2526189 Gспособ прогнозирования риска возникновения переломов, патент № 2526189 T, являющееся генетическим маркером риска развития переломов.

Предлагаемый способ позволяет с высокой точностью прогнозировать риск развития возникновения переломов, т.к. именно сочетание генотипов по трем локусам, расположенным в регуляторном регионе гена коллагена I типа альфа 1 цепи (COLIA1), влияет на экспрессию данного гена и дает полную картину развития возникновения переломов у пациентов с повышенным риском развития переломов. Данный метод может быть использован для прогностических и предиктивных целей, позволяющих проводить профилактическое лечение у индивидуумов со склонностью к переломам до развития остеопоретических переломов.

Таблица 1
Праймеры, зонды и условия проведения полимеразной цепной реакции
ГенПолиморфный маркер/мутацияdbSNP ЧастотаПраймеры и зонды
способ прогнозирования риска возникновения переломов, патент № 2526189 G/Trs1800012 34% GG 49% GT 17% TT COLIA1-rs1800012-FJ, GAGGGAGGAGAGAAGGGA, 65.1C COLIA1-rs1800012-RJ, CTAGGTGCTGGAGGTTAGG, 64.8C COLIA1-rs1800012-FAM, FAM-cccgcccCcaTtccc-BHQ-1, 71.9C COLIA1-rs1800012-VIC, VIC-cccgCccAcattccc-BHQ-2,69.1C Длина 168, 65C
COLIA1 G/Trs1107946 12% GG 52% GT 36% TTCOLIA1-rs1107946-FJ, GAACCCACCAAAGTCCTG, 63.8C COLIA1-rs1107946-RJ, CCTAGACCACCACTCTAAATG, 63.3C COLIA1-rs1107946-FAM, FAM-ccaagAgaAccCctcc-BHQ-1, 71.9C COLIA1-rs1107946-VIC, VIC-ccaagAgaCccCctcc-BHQ-2, 69.1С Длина 114, 61C
ID rs241229815% II 47% ID 38% DD COLIA1-rs2412298-FJ, CAGCTGGTTTTGTGCAAC, 63.7C COLIA1-rs2412298-RJ, TGCCTCTCTGGAAACTCTA, 63.3C COLIA1-rs2412298-FAM, FAM-aggcaaaGgggAaaaAaaaGga-BHQ-1, 75.9C COLIA1-rs2412298-VIC, VIC-aggcaaaGgggAaaAaaaGga-BHQ-2, 74.4C Длина 174, 63C

Скачать патент РФ Официальная публикация
патента РФ № 2526189

patent-2526189.pdf

Класс G01N33/50 химический анализ биологических материалов, например крови, мочи; испытания, основанные на способах связывания биоспецифических лигандов; иммунологические испытания

способ выбора лечения акне у женщин -  патент 2529789 (27.09.2014)
способ определения структурного состояния мембраны эритроцитов -  патент 2528909 (20.09.2014)
способ определения показаний к операции программированной санационной релапаротомии при перитоните -  патент 2528880 (20.09.2014)
способ лечения больных с синдромом диспепсии в сочетании с избыточной массой тела -  патент 2528641 (20.09.2014)
способ диагностики острого токсического повреждения печени -  патент 2527770 (10.09.2014)
способ исследования скорости всасывания аминокислот в пищеварительном тракте -  патент 2527349 (27.08.2014)
способ комплексного лечения некротического энтероколита у новорожденных и детей младшего грудного возраста -  патент 2527348 (27.08.2014)
способ оценки эффективности тромболитической терапии у больных острым инфарктом миокарда с подъемом сегмента st -  патент 2526831 (27.08.2014)
способ прогнозирования развития пороговой стадии ретинопатии недоношенных у детей без офтальмологических признаков заболевания -  патент 2526827 (27.08.2014)
способ диагностики наружного генитального эндометриоза -  патент 2526823 (27.08.2014)
Наверх