рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез рекомбинантного белка p35d вируса оспы коров, штамм бактерий escherichia coli - продуцент рекомбинантного белка p35d вируса оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый для создания тест-систем и конструирования субъединичных вакцин против ортопоксвирусных инфекций

Классы МПК:C12N15/70 векторы или системы экспрессий, специально приспособленные для Ecoli
C12N15/09 метод рекомбинантных ДНК
C12N15/39 Poxviridae, например вирусы коровьей оспы, оспы человека
C07K14/07 вирус натуральной; вирус коровьей оспы
C12N1/21 модифицированные введением чужеродного генетического материала
A61K39/285 вирусы натуральной или коровьей оспы
Автор(ы):, , , , ,
Патентообладатель(и):Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" (ФБУН ГНЦ ВБ "Вектор") (RU),
Федеральное государственное бюджетное учреждение науки Институт химической биологии и фундаментальной медицины Сибирского отделения Российской академии наук (ИХБФМ СО РАН) (RU)
Приоритеты:
подача заявки:
2012-08-01
публикация патента:

Изобретение относится к области биотехнологии и касается получения генетической конструкции, обеспечивающей синтез в клетках Escherichia coli рекомбинантного белка p35d.Представлены: рекомбинантная плазмидная ДНК pQE-p35d, обеспечивающая синтез рекомбинантного белка p35dвируса оспы коров и содержащая в соответствии с физической и генетической картой плазмиды, приведенной на фиг. 2: плазмидный вектор pQE30, фрагмент, кодирующий олигопептид MRGSHHHHHHG и фрагмент размером 717 п.о., кодирующий фрагмент белка р35 вируса оспы коров с 1 по 239 аминокислотный остаток (фиг.1а); штамм бактерий Escherichia coli XL1Blue/pQE-p35d В-1252 - продуцент рекомбинантного белка p35dвируса оспы коров, содержащий рекомбинантную плазмидную ДНК pQE-p35d, депонированный в Коллекции бактерий, бактериофагов и грибов ФБУН ГНЦ ВБ «Вектор» под регистрационным номером В-1252 и рекомбинантный белок p35d вируса оспы коров. Охарактеризованные решения могут быть использованы для создания тест-систем и конструирования субъединичных вакцин против ортопоксвирусных инфекций. 3 н. п. ф-лы, 7 ил., 5 пр.

Рисунки к патенту РФ 2511037

рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037

Изобретение относится к получению генетической конструкции, обеспечивающей синтез в клетках Escherichia coli рекомбинантного белка p35d вируса оспы коров, состоящего из N-концевого олигопептида MRGSHHHHHHGSGG и фрагмента белка р35 вируса оспы коров с 1 по 239 аминокислотный остаток, взаимодействующего с сыворотками доноров, вакцинированных вирусом осповакцины, и вируснейтрализующими антителами против нативного белка р35 ортопоксвирусов, и может быть использовано в биотехнологии, генетической и белковой инженерии для создания тест-систем и конструирования субъединичных вакцин против ортопоксвирусных инфекций.

Род Orthopoxvirus является наиболее известным в семействе Poxviridae, включающем в себя сложные ДНК-содержащие вирусы, реплицирующиеся в цитоплазме клеток позвоночных и беспозвоночных. К роду Orthopoxvirus относится большая часть патогенных для человека поксвирусов, таких как вирус натуральной оспы и вирус оспы обезьян. Вакцинация вирусом осповакцины вызывает достаточно надежный иммунитет, однако вирус осповакцины и вирус оспы коров могут вызывать генерализованную инфекцию у людей с ослабленным иммунным статусом [1].

Открытая рамка трансляции, кодирующая белок р35, чрезвычайно консервативна среди ортопоксвирусов [1]. Белок р35 является основным иммуногенным белком при развитии иммунного ответа на ортопоксвирусную инфекцию в организме человека и главной целью нейтрализующих АТ при гуморальном иммунном ответе у человека [2]. Этот белок выявляется человеческим вакцинным иммуноглобулином [3]. Очищенный человеческий анти-р35 иммуноглобулин G достаточен для нейтрализации вируса оспы коров [2]. Кроме того, белок р35 является иммунодоминантным антигеном для инфицированных лабораторных животных [4]. Иммунизация рекомбинантным аналогом белка р35 вызывает наработку вируснейтрализующих антител у иммунизированных мышей и защищает их в случае заражения летальной дозой вируса [2,4,5]. Таким образом, получение рекомбинантного аналога белка р35 ортопоксвирусов актуально для создания тест-систем для выявления ортопоксвирусной инфекции и конструирования субъединичных вакцин нового поколения против ортопоксвирусов.

Известен рекомбинантный аналог белка р35 вируса осповакцины, содержащий рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 -галактозидазу и 4/5 аминоксилотной последовательности белка р35 вируса осповакцины [6].

Наиболее близким аналогом (прототипом) является рекомбинантный аналог белка р35 вируса коров, названный (prJ3L), также являющийся химерным белком рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 -галактозидаза-р35 [7]. Этот белок взаимодействует с сыворотками доноров, вакцинированных вирусом осповакцины, и вируснейтрализующими антителами против нативного белка р35 [7].

Основным недостатком этих гибридных белков [6, 7] является высокая способность рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 -галактозидазы, входящей в состав этих белков, к перекрестному связыванию. Это приводит к низкой специфичности связывания, недостаточной при создании тест-систем, в связи с чем необходима разработка рекомбинантного белка р35 ортопоксвирусов. В Российской Федерации и за рубежом такие аналоги отсутствуют.

Техническим результатом заявляемого изобретения является создание такой плазмидной ДНК pQE-p35d, и на основе нее такого штамма бактерий Escherichia coli, обеспечивающие синтез более высокоспецифичного рекомбинантного белка p35d вируса оспы коров, который распознается сыворотками вакцинированных вирусом осповакцины людей и взаимодействует с вируснейтрализующими моноклональными антителами против нативного белка р35 ортопоксвирусов.

Указанный технический результат достигается конструированием плазмиды pQE-p35d путем встройки в плазмидный вектор pQE30 фрагмента ДНК, кодирующего N-концевой фрагмент белка р35 с 1 по 239 аминокислотный остаток вируса оспы коров, штамм Гришак. Трансформация полученной плазмидой клеток Escherichia coli, штамм XL1Blue, обеспечивает синтез рекомбинантного белка p35d вируса оспы коров, взаимодействующего с сыворотками иммунизированных вирусом осповакцины доноров и вируснейтрализующими моноклональными антителами против нативного белка р35 ортопоксвирусов.

Сущность изобретения заключается в следующем:

Генно-инженерными методами получают плазмиду pQE-p35d, несущую ген, кодирующий рекомбинантный белок p35d вируса оспы коров, содержащий N-концевой олигопептид MRGSHHHHHHGSGG и фрагмент белка р35 вируса оспы коров с 1 по 239 аминокислотный остаток. Последовательность ДНК, кодирующую фрагмент белка р35 вируса оспы коров с 1 по 239 аминокислотный остаток получают на основе ДНК вируса оспы коров, штамм Гришак.

Клетки E.coli XL1Blue трансформируют сконструированной плазмидой pQE-p35d и выращивают в течение ночи. Ночную культуру (1/100) засевают в свежую среду YTx2 с ампициллином (100 мкг/мл). Синтез белка индуцируют добавлением изопропилтиогалактазида до концентрации 1 мМ в тот момент, когда культура достигает средне-логарифмической фазы роста. Индуцированные клетки растят 16 часов при 30 оС, после чего собирают центрифугированием при 5000 g. Индуцированные клетки E.coli XL1Blue/pQE-p35d используют для очистки рекомбинантного белка p35d вируса оспы коров с помощью аффинной хроматографии. В результате получают рекомбинантный белок p35d вируса оспы коров, имеющий молекулярную массу около 30 кДа, состоящий из N-концевого олигопептида MRGSHHHHHHGSGG и фрагмента белка р35 вируса оспы коров с 1 по 239 аминокислотный остаток, взаимодействующий с сыворотками доноров, вакцинированных вирусом осповакцины, включающий аминокислотную последовательность, кодируемую нуклеотидной последовательностью SEQ ID NO: 1. (фиг. 1).

Исходным генетическим материалом для конструирования рекомбинантной плазмиды pQE-p35d являются:

а) плазмидный вектор pQE30 («QIAGEN», США), обеспечивающий встройку фрагмента ДНК, кодирующего фрагмент белка р35 вируса оспы коров, и его экспрессию под контролем позднего промотора Т5;

б) фрагмент ДНК, кодирующий фрагмент белка р35 вируса оспы коров, который получают в полимеразной цепной реакции с использованием в качестве матрицы ДНК вируса оспы коров, штамм Гришак, и олигонуклеотидных праймеров: BamH1 5'CGGGATCCGGTGGAAT GGCGGCGGTGAAAAC и J3L-Back12 5'AACTGCAGGTGTTCTA CATATTTGGCGGCG, соответствующих 5'- и 3'-концам ДНК, кодирующей фрагмент белка р35 с 1 по 239 аминокислотный остаток, и обеспечивающих наличие в амплификационном фрагменте сайтов рестрикции Bam HI и PstI соответственно.

Полученная в результате плазмида pQE-p35d (фиг. 2) характеризуется следующими признаками:

- имеет молекулярную массу 2,7 МДа и размер 4156 п.о.;

- кодирует рекомбинантный белок p35d вируса оспы коров, состоящий из N-концевого олигопептида c аминокислотной последовательностью MRGSHHHHHHGSGG и фрагмента белка р35 вируса оспы коров с 1 по 239 аминокислотный остаток;

- состоит из следующих элементов:

а) фрагмента ДНК, размером 783 п.о., кодирующего N-концевой пептид с аминокислотной последовательностью MRGSHHHHHHGSGG и фрагмент белка р35 вируса оспы коров с 1 по 239 аминокислотный остаток;

б) плазмидного вектора pQE30, обеспечивающего эффективную транскрипцию полученного гена, кодирующего рекомбинантный белок p35d вируса оспы коров, и его экспрессию;

- содержит:

а) сайт инициации репликации ColE1 из плазмиды pBR322;

б) промотор бактериофага Т5;

в) генетические маркеры: AMPr - ген рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 -лактамазы, определяющий устойчивость к ампициллину при трансформации клеток Escherichia coli;

г) искусственный ген, кодирующий N-концевой олигопептид MRGSHHHHHHGSGG и фрагмент белка р35 вируса оспы коров с 1 по 239 аминокислотный остаток;

д) уникальные сайты узнавания эндонуклеазами рестрикции, имеющими следующие координаты: Xho I (2), Eco RI (89), BamH I (146), Pst I (879), Nhe I (1003), Xba I (1859).

Для получения штамма-продуцента рекомбинантного белка p35d оспы коров компетентные клетки бактерий Escherichia coli XL1Blue (recA1, endA1, gyrA96, thi-1, hsdR17, supE44, relA1, lac [F' proAB lacIqZрекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 M15 Tn10 (Tetr)] «Stratagene») трансформируют сконструированной плазмидой pQE-p35d. Полученный таким образом штамм E.coli XL1Blue/pQE-p35d характеризуется следующими признаками:

Морфологические признаки. Клетки мелкие утолщенной палочковидной формы, грамотрицательные, неспороносные.

Культуральные признаки. Клетки хорошо растут на простых питательных средах. При росте на агаре рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 Difkoрекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 - колонии круглые, гладкие, прижатые, мутные, блестящие серые, край ровный. При росте на жидких средах (на минимальной среде с глюкозой или LB бульоне) образуют интенсивную ровную муть. Клетки растут при температуре 37°С при оптимуме pH от 6.8 до 7.0.

Устойчивость к антибиотикам. Клетки проявляют устойчивость к ампициллину (100 мкг/мл), обусловленную наличием плазмиды.

Штамм E.coli XL1Blue/pQE-p35d обеспечивает индуцируемый изопропилтиогалактозидом синтез рекомбинантного белка p35d с уровнем экспрессии более 20% суммарного клеточного белка. Уровень экспрессии определяют с помощью денситометрии полиакриламидного геля, окрашенного Кумасси-G250 с использованием программного обеспечения Image Lab Ver. 3.0, поставляемого с прибором GelDocXR+ (Bio-Rad).

Полученный штамм депонирован в Коллекции бактерий, бактериофагов и грибов Федерального бюджетного учреждения науки Государственный научный центр вирусологии и биотехнологии «Вектор» (ФБУН ГНЦ ВБ «Вектор») под номером B-1252.

Таким образом, впервые получена плазмидная ДНК и штамм-продуцент, обеспечивающие продукцию в бактериальных клетках E.coli рекомбинантного белка p35d вируса оспы коров, состоящего из N-концевого олигопептида MRGSHHHHHHGSGG и фрагмента белка р35 вируса оспы коров с 1 по 239 аминокислотный остаток, взаимодействующего с сыворотками доноров, вакцинированных вирусом осповакцины, и моноклональными вируснейтрализующими антителами против нативного белка р35.

Изобретение иллюстрируется следующими графическими материалами, представленными на фигурах с 1 по 7:

Фиг.1а. Нуклеотидная последовательность и кодируемая ею аминокислотная последовательность фрагмента плазмиды pQE-p35d, кодирующая рекомбинантный белок p35d вируса оспы коров, состоящий из N-концевого олигопептида MRGSHHHHHHGSGG и фрагмента белка р35 вируса оспы коров с 1 по 239 аминокислотный остаток.

Фиг.1б. Аминокислотная последовательность рекомбинантного белка p35d вируса оспы коров.

Фиг.2. Общая схема структурной организации плазмиды pQE-p35d (физическая карта). p35d - ген, кодирующий рекомбинантный белок p35d, T5 - промотор фага Т5, AMPr- ген устойчивости к ампициллину; указаны некоторые сайты рестрикции.

Фиг.3. Электрофореграмма в 12,5% SDS-ПААГ лизатов клеток E.coli. Дорожки: 1 - индуцированная культура клеток E.coli XL1Blue/pQE30, 2 - индуцированная культура клеток E.coli XL1Blue/pQE-p35d, 3 - индуцированная культура клеток E.coli XL1Blue, 4 - маркеры молекулярных масс.

Фиг.4. Электрофореграмма в 12,5% SDS-ПААГ клеточных и белковых фракций E.coli XL1Blue/pQE-p35d. Дорожки: 1 - индуцированная культура клеток E.coli XL1Blue/pQE-p35d, 2 - периплазматическая фракция, 3 - фракция растворимых белков цитоплазмы, 4 - фракция телец включения, 5 - маркеры молекулярных масс, 6 - фракция белков, не связавшихся с Ni-NTA, 7 - элюат 25 мМ имидазолом, 8 - элюат 100 мМ имидазолом, 9 - концентрированный очищенный белок p35d.

Фиг.5. Иммуноблотинг рекомбинантного белка p35d с моноклональными антителами (300 нг) против белка р35 ортопоксвирусов и сыворотками (разведение 1:200). 1 - маркер молекулярных масс, 2 - белок p35d, 3-4 - белок p35d, проявленный полноразмерными антителами человека, направленными к белку р35 ортопоксвирусов, 5 - белок p35d, проявленный сывороткой не вакцинированного осповакциной донора, 6-9 -белок p35d, проявленный сыворотками доноров, вакцинированных осповакциной.

Фиг.6. Иммуноферментный анализ связывания сывороток доноров, вакцинированных осповакциной с рекомбинантным белком p35d. На твердую фазу сорбировали белок p35d в различных концентрациях. Сыворотки наносили в разведении 1:200. Линии 1, 2, 3 и 4 - сыворотки доноров, вакцинированных осповакциной, 5 - сыворотка донора, не вакцинированного осповакциной.

Фиг.7. Конкурентное связывание рекомбинантного белка p35d и вируса осповакцины с моноклональным вируснейтрализующим антителом. Моноклональное антитело в концентрации 3,5 нг прединкубировали 30 мин с различными концентрациями рекомбинантного белка p35d и вносили в лунки с предварительно сорбированным вирусом осповакцины (200 нг/лунка).

Для лучшего понимания сущности предлагаемого изобретения оно иллюстрируется следующими примерами его осуществления.

Пример 1. Способ конструирования плазмиды pQE-p35d.

В качестве источника гена, кодирующего фрагмент белка р35, используют геномную ДНК вируса оспы коров. Амплификацию гена, кодирующего фрагмент белка р35 вируса оспы коров, проводят методом ПЦР с использованием Taq-ДНК-полимеразой («Fermentas»). Для синтеза фрагмента ДНК, кодирующего фрагмент белка р35, в реакционную смесь добавляют праймеры Bam1 5'CGGGATCCGGTGGAATGGCGGC GGTGAAAAC и J3L-Back12 5'AACTGCAGGTGTTCTACATA TTTGGCGGCG, соответствующие 5'- и 3'-концам ДНК, кодирующей фрагмент белка р35 вируса оспы коров с 1 по 239 аминокислотный остаток, и обеспечивающие в амплификационном фрагменте наличие сайтов рестрикции BamHI и Pst I соответственно. Реакцию проводят в амплификаторе «GeneAmp PCR System 9700» («Applied Biosystems», США). Условия проведения ПЦР: предварительная денатурация - 2 минуты при 94°С; 30 циклов - 30 секунд при 94°С, 30 секунд при 52°С, 1 минута при 72°С; заключительная стадия - 10 минут при 72°С.

Продукт аплификации, кодирующий фрагмент белка р35 вируса оспы коров, расщепляют ферментами рестрикции BamHI и PstI в реакционной смеси, содержащей 33 mM Трис-ацетата, pH 7.9, 10 mM Mg-ацетата, 66 mM K-ацетата, 0.1 мг/мл BSA и по 5 ед. активности соответствующих ферментов. Аналогично ведут обработку рестриктазами ДНК векторной плазмиды pQE30. Реакцию ведут 1 час при 37°С. После этого ПЦР-фрагмент и линеаризованный вектор очищают электрофоретически в 1 % агарозном геле с последующим выделением ДНК с помощью набора GeneJETрекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 Gel Extraction Kit («Fermentas») в соответствии с рекомендациями производителя. В стандартном буфере проводят лигирование. Полученной лигазной смесью трансформируют клетки E.coli XL1Blue. С помощью рестрикционного анализа и полимеразной цепной реакции отбирают клоны, содержащие вставку нужного размера. Полученную таким образом целевую плазмиду обозначают как pQE-p35d. Схема плазмидной ДНК pQE-p35d (физическая карта) представлена на фиг.2.

Пример 2. Получение штамма-продуцента рекомбинантного аналога белка р35 вируса оспы коров - продукта плазмиды pQE-p35d.

Клетки E.coli XL1Blue трансформируют полученной плазмидой pQE-p35d. Клетки E.coli XL1Blue, трансформированные плазмидой pQE-p35d, растят ночь при 37оС. Ночную культуру (1/100) засевают в свежую среду YTx2 с ампициллином (100 мкг/мл). Синтез РНК-полимеразы индуцируют добавлением изопропилтиогалактазида до концентрации 1 мМ в тот момент, когда культура достигает среднелогарифмической фазы роста. Индуцированные клетки растят ночь при 37о С, после чего собирают центрифугированием при 5000 g и анализируют методом электрофореза по Лэммли в 12,5% SDS-полиакриламидном геле (ПААГ) [8]. Результаты этого анализа, представленные на фиг. 3, показывают наличие в индуцированной культуре клеток XL1Blue/pQE-p35d дополнительного белка с молекулярной массой около 30 кДа, что соответствует расчетной молекулярной массе рекомбинантного белка p35d (дорожка 2), который отсутствует в контрольном лизате индуцированных клеток E.coli XL1Blue/pQE30 (дорожка 1) и клеток E.coli XL1Blue (дорожка 3).

Пример 3. Очистка рекомбинантного белка p35d вируса оспы коров из клеток E.coli XL1Blue/pQE-p35d.

Рекомбинантный белок p35d вируса оспы коров получают из цитоплазматической фракции индуцированных клеток E.coli XL1Blue/pQE-p35d в результате аффинной хроматографии на Ni-NTA агарозе (Sigma, США) согласно инструкции производителя. Индуцированные клетки E.coli XL1Blue/pQE-p35d осаждают центрифугированием при 3000 g в течение 10 мин. Осадок растворяют в 1/10 объема буфера STE, содержащего 200 мМ трис-HCl, pH 8.0, 10 мМ ЭДТА, 20 % сахарозу, выдерживают 20 мин во льду, после чего осаждают клетки центрифугированием при 7000 g в течение 6 мин. Клеточный осадок ресуспендируют в 5 мМ MgSO4 и выдерживают 10 мин во льду. После осаждения клеткок центрифугированием при 16000 g в течение 10 мин супернатант, представляющий собой периплазматическую фракцию, переносят в чистые пробирки. Осадок растворяют в буфере, содержащем 50 мМ Трис-HCl, pH 8.0, и разрушают с помощью ультразвукового дезинтегратора. Полученную суспензию центрифугируют при 16000 g в течение 10 минут, после чего переносят супернатант, представляющий собой раствор цитоплазматических белков, в чистую пробирку. Полученные клеточные фракции анализируют электрофорезом в 12,5 % ПААГ с SDS по Лэммли [8], приготавливая образцы для нанесения на гель в присутствии 2-меркаптоэтанола. Пример электрофоретического анализа приведен на фиг. 4.

На хроматографическую колонку, содержащую 1 мл Ni-NTA агарозы (Sigma, США) и уравновешенную буфером А, содержащим 50 мМ Na-фосфатный буфер рН 8.0, 300 мМ NaCl, 5 мМ Трис-HCl, наносят 6 мл цитоплазматической фракции индуцированных клеток со скоростью потока 1 мл/мин. Колонку промывают 20 мл буфера А, после чего проводят предварительную элюцию неспецифически сорбирующихся белков Е.coli 20 мл буфера A, содержащего дополнительно 25 мМ имидазола. Рекомбинантный пептид элюируют 10 мл буфера А, содержащего 100 мМ имидазола, а затем проводят дополнительную элюцию в денатурирующих условиях 10 мл буфера, содержащего 50 мМ Трис-HCl pH 8.0, 6 М гуанидин-HCl. Полученные белковые фракции диализуют против 150 мМ NaCl, Трис-HCl pH 7.5 (две смены по 18 ч при 5ºC) и анализируют электрофорезом в 12,5 % ПААГ с SDS по Лэммли [8], приготавливая образцы для нанесения на гель в присутствии 2-меркаптоэтанола. Пример электрофоретического анализа приведен на фиг. 5.

Определение концентрации рекомбинантного белка p35d вируса оспы коров в препаратах проводят по методу Брэдфорда [9]. Для построения калибровочной кривой используют бычий сывороточный альбумин (Serva, США). Определение концентрации белка показывает, что общий выход составляет 300 мг из 1 л культуры клеток E. coli.

Пример 4. Оценка иммунохимических свойств рекомбинантного белка p35d.

Очищенный белок p35d анализируют с помощью вестерн-блот анализа с использованием вируснейтрализующих моноклональных антител к белку р35 ортопоксвирусов и сывороток доноров, вакцинированных осповакциной (фиг.5). В качестве отрицательного контроля используют сыворотку невакцинированного осповакциной донора. Для этого проводят электрофорез белка p35d в 12,5% ПААГ с SDS и переносят на нитроцеллюлозную мембрану по методу Towbin c соавт. [10], которую после блокирования сайтов неспецифического связывания раствором 5% сухого молока в фосфатно-солевом буфере (100 мМ NaCl, 33 мМ Na2HPO 4, 17 мМ NaH2PO4·2H2 O, pH 7,2) инкубируют с 300 нг моноклональных антител против белка р35 ортопоксвирусов, разведенных в фосфатно-солевом буфере с 0,1% Tween-20, либо с сыворотками доноров, разведенными 1:200 в том же буфере. Связавшиеся антитела проявляют конъюгатом антивидового моноклонального анти-IgG антитела мыши со щелочной фосфатазой (рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 Sigmaрекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 , США) в разведении 1:8000. Визуализацию иммунного комплекса проводят, добавляя 5-бромо-3-индолил фосфат и нитротетразолиевый голубой.

Способность рекомбинантного белка p35d взаимодействовать с сыворотками доноров, вакцинированных вирусом осповакцины, была продемонстрирована в иммуноферментном анализе (фиг.6). В лунки полистироловых планшетов («Медполимер», Россия) сорбировали различные концентрации рекомбинантного белка p35d, разведенного в фосфатно-солевом буфере, начиная со 100 нг/лунка с шагом 1:2. После удаления несвязавшегося антигена лунки трижды промывали фосфатно-солевым буфером. Участки неспецифического связывания насыщали раствором 0,2% Tween-20 в фосфатно-солевом буфере при 37°С в течение 1 ч, после чего лунки снова промывали трижды фосфатно-солевым буфером с 0,1% Tween-20, а затем инкубировали 1 час при 37°С с сыворотками доноров, вакцинированных вирусом осповакцины, разведенными 1:200 в фосфатно-солевом буфере с 0,1% Tween-20. Для сравнения брали сыворотку невакцинированного донора, разведенную аналогично. Лунки промывали трижды фосфатно-солевым буфером с 0,1% Tween-20, а затем трижды фосфатно-солевым буфером. Образовавшиеся иммунные комплексы выявляли конъюгатом антивидового моноклонального анти-IgG антитела мыши со щелочной фосфатазой (рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 Sigmaрекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 , США) в разведении 1:8000. После трехкратной промывки лунок фосфатно-солевым буфером с 0,1% Tween-20 и AP-буфером (100 мМ NaCl, 5 мМ MgCl2, 100 мМ Трис-HCl, pH 9,5) в лунки добавляли хромоген - пара-нитрофенилфосфат (по 1.05 мг) в АР-буфере.

Сохранение правильной конформации эпитопа белка p35 ортопоксвирусов, ответственного за связывание с вируснейтрализующими антителами, в рекомбинантном белке p35d исследуют в анализе конкурентного связывания вируса осповакцины и рекомбинантного белка p35d с моноклональным вируснейтрализующим антителом против белка р35 ортопоксвирусов [7] (фиг.7). В лунки полистироловых планшетов («Медполимер», Россия) сорбировали 200 нг/лунка вируса осповакцины, разведенного в фосфатно-солевом буфере. После удаления несвязавшегося антигена лунки трижды промывали фосфатно-солевым буфером. Участки неспецифического связывания насыщали раствором 0,2% Tween-20 в фосфатно-солевом буфере при 37°С в течение 1 ч, после чего лунки снова промывали трижды фосфатно-солевым буфером с 0,1% Tween-20. Моноклональное антитело в концентрации 3,5 нг предынкубировали 30 мин с различными концентрациями рекомбинантного белка p35d, начиная с 5 мг/мл с шагом 1:2, и вносили в лунки с предварительно сорбированным вирусом осповакцины. Иммунологические планшеты инкубировали 30 мин при 37°С, затем лунки промывали трижды фосфатно-солевым буфером с 0,1% Tween-20, а затем трижды фосфатно-солевым буфером. Образовавшиеся иммунные комплексы выявляли конъюгатом антивидового моноклонального анти-IgG антитела мыши со щелочной фосфатазой (рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 Sigmaрекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез   рекомбинантного белка p35d вируса оспы коров, штамм бактерий   escherichia coli - продуцент рекомбинантного белка p35d вируса   оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый   для создания тест-систем и конструирования субъединичных вакцин   против ортопоксвирусных инфекций, патент № 2511037 , США) в разведении 1:8000. После трехкратной промывки лунок фосфатно-солевым буфером с 0,1% Tween-20 и AP-буфером в лунки добавляли хромоген - пара-нитрофенилфосфат (по 1.05 мг) в АР-буфере. Результаты подтвердили специфичность связывания моноклональных антител с рекомбинантным белком p35d вируса оспы коров и показали наличие конкуренции между этим белком и вирусом осповакцины за общий сайт связывания (фиг.7).

Из изложенного выше видно, что получены плазмидная ДНК и бактериальный штамм-продуцент, обеспечивающие экспрессию рекомбинантного белка p35d вируса оспы коров, имеющего молекулярную массу около 30 кДа, состоящего из N-концевого олигопептида MRGSHHHHHHGSGG и фрагмента белка р35 вируса оспы коров с 1 по 239 аминокислотный остаток, включающий аминокислотную последовательность, кодируемую нуклеотидной последовательностью SEQ ID NO: 1. (фиг. 1). Рекомбинантный белок p35d сохраняет конформацию эпитопа, узнаваемого вируснейтрализующими антителами против белка р35 ортопоксвирусов и способен взаимодействовать с сыворотками доноров, вакцинированных вирусом осповакцины, и моноклональными вируснейтрализующими антителами против белка р35 ортопоксвирусов.

ИСТОЧНИКИ ИНФОРМАЦИИ

1. Маренникова С.С., Щелкунов С.Н. Патогенные для человека ортопоксвирусы. - М.: КМК Scientific Press Ltd., 1998. - 386 с.

2. Benhnia M.R., McCausland M.M., Hua-Poo Su, Singh K., Hoffmann J., Davies D.H., Felgner P.L., Head S., Sette A., Garboczi D.N., Crotty S. Redundancy and Plasticity of Neutralizing Antibody Responses Are Cornerstone Attributes of the Human Immune Response to the Smallpox Vaccine // Journal of Virology. - 2008. - V. 82. - N. 7. - P. 3751-3768.

3. Jones-Trower A., Garcia A., Meseda C.A., He Y., Weiss C., Kumar A., Weir J.P. and Merchlinsky M. Identification and preliminary characterization of vaccinia virus (Dryvax) antigens recognized by vaccinia immune globulin // Virology.- 2005. - V. 343. - P.128-140.

4. Demkovicz W., Maa J., Esteban M. Identification and characterization of Vaccinia virus genes encoding proteins that are highly antigenic in animals and are immunodominant in vaccinated humans // J. Virol. - 1992. - V. 66. - P. 386-398.

5. Davies D.H., McCausland M.M., Valdez C., Huynh D., Hernandez J.E., Mu Y., Hirst S., Villarreal L., Felgner P.L., Crotty S.. Vaccinia virus H3L envelope protein is a major target of neutralizing antibodies in humans and elicits protection against lethal challenge in mice // J Virol. - 2005. - V. 79. - P. 11724-11733.

6. Zinoviev V.V., Tchikaev N.A., Chertov O.Yu., Malygin E.G. Identification of the gene encoding vaccinia virus immunodominant protein p35 // Gene. - 1994. - V.147. - P. 209-214.

7. N.Tikunova, Dubrovskaya V., Morozova V., Yun T., Khlusevich Y., Bormotov N., Laman A., Brovko F., Shvalov A., Belanov E. The neutralizing human ecombinant antibodies to pathogenic Orthopoxviruses derived from a phage display immune library // Virus Research. - 2012. - V. 163. - P. 141-150.

8. Маниатис Т., Фрич Э., Сэмбрук Д. Молекулярное клонирование. М.: Мир, 1984. (Maniatis T., Fritsch E.E., Sambrook J. Molecular cloning. Cold Spring Harbor Laboratory. N. Y.: Cold Spring Harbor 1982.

9. Bradford M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. // Anal. Biochem. - 1976. - V.72. - P. 248-254.

10. Towbin H., Staehlin T., Gorden J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications // Proc. Natl. Acad. Sci. USA. - 1979. - V. 76. - P. 4350.

ФОРМУЛА ИЗОБРЕТЕНИЯ

1. Рекомбинантная плазмидная ДНК pQE-p35d, обеспечивающая синтез рекомбинантного белка p35d вируса оспы коров в клетках Escherichia coli, молекулярной массой 2,7 МДа и размером 4156 п.о. и содержащая в соответствии с физической и генетической картой плазмиды, приведенной на фиг. 2:

- плазмидный вектор pQE30, раскрытый по BamHI и PstI сайтам и включающий сайт инициации репликации ColE1, фрагмент, кодирующий олигопептид MRGSHHHHHHG, и уникальные сайты рестрикции BamHI (146), PstI (879);

- BamHI и PstI - фрагмент размером 717 п.о., кодирующий фрагмент белка р35 вируса оспы коров с 1 по 239 аминокислотный остаток, причем нуклеотидная последовательность и кодируемая ею аминокислотная последовательность фрагмента плазмиды pQE-p35d, кодирующая N-концевой олигопептид MRGSHHHHHHGSGG и фрагмент белка р35 вируса оспы коров с 1 по 239 аминокислотный остаток SEQ ID NO:1 представлены на фиг. 1,а;

2. Штамм бактерий Escherichia coli XL1Blue/pQE-p35d В-1252 - продуцент рекомбинантного белка p35d вируса оспы коров, содержащий рекомбинантную плазмидную ДНК pQE-p35d по п.1 и депонированный в Коллекции бактерий, бактериофагов и грибов Федерального бюджетного учреждения науки Государственный научный центр вирусологии и биотехнологии «Вектор» под регистрационным номером В-1252.

3. Рекомбинантный белок p35d вируса оспы коров, используемый для создания тест-систем и конструирования субъединичных вакцин против ортопоксвирусных инфекций, имеющий молекулярную массу около 30 кДа и состоящий из N-концевого олигопептида MRGSHHHHHHGSGG и фрагмента белка р35 вируса оспы коров с 1 по 239 аминокислотный остаток, включающий аминокислотную последовательность, кодируемую нуклеотидной последовательностью SEQ ID NO:1, представленную на фиг. 1,б.


Скачать патент РФ Официальная публикация
патента РФ № 2511037

patent-2511037.pdf
Патентный поиск по классам МПК-8:

Класс C12N15/70 векторы или системы экспрессий, специально приспособленные для Ecoli

Патенты РФ в классе C12N15/70:
рекомбинантная днк, кодирующая гранулоцитарный колониестимулирующий фактор человека (g-csf) и рекомбинантная плазмида рas017, обеспечивающая синтез g-csf в клетках escherichia coli -  патент 2529363 (27.09.2014)
рекомбинантная днк, кодирующая гибридный белок эпидермального фактора роста человека слитого последовательностью глутатион-s-трансферазы (gst-hegf) и рекомбинантная плазмида pas007, обеспечивающая синтез gst-hegf в клетках escherichia coli -  патент 2521515 (27.06.2014)
рекомбинантная плазмидная днк pg1-rm7, обеспечивающая синтез гибридного белка g1-rm7, и гибридный белок, связывающий фактор некроза опухолей и обладающий биолюминесцентной активностью -  патент 2513686 (20.04.2014)
способ получения рекомбинантного антигена g2 хантавируса добрава в клетках e.coli -  патент 2509805 (20.03.2014)
рекомбинантный полипептид а2, селективно связывающий hsa, рекомбинантная днк pa2, кодирующая hsa-связывающую часть полипептида a2, его продуцент - рекомбинантный штамм escherichia coli m15-a2, содержащий рекомбинантную плазмидную днк pqe 32-pa2, обеспечивающую получение полипептида a2 и применение полипептида а2 для диагностики микроальбуминурии и выделения hsa из сыворотки крови -  патент 2506271 (10.02.2014)
способ получения рекомбинантного антигена g2 хантавируса добрава в клетках e. coli -  патент 2495938 (20.10.2013)
система экспрессии компонентов ортогональной трансляции в эубактериальной клетке-хозяине -  патент 2467069 (20.11.2012)
штамм клеток e.coli bl21(de3)plyss, клон ptt9/asfvp30, содержащий рекомбинантную плазмиду со встройкой участка гена ср204l вируса африканской чумы свиней, кодирующего конформационный эпитоп белка p30, для изготовления диагностических препаратов -  патент 2463343 (10.10.2012)
рекомбинантная плазмидная днк pтв323, кодирующая гибридный полипептид gst-дельтамрт64 со свойствами видоспецифичного микобактериального антигена мрт64 (мрв64), рекомбинантный штамм бактерий escherichia coli - продуцент гибридного полипептида gst-дельтамрт64 и рекомбинантный полипептид gst-дельтамрт64 -  патент 2458130 (10.08.2012)
состав полиэпитопного белка для индукции иммунного ответа против вируса ящура -  патент 2453557 (20.06.2012)

Класс C12N15/09 метод рекомбинантных ДНК

Патенты РФ в классе C12N15/09:
рекомбинантная плазмидная днк ppa-oprf-eta, кодирующая синтез рекомбинантного белка oprf-eta pseudomonas aeruginosa, штамм escherichia coli pa-oprf-eta - продуцент рекомбинантного белка oprf-eta pseudomonas aeruginosa и способ получения рекомбинантного белка oprf-eta pseudomonas aeruginosa -  патент 2529359 (27.09.2014)
модифицированная дрожжевая двугибридная система для эффективного исследования взаимодействия между белками и их доменами. -  патент 2529356 (27.09.2014)
нуклеиноваяя кислота, обладающая активностью гена фосфатазы фосфатидной кислоты (варианты), белок, рекомбинантный вектор, трансформант и способ получения композиции жирной кислоты -  патент 2528875 (20.09.2014)
способ скрининга с использованием фактора, являющегося мишенью для талидомида -  патент 2528380 (20.09.2014)
слитый белок тиоредоксина и домена 4 инфестина, способ его получения, экспрессионная плазмидная днк, кодирующая слитый белок, и бактерия рода escherichia coli, трансформированная такой плазмидной днк -  патент 2528251 (10.09.2014)
полинуклеотид, кодирующий гомолог ацил-соа-синтетазы, и его применение -  патент 2528248 (10.09.2014)
тест-система для скрининга ингибиторов протеинкиназы gsk3 ; человека -  патент 2528059 (10.09.2014)
способ и набор для детекции микроорганизмов -  патент 2527897 (10.09.2014)
способ получения наноматериала на основе рекомбинантных жгутиков археи halobacterium salinarum -  патент 2526514 (20.08.2014)
рекомбинантная псевдоаденовирусная частица на основе генома аденовируса человека 5 серотипа, продуцирующая гемагглютинин вируса гриппа штамма a/brisbane/59/2007(h1n1) и способ ее использования -  патент 2523599 (20.07.2014)

Класс C12N15/39 Poxviridae, например вирусы коровьей оспы, оспы человека

Патенты РФ в классе C12N15/39:
средство для нейтрализации вируса натуральной оспы -  патент 2515905 (20.05.2014)
рекомбинантная плазмидная днк pgem-puro-ds-apo, содержащая синтетический ген апоптина, фланкированный последовательностями генома вируса осповакцины из района c10l-c12l, и рекомбинантный штамм vvdgf-apos24/2 вируса осповакцины, продуцирующий апоптин -  патент 2492238 (10.09.2013)
синтетические олигонуклеотидные праймеры и способ выявления днк вируса инфекционной анемии цыплят с помощью синтетических олигонуклеотидных праймеров в полимеразной цепной реакции в режиме реального времени -  патент 2481403 (10.05.2013)
рекомбинантные плазмидные днк pqe-60-tnfr-crmb-ind-67 и pfastbac1-g2r-dsecret, содержащие фрагмент генома вируса натуральной оспы, кодирующий фактор некроза опухолей связывающий домен белка crmb и штамм бакуловируса bv/g2r-dsecret, продуцирующий секретируемый фно-связывающий белок crmb вируса натуральной оспы с делетированным secret-доменом -  патент 2471869 (10.01.2013)
набор олигонуклеотидных праймеров и флуоресцентномеченых зондов для видоспецифичной экспресс-идентификации ортопоксвирусов на основе мультиплексной пцр в реальном времени -  патент 2427648 (27.08.2011)
рекомбинантная плазмидная днк pfastbac-g2r-igg, содержащая фрагмент генома вируса натуральной оспы, кодирующий фактор некроза опухолей связывающий белок, и фрагмент генома человека, кодирующий участок тяжелой цепи иммуноглобулина g, и штамм бакуловируса bvg2rigg, продуцирующий растворимый химерный белок, состоящий из белка вируса натуральной оспы, связывающего фактор некроза опухолей, и фрагмента тяжелой цепи иммуноглобулина g человека -  патент 2376375 (20.12.2009)
набор олигонуклеотидов-праймеров, биочип и способ видовой идентификации ортопокс- и герпесвирусов, патогенных для человека -  патент 2318875 (10.03.2008)
рекомбинантная плазмидная днк pfastbac-b9rz, содержащая фрагмент генома вируса оспы обезьян, кодирующий интерферон гамма-связывающий белок, и штамм бакуловируса bvb9rz, продуцирующий растворимый интерферон гамма-связывающий белок вируса оспы обезьян -  патент 2318874 (10.03.2008)
комбинаторная фагмидная библиотека одноцепочечных антител человека, обогащенная антителами против вируса осповакцины, рекомбинантная фагмидная днк phen-2a8, содержащая уникальный ген одноцепочечного антитела человека, способного нейтрализовать вирус осповакцины и вирус оспы коров, и искусственное одноцепочечное антитело человека 2a8, способное нейтрализовать вирус осповакцины и вирус оспы коров -  патент 2311927 (10.12.2007)
модифицированный вариант вируса коровьей оспы ankara -  патент 2290438 (27.12.2006)

Класс C07K14/07 вирус натуральной; вирус коровьей оспы

Класс C12N1/21 модифицированные введением чужеродного генетического материала

Патенты РФ в классе C12N1/21:
рекомбинантный штамм бактерий escherichia coli n41 (pbpun4/mr)-продуцент сайт-специфической эндонуклеазы рестрикции bpun4i -  патент 2529362 (27.09.2014)
рекомбинантная плазмидная днк ppa-oprf-eta, кодирующая синтез рекомбинантного белка oprf-eta pseudomonas aeruginosa, штамм escherichia coli pa-oprf-eta - продуцент рекомбинантного белка oprf-eta pseudomonas aeruginosa и способ получения рекомбинантного белка oprf-eta pseudomonas aeruginosa -  патент 2529359 (27.09.2014)
нуклеиноваяя кислота, обладающая активностью гена фосфатазы фосфатидной кислоты (варианты), белок, рекомбинантный вектор, трансформант и способ получения композиции жирной кислоты -  патент 2528875 (20.09.2014)
слитый белок тиоредоксина и домена 4 инфестина, способ его получения, экспрессионная плазмидная днк, кодирующая слитый белок, и бактерия рода escherichia coli, трансформированная такой плазмидной днк -  патент 2528251 (10.09.2014)
тест-система для скрининга ингибиторов протеинкиназы gsk3 ; человека -  патент 2528059 (10.09.2014)
рекомбинантный штамм бактерий escherichia coli - продуцент янтарной кислоты (варианты) и способ получения янтарной кислоты с использованием этого штамма -  патент 2528056 (10.09.2014)
проникающие в клетку пептиды и полипептиды для клеток микроорганизмов -  патент 2526511 (20.08.2014)
плазмида 40nagal, определяющая синтез -n-ацетилгалактозаминидазы -alnagal, штамм e.coli rosetta(de3)/40nagal - продуцент химерного белка, включающего аминокислотную последовательность рекомбинантной -n-ацетилгалактозаминидазы -alnagal, и способ ее получения -  патент 2525682 (20.08.2014)
антитело к epha2 -  патент 2525133 (10.08.2014)
штамм бактерий escherichia coli - продуцент рекомбинантного флагеллина -  патент 2524133 (27.07.2014)

Класс A61K39/285 вирусы натуральной или коровьей оспы



Наверх