рекомбинантный штамм бактерий bacillus licheniformis - продуцент термостабильной липазы

Классы МПК:C12N1/21 модифицированные введением чужеродного генетического материала
C12N9/20 расщепление триглицерида, например с помощью липазы
C12R1/10 Bacillus licheniformis
Автор(ы):, , , ,
Патентообладатель(и):Федеральное государственное унитарное предприятие "Государственный научно-исследовательский институт генетики и селекции промышленных микроорганизмов" (ФГУП "ГосНИИгенетика") (RU)
Приоритеты:
подача заявки:
2012-10-10
публикация патента:

Изобретение относится к биотехнологии и представляет собой штамм бактерий Bacillus licheniformis ВКПМ В-11302 - продуцент термостабильной липазы. При ферментации полученного штамма в 3 л лабораторном ферментере активность фермента в культуральной жидкости достигает уровня 500 ЕД/мл. Изобретение позволяет получать термостабильную липазу с высокой степенью эффективности. 3 ил., 5 пр.

рекомбинантный штамм бактерий bacillus licheniformis - продуцент   термостабильной липазы, патент № 2500812 рекомбинантный штамм бактерий bacillus licheniformis - продуцент   термостабильной липазы, патент № 2500812 рекомбинантный штамм бактерий bacillus licheniformis - продуцент   термостабильной липазы, патент № 2500812

Формула изобретения

Рекомбинантный штамм Bacillus licheniformis ВКПМ В-11302 - продуцент термостабильной липазы.

Описание изобретения к патенту

Изобретение относится к микробиологии и биотехнологии и касается штамма Bacillus lichensformis - продуцента фермента термостабильной липазы.

Липазы - ферменты, осуществляющие гидролиз триацилглицеридов с образованием жирных кислот и глицерина, находят применение в пищевой промышленности, бытовой химии, косметике и многих других областях. При этом большинство промышленных процессов, в которых используются липазы, проводят при температурах, превышающих 45°С, следовательно, особый интерес вызывают термостабильные липазы. Кроме того, так как липазы, наряду с протеазами и целлюлазами, входят в состав экологичных моющих средств, для них важна способность к работе в щелочной области pH.

Высокотермостабильные липазы, температурный оптимум которых превышает 70°C и достигает 95°C и найдены у экстремально термофильных анаэробных бактерий Thermosyntropha lipolytica [Journal of Industrial Microbiology & Biotechnology. - 2009. - V.36. - N.10. - P.1281-71], Caldanaerobacter subterraneus, Thermounuerobacler thermohydrosulfwicus [Extremophiles. - 2009. - V.13. - N.5. - P.769-83]. Fervidobacterium changbaicum [Appi Microbiol Biotechnol. - 2011. - V.89. - N.5. - P.1463-73]. Однако, существенным недостатком охарактеризованных ферментов, является их низкая удельная активность - менее 60 ед./мг белка.

Термофильные липазы, оптимум активности которых лежит в диапазоне температур 55-70°C и pH 8-10 выделены из умеренно термофильных аэробных бактерий родов Bacillus [Molecular and Cellular Biochemistry. - 2006. - V.290. - N.1-2. - P.17-22, Protein Expr Purif. - 2009. - V.68. - N.2. - P.161-6] и Geobacillus (ранее классифицируемые как Bacillus): [Journal of Molecular Catalysis B: Enzymatic. - 2003. - V.22. - N.5-6. - P.307-13, Methods in Enzymology. - 1997. - V.284. - P.194-220. Molecular Biotechnology. - 2008. - V.42. - N.1. - P.75-83].

Из описанных в литературе термостабильных липаз наибольшей удельной активностью обладает липаза BTL2 из штамма Geobacillus thermocalenulatus DSM 730, температурный оптимум специфической активности которой лежит в диапазоне 60-75°С, Липаза отличается высокой стабильностью в присутствии детергентов (кроме SDS) и органических растворителей (метанол, ацетон, изопропанол). Удельная активность очищенного фермента составляет 55000 единиц/мг белка. Однако, продукция липазы природным штаммом очень мала, в связи с чем для получения ферменты целесообразно использовать рекомбинантные продуценты

Экспрессия гена липазы в клетках E.coli под контролем сильного температуроиндуцибельного промотора рекомбинантный штамм бактерий bacillus licheniformis - продуцент   термостабильной липазы, патент № 2500812 PL. приводит к тому, что большая часть фермента транспортируется в периплазму [Journal of Biotechnology. - 1997. - V.56. - P.89-102]. Активность фермента достигает 590 единиц/мл по трибутирину. Однако для получения фермента требуется стадия разрушения клеток, что приводит к удорожанию стоимости конечного продукта.

Экспрессия гена термостабильной липазы в P.pastoris приводит к секреции активного фермента в культуральную жидкость (до 309 ед/мл) [Protein Expression and Purification. - 2003. - V.28. - N.1. - P.102-1]. Однако при этом удельная активность фермента по трибутирату составляет 23000 единиц/мг (против 55000 единиц/мл у нативного фермента), а культивирование этого продуцента требует присутствия метанола в качестве индуктора и дорогих сред, что делает его использование не выгодным.

Интерес к созданию высокоэффективных продуцентов липазы на основе Bacillus licheniformis связан с достаточно хорошей генетической изученностью этого объекта и тем, что данный вид бактерий удобен для промышленной ферментации. В. licheniformis привлекает внимание биотехнологов и генетиков также своей термотолерантностью, открывающей возможность культивирования при повышенных температурах (до 60°C), что препятствует контаминации культуры в производственном ферментере.

Кроме того, работа со штаммами В. licheniformis не требует специальных мер предосторожности, так как данный вид бактерий относится к микроорганизмам, непатогенным для человека.

Технической задачей заявляемого изобретения является расширение арсенала рекомбинантных микроорганизмов, продуцирующих термостабильную липазу.

Задача решена путем конструирования рекомбинантного штамма бактерий Bacillus lichemformis ВКПМ В-11302 - продуцента термостабильной липазы.

Рекомбинантный штамм Bacillus lichemformis ВКПМ В-11302 получен из штамма Bacillus lichemformis 28KA (ВКПМ В-3039) посредством трансформации последнего экспрессионной репликативной плазмидой, полученной на основе вектора pHY300PLK (J. Bacteriol (1983), 153, 813-821), названной p-bt1 и содержащей ген btl2, кодирующий термостабильную липазу BTL2 из штамма Geohacillus thermocatenulatus DSM 730.

Заявляемый штамм Bacillus lichemformis депонирован во Всероссийской коллекции промышленных микроорганизмов (ВКПМ) по адресу 117545 Москва, 1-ый Дорожный проезд, д.1 и имеет регистрационный номер ВКПМ В-11302.

Штамм Bacillus lichemformis ВКПМ В-11302 характеризуется следующими признаками:

Культурально-морфологические признаки.

Грамм-положительная спорообразующая палочковидная бактерия. Суточная культура в жидкой LB среде (мас.%: дрожжевой экстракт - 0,5, пептон - 1, NaCl - 1, вода - остальное) представлена подвижными цепочками из 2-3-х клеток палочковидными клетками размером 0,6-0,8 и 0,2-0,3 мкм. К третьим суткам цепочки распадаются и образуются овальные споры, не превышающие размер клетки, расположенные центрально. При росте на агаризованной LB среде образует колонии неправильной формы, слизистые, гладкие, непрозрачные, 2-5 мм в диаметре.

Физиолого-биохимические признаки. Облигатный аэроб. Сахара не сбраживает. Ассимилирует: сахарозу, D-глюкозу, L-арабинозу, D-ксилозу. D-маннитол. Гидролизует казеин и крахмал. Отличается пониженной протеолитической активностью и способностью к восстановлению нитрата.

Оптимальное значение pH для роста 5,5-8,0. Способен к расту при 55°C. Оптимальная температура роста 30-40°C.

Заявляемый штамм при выращивании в колбах на среде LB. способен продуцировать термостабильную липазу с активностью до 250 ЕД/мл культуральной жидкости, при выращивании в лабораторном ферментере - с активностью до 500 ЕД/мл культуральной жидкости

Изобретение проиллюстрировано следующими фигурами графического изображения:

Фиг.1 Электрофореграмма ПЦР-анализа исследуемых штаммов с помощью проверочных праймеров.

Фиг.2 График зависимости активности рекомбинантной и нативной термостабильной липазы от температуры

Фиг.3 График зависимости активности рекомбинантной и нативной термостабильной липазы от pH инкубационной среды

Получение и культивирование штамма Bacillus licheniformis ВКПМ В-11302 подтверждено следующими примерами.

Пример 1. Получение штамма Bacillus licheniformis ВКПМ В-11302. Трансформацию Bacillus licheniformis осуществляют методом введения молекул ДНК в бактериальные протопласты под воздействием осмотического давления раствора полиэтиленгликоля (ПЭГ).(Harwood, С.R. & Cutting, S.М. (1990). Molecular Biological Methods for Bacillus. New York: Wiley.)

Для приготовления компетентных клеток используют штамм Bacillus licheniformis 28KA ВКПМ В- 3039. В качестве ДНК используют 1 мкг ДНК плазмиды p-bt1 Селекцию трансформантов ведут на агаризованной питательной среде LB с добавлением антибиотика эритромицина.

Наличие целевого рекомбинантного гена в составе плазмид трансформантов подтверждают методом ПЦР-анализа.

Из бактериальныех клонов, полученных в результате генетической трансформации, стандартными методами выделяют плазмидную ДНК, используемую в качестве матрицы для проведения полимеразной цепной реакции с использованием специфических проверочных праймеров.

Последовательность проверочных праймеров:

bt1-f AAACATATGATGAAAGGCTGCCGGGTGATGGTT

bt1-r AAATCGCGAATACAACTCAGGTGCTTGCT

Режим реакции ПЦР:

95°С - 3 мин. - 1 цикл

35 циклов:

95°С - 30 сек.

60°С - 30 сек.

72°С - 60 сек.

72°С - 5 мин - 1 цикл.

Для контроля величины фрагментов ДНК при электрофорезе используют молекулярный маркер O'GeneRuler 100 bp DNA Ladder (фиг.1 линия 1 размер фрагментов 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1700, 2000. 3000 п.н, сверху вниз)

Наработка фрагментов размером 420 п.н. при использовании проверочных праймеров bt1-f и bt1-r подтверждает присутствие целевого рекомбинантного гена btl в составе плазмид полученных клонов Bacillus Ucheniformis 28KA/ p-bt1 (фиг.1, линии 2 и 3)

Трансформаные клоны культивируют в жидкой среде в пробирках. Ферментацию проводят при 37°С на качалке (250 об/мин) в питательнй среде LB в пробирках (50 мл) с рабочим объемом 10 мл. Посев осуществляют бактериологической петлей.

Ферментацию продолжают в течение 24 часов. Специфическую активность термостабильной липазы определяют спектрофотометрическим методом по гидролизу хромогенного субстрата пира-нитрофенилбутирата (FEMS Yeast Res - 2002 - N.2 - Р.371-379).

Липолитическая активность характеризует способность фермента катализировать расщепление субстрата иара-нитрофенилбутирата до иорд-нитрофенола и бутановой кислоты.

За единицу липолитической активности принимают такое количество фермента, которое за 1 мин гидролизует 1 мкМоль субстрата с выделением эквимолярного количества нитрофенола и жирных кислот

По результатам ферментации отбирают заявляемый штамм Bacillus licheniformis ВКПМ В-11302, который при культивировании в среде LB. позволяет получать термостабильную липазу с активностью 240 ЕД/мл культуральной жидкости.

Пример 2. Культивирование штамма Bacillus licheniformis ВКПМ B-l 1302 в лабораторных условиях.

Культуру Bacillus licheniformis ВКПМ В-11302. наращивают в 5 мл среды LB в течение 20 часов при 37°C с аэрацией на качалке (250 об/мин)

Инокулят переносят в колбу объемом 750 мл с 45 мл свежей среды LB и растят при 37°C в течении 24 часов с аэрацией на качалке (250 об/мин).

Через 5, 10, 15, 20 и 24 часа культивирования отбирают пробы растущей бактериальной культуры, осаждают клетки методом центрифугирования и культуральную жидкость используют для проведения анализа специфической липазной активности.

При ферментации в колбах в питательной среде штамм Bacillus licheniformis ВКПМ B-11302 синтезирует термостабильную липазу обладающую активностью 240 ЕД/мл культуральной жидкости.

Пример 3. Культивирование штамма Bacillus licheniformis ВКПМ B-11302 в 3 л лабораторном ферментере.

Для получения посевного материала в пробирках культуру Bacillus licheniformis ВКПМ B-11302. наращивают в 5 мл среды LB в течение примерно 20 часов при 37°C с аэрацией (250 об/мин). Затем культуру из пробирки переносят в колбу с 50 мл среды LB. Культивируют в шейкере-инкубаторе (250 об/мин) при 37°С в течение 24 часов.

Полученный посевной материал переносят в 3 л ферментер и растят 48 часов в 1 литре LB среды.

Через 12, 24, 36 и 48 часов культивирования отбирают пробы растущей бактериальной культуры, осаждают клетки методом центрифугирования и культуральную жизкость используют для проведения анализа специфической липазной активности.

При ферментации в 3 л лабораторном ферментере штамм ВКПМ B-11302 синтезирует термостабильную липазу с активностью 500 ЕД/мл культуральной жидкости.

Пример 4. Исследование температурного оптимума рекомбинантной термостабильной липазы.

Для определения температурного оптимума рекомбинантной термостабильной липазы измеряют специфическую активности фермента при разных значениях температур по гидролизу пара-нитрофенилбутирата. Полученные результаты приведены на фиг.2 (кривая 2) в сравнении с аналогичными значениями нативной термостабильной липазы BTL2 из Geobacillus thermocatenulatus DSM 730 (кривая 1).

Показано, что температурный оптимум действия рекомбинантной термостабильной липазы находится в диапазоне 45-60°С, в то время как температурный оптимум нативной термостабильной липазы лежит в диапазоне 65-72°С.

Пример 5. Исследование оптимума pH рекомбинантной термостабильной липазы.

Активность термостабильной липазы измеряют при разных значениях pH инкубационной среды по гидролизу пара-нитрофенилбутирата. Полученные данные приведенные на фиг.3 (кривая 2) в сравнении с аналогичными значениями нативной термостабильной липазы BTL2 из Geobacillus thermocatenulatus DSM 730 (кривая 1). показывают, что оптимум действия pH рекомбинантной термостабильной липазы находится в диапазоне pH от 7,5 до 8,5 и практически совпадает с оптимумом рН нативной термостабильной липазы.

Таким образом, заявляемый штамм Bacillus lichemformis ВКПМ В-1130 продуцирует термостабильную липазу обладающую активностью до 500 ед/мл культуральной жидкости, при этом полученный фермент сохраняет промышленно ценные свойства нативного фермента.

Скачать патент РФ Официальная публикация
патента РФ № 2500812

patent-2500812.pdf

Класс C12N1/21 модифицированные введением чужеродного генетического материала

рекомбинантный штамм бактерий escherichia coli n41 (pbpun4/mr)-продуцент сайт-специфической эндонуклеазы рестрикции bpun4i -  патент 2529362 (27.09.2014)
рекомбинантная плазмидная днк ppa-oprf-eta, кодирующая синтез рекомбинантного белка oprf-eta pseudomonas aeruginosa, штамм escherichia coli pa-oprf-eta - продуцент рекомбинантного белка oprf-eta pseudomonas aeruginosa и способ получения рекомбинантного белка oprf-eta pseudomonas aeruginosa -  патент 2529359 (27.09.2014)
нуклеиноваяя кислота, обладающая активностью гена фосфатазы фосфатидной кислоты (варианты), белок, рекомбинантный вектор, трансформант и способ получения композиции жирной кислоты -  патент 2528875 (20.09.2014)
слитый белок тиоредоксина и домена 4 инфестина, способ его получения, экспрессионная плазмидная днк, кодирующая слитый белок, и бактерия рода escherichia coli, трансформированная такой плазмидной днк -  патент 2528251 (10.09.2014)
тест-система для скрининга ингибиторов протеинкиназы gsk3 ; человека -  патент 2528059 (10.09.2014)
рекомбинантный штамм бактерий escherichia coli - продуцент янтарной кислоты (варианты) и способ получения янтарной кислоты с использованием этого штамма -  патент 2528056 (10.09.2014)
проникающие в клетку пептиды и полипептиды для клеток микроорганизмов -  патент 2526511 (20.08.2014)
плазмида 40nagal, определяющая синтез -n-ацетилгалактозаминидазы -alnagal, штамм e.coli rosetta(de3)/40nagal - продуцент химерного белка, включающего аминокислотную последовательность рекомбинантной -n-ацетилгалактозаминидазы -alnagal, и способ ее получения -  патент 2525682 (20.08.2014)
антитело к epha2 -  патент 2525133 (10.08.2014)
штамм бактерий escherichia coli - продуцент рекомбинантного флагеллина -  патент 2524133 (27.07.2014)

Класс C12N9/20 расщепление триглицерида, например с помощью липазы

биокатализатор для переэтерификации жиров и способ его получения -  патент 2528778 (20.09.2014)
способ получения сложных метиловых эфиров жирных кислот с использованием смеси липаз (варианты) -  патент 2520093 (20.06.2014)
рекомбинантная плазмидная днк pyp2, кодирующая ферментативно-активную часть полипептида липазы, белка пищеварительного тракта пчелиной огневки -  патент 2507261 (20.02.2014)
способ получения лектинов, обладающих противокандидной активностью -  патент 2486241 (27.06.2013)
способ получения фосфатидилсерина -  патент 2482186 (20.05.2013)
варианты липолитического фермента -  патент 2474611 (10.02.2013)
способ получения твердого масла -  патент 2473694 (27.01.2013)
способ восстановления переэтерификационной активности липазы и способ переэтерификации -  патент 2465329 (27.10.2012)
рекомбинантный штамм дрожжей yarrowia-lipolytica - продуцент липазы -  патент 2451075 (20.05.2012)
ферментативная переэтерификация масла -  патент 2415178 (27.03.2011)

Класс C12R1/10 Bacillus licheniformis

штамм bacillus licheniformis, обладающий выраженным антагонизмом по отношению к salmonella typhi, staphyloccus aureus, listeria monocytogenes и резистентностью к стрептомицину и налидиксовой кислоте -  патент 2501851 (20.12.2013)
штамм bacillus licheniformis вкм b-2713d, обладающий выраженным антагонизмом по отношению к salmonella typhi, staphyloccus aureus, listeria monocytogenes и резистентностью к стрептомицину и налидиксовой кислоте -  патент 2501849 (20.12.2013)
способ получения комплексного кормового препарата с продуцентом лизина на основе corynebacterium glutamicum -  патент 2499829 (27.11.2013)
штамм bacillus licheniformis для получения гистидиндекарбоксилазы -  патент 2485176 (20.06.2013)
микроорганизмы, микробные фосфатные удобрения и способы изготовления микробных фосфатных удобрений -  патент 2443776 (27.02.2012)
пептид lana1, выделенный из бактерии bacillus licheniformis vk21, обладающий антимикробным действием -  патент 2408732 (10.01.2011)
штамм бактерий bacillus licheniformis вкм в-2396 d - продуцент термостабильной альфа-амилазы -  патент 2324734 (20.05.2008)
Наверх