рекомбинантная плазмида pol-dsred2, кодирующая белки oct4 и lin28 человека и флуоресцентный белок dsred2, предназначенная для получения индуцированных плюрипотентных стволовых клеток человека

Классы МПК:C12N15/00 Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев
C12N15/12 гены, кодирующие животные белки
C12P21/02 с известной последовательностью из двух или более аминокислотных остатков, например глутатиона
Автор(ы):, , ,
Патентообладатель(и):Федеральное государственное бюджетное учреждение "Новосибирский научно-исследовательский институт патологии кровообращения имени академика Е.Н. Мешалкина" Министерства здравоохранения Российской Федерации (ФГБУ "ННИИПК им. акад. Е.Н. Мешалкина" Минздрава России) (RU),
Учреждение Российской академии наук Институт цитологии и генетики Сибирского отделения РАН (RU),
Учреждение Российской академии наук Институт химической биологии и фундаментальной медицины Сибирского отделения РАН (RU)
Приоритеты:
подача заявки:
2011-12-08
публикация патента:

Изобретение относится к области генной инженерии, молекулярной и клеточной биологии. Предложена плазмидная генетическая конструкция pOL-DsRed2, построенная на основе плазмидного вектора pIRES (Clontech), в который помещены фрагменты кДНК генов ОСТ4 и LIN28 человека, соединенные нуклеотидной последовательностью, кодирующей F2А-пептид, и кДНК гена, кодирующая флуоресцентный белок DsRed2. Изобретение обеспечивает одновременную трансляцию белков ОСТ4 и LIN28 человека и флуоресцентного белка DsRed2 при получении индуцированных плюрипотентных стволовых клеток человека и животных в медицине и ветеринарии. 2 з.п. ф-лы, 1 табл., 1 ил.

рекомбинантная плазмида pol-dsred2, кодирующая белки oct4 и lin28   человека и флуоресцентный белок dsred2, предназначенная для получения   индуцированных плюрипотентных стволовых клеток человека, патент № 2495126

Формула изобретения

1. Рекомбинантная плазмида pOL-DsRed2, кодирующая белки ОСТ4 и LIN28 человека и флуоресцентный белок DsRed2, предназначенная для получения индуцированных плюрипотентных стволовых клеток человека, представляющая собой генетическую конструкцию на основе плазмиды pIRES, содержащая следующие конструктивные элементы: фрагмент ДНК, кодирующий белки ОСТ4 и LIN28 человека, включающий последовательность, кодирующую F2A, расположенную между последовательностями ОСТ4 и LIN28, встроен в сайт рестрикции EcoR I в полилинкер А плазмиды pIRES, размер встройки 1888 пар нуклеотидов, и фрагмент ДНК, кодирующий флуоресцентный белок DsRed2, встроенный в сайт ХЬа I полилинкера В плазмиды pIRES; транскрипция полицистронной мРНК OCT4-F2A-LIN28-IRES-DsRed2 осуществляется с конститутивного промотора р CMV IE.

2. Рекомбинантная плазмида pOL-DsRed2 по п.1, где разделение нуклеотидных последовательностей элементами F2A и IRES позволяет экспрессировать три белка с одной плазмиды одновременно.

3. Рекомбинантная плазмида pOL-DsRed2 по п.1, где фрагмент ДНК, кодирующий белки ОСТ4 и LIN28 человека, запускает репрограммирование клеток для получения индуцированных плюрипотентных стволовых клеток человека, а фрагмент ДНК, кодирующий флуоресцентный белок DsRed2, является маркером трансфекции клеток и последующей элиминации плазмидной ДНК.

Описание изобретения к патенту

Изобретение относится к области генной инженерии, молекулярной и клеточной биологии, биотехнологии и может быть использовано для получения индуцированных плюрипотентных стволовых клеток человека и животных.

Индуцированные плюрипотентные стволовые клетки (ИПСК) - это тип стволовых клеток, которые могут быть получены из соматических клеток животных и человека в результате повышенной экспрессии набора определенных генов . Для получения ИПСК человека и животных успешно используется сверхэкспрессия таких генов как OCT4, SOX2, KLF4 и c-MYC . Позже группой Томсона ИПСК человека были успешно получены с использованием генов OCT4, SOX2, NANOG и LIN28 .

Известно, что для получения большинства новых линий ИПСК в настоящий момент используют генетические конструкции, полученные на основе ретро- и лентивирусных векторов. Этот метод характеризуется тем, что происходит случайное встраивание ДНК-копий геномов ретро- или лентивирусов в геномы клеток, что в свою очередь может приводить к нарушению функционирования генов .

Для полномасштабного применения индуцированных плюрипотентных стволовых клеток в фундаментальных и прикладных исследованиях, таких как скрининг новых лекарственных веществ, исследования в области токсикологии и регенеративной медицины, необходимо решение ряда проблем. Во-первых, необходима разработка методов получения ИПСК без генетической модификации их геномов. Во-вторых, способ получения ИПСК должен быть достаточно эффективным.

Известно, что плазмидные векторы -плазмиды- могут временно существовать в ядрах клеток, обеспечивая стабильную транскрипцию нуклеотидных последовательностей, находящихся под контролем конститутивных промоторов. Кроме того, известен метод, основанный на использовании специфических последовательностей - 2А-пептидов, позволяющий получать генетические конструкции, обеспечивающие трансляцию нескольких полипептидов (белков) с одной молекулы матричной РНК [5].

Задачей данного изобретения является конструирование полицистронной неинтегрирующейся плазмидной конструкции, кодирующей белки OCT4 и LIN28 человека и флуоресцентный белок DsRed2, обеспечивающей одновременную трансляцию данных белков и являющейся вектором при получении индуцированных плюрипотентных стволовых клеток. Белки OCT4 и LIN28 необходимы для запуска репрограммирования клеток, а флуоресцентный белок DsRed2 служит маркером трансфекции клеток и последующей элиминации плазмидной ДНК.

Реализация изобретения осуществляется следующим образом.

Конструирование рекомбинантной плазмидной ДНК выполняется на основе плазмиды pIRES (Clontech) и включает следующие стадии:

1. выделяют РНК из клеток известной линии эмбриональных стволовых клеток человека HUES9 и производят синтез кДНК с помощью олиго-(dT) праймеров. Полученную кДНК используют в качестве матрицы для синтеза фрагментов, кодирующих белки;

2. синтез фрагмента кДНК гена OCT4 - позиции в мРНК 53-1135- (Homo sapiens POU domein, class 5, Transcription factor 1 (POU5F1)) человека, (регистрационный номер в GeneBank NM_002701), размером 1152 пар нуклеотидов, содержащего на 3'-конце последовательность F2A-пептида (OCT4-F2A). Синтез проводят с помощью полимеразной цепной реакции с праймерами: hOCT45'NheI 5'-TTTTGCGCTAGCCATGGCGGGACACCTGGCTTCGG-3' (прямой праймер, содержит искусственно введенный сайт эндонуклеазы рестрикции Nhe I) и hOCT4 F2A 3'5'-CCTGCAAGTTTCAGCAAATCAAAGTTTAATGTCTGCTTTACTGGCGCACCCGAACCCGAGTTTGAATGCATGGGAGAGCCCAGAGTGGTG-3' (обратный праймер, содержащий нуклеотидную последовательность кодирующую пептид F2A);

3. синтез фрагмента кДНК гена LIN28 - позиции в мРНК 100-796- (Homo sapiens lin-28 homolog A (C. elegans)) (регистрационный номер в GeneBank NM_024674.4) размером 775 пар нуклеотидов, содержащего на 5'-конце последовательность F2A-пептида (F2A-KLF4). Синтез проводят с помощью полимеразной цепной реакции с праймерами: hLIN28 F2A5' 5'- GCAGACATTAAACTTTGATTTGCTGAAACTTGCAGGTGATGTAGAGTCAAATCCAGGTCCAGCTCAGCCGACGACCATGGGCTCC-3' (прямой праймер, содержащий нуклеотидную последовательность кодирующую пептид F2A) и hLIN28 3'MluI 5'- CACTTTCTCCAACGCGTCTGCTCCTCAAAACTTCCTG-3' (прямой праймер, содержит искусственно введенный сайт эндонуклеазы рестрикции Mlu I);

4. объединение фрагментов OCT4-F2A и F2A-LIN28 осуществляют методом полимеразной цепной реакции с использованием в качестве матриц перекрывающихся фрагментов OCT4-F2A и F2A-LIN28, а также праймеров hOCT45'NheI и hLIN28 3'MluI. В результате получают фрагмент OCT4-F2A-LIN28, размером 1891 пар нуклеотидов;

5. фрагмент ДНК, кодирующий белок DsRed2, вырезают из плазмиды pDsRed2 (Clontech) эндонуклеазой рестрикции Xba I, клонирован в сайт Xba I, находящийся в полилинкере B плазмиды pIRES (Clontech). В результате получают плазмида pIRES-DsRed2;

6. фрагмент ДНК OCT4-F2A-LIN28 клонируют с помощью набора реагентов pGEM-T Easy Vector Systems (Promega) и штамма E.coli XL-10 Gold;

7. клоны плазмиды pGEM-T Easy со встройками - pGEM-OCT4-F2A-LIN28 последовательности выделяют стандартным методом щелочного лизиса (Maniatis, Т., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: a Laboratory Manual, Cold Sping Harbor Laboratory Press);

8. фрагмент OCT4-F2A-LIN28 вырезают из плазмиды pGEM-OCT4-F2A-LIN28 с помощью эндонуклеазы рестрикции EcoR I и лигируют с плазмидой pIRES-DsRed2 гидролизованной эндонуклеазой рестрикции EcoR I, сайт которой расположен в полилинкере А.

В результате получена плазмида pOL-DsRed2 размером 8714 п.н. (OL=OCT4, LIN28).

На Фиг.1 изображена карта плазмидной генетической конструкции pOL-DsRed2. Фрагмент ДНК кодирующий белки OCT4 и LIN28 встроен в сайт EcoR I в полилинкер А плазмиды pIRES, а ДНК кодирующая DsRed2 встроена в сайт Xba I полилинкера В плазмиды pIRES.

Описание и позиции в нуклеотидной последовательности (п.н., пара нуклеотидов) функциональных элементов генетической плазмидной конструкции pOL-DsRed2 представлены в таблице 1.

Таблица 1
Элемент плазмидной генетической конструкции Позиции в последовательности конструкции, п.н.
p CMV IE - энхансер/промотор цитомегаловируса 1-750
IVS - интрон 890-1022
Промотор РНК-полимеразы T71067-1085
Фрагмент ДНК OCT4-F2A-LIN281096-2984
IRES - внутренний сайт посадки рибосом 3020-3601
DsRed2- кДНК гена DsRed23624-4350
Промотор РНК-полимеразы T3 4396-4418
SV40 poly A - фрагмент содержащий сигнал полиаденилирования мРНК вируса SV40 4429-4651
Ориджин репликации f1 4747-5203
p SV40 - энхансер/ранний промотор вируса SV405268-5686
SV40 ori - ориджин репликации вируса SV405584-5650
Neo-r - ген устойчивости к неомицину5731-6526
Синтетический сигнал полиаденилирования 6591-6640
Amp-r - ген устойчивости к ампициллину7052-7913

Полученная плазмидная генетическая конструкция pOL-DsRed2 построена на основе плазмидного вектора pIRES (Clontech), в который помещены фрагменты кДНК генов OCT4 и LIN28 человека, соединенные нуклеотидной последовательностью кодирующей F2A-пептид и кДНК гена, кодирующего флуоресцентный белок DsRed2.

Транскрипция единой мРНК OCT4-F2A-LIN28-IRES-DsRed2 осуществляется с конститутивного промотора p CMV IE, обеспечивающего высокий уровень наработки мРНК.

Наличие последовательностей F2A и IRES позволяет одновременно транслировать белки OCT4, LIN28 и DsRed2 с одной молекулы мРНК.

Фрагмент ДНК, кодирующий флуоресцентный белок DsRed2, является маркером трансфекции клеток и последующей элиминации плазмидной ДНК.

Плазмидная генетическая конструкция pOL-DsRed2 предназначена для временной или постоянной экспрессии генов OCT4, LIN28 и DsRed2 в культивируемых клетках человека, обеспечивает стабильную экспрессию введенного гена.

Рекомбинантная плазмида pOL-DsRed2 может использоваться в качестве вектора для получения индуцированных плюрипотентных стволовых клеток человека.

Список использованной литературы

1. Takahashi K. and S. Yamanaka. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 2006. 126(4): p.663-76.

2. Takahashi K. et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell, 2007. 131(5): p.861-72.

3. Yu J. et al. Induced pluripotent stem cell lines derived from human somatic cells. Science, 2007. 318(5858): p.1917-20.

4. Okita K. et al. Generation of mouse induced pluripotent stem cells without viral vectors. Science, 2008. 322(5903): p.949-53.

5. Szymczak A.L. and Vignali D.A. Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther, 2005. 5(5): p.627-38.

6. Cowan C.A. et al. Derivation of embryonic stem-cell lines from human blastocysts. N Engl J Med, 2004. 350(13): p.1353-6.

Скачать патент РФ Официальная публикация
патента РФ № 2495126

patent-2495126.pdf

Класс C12N15/00 Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев

способ идентификации вызывающих муковисцидоз мутаций в гене cftr человека, набор праймеров, биочип, набор мишеней и тест-система, используемые в способе -  патент 2529717 (27.09.2014)
рекомбинантная днк, кодирующая гранулоцитарный колониестимулирующий фактор человека (g-csf) и рекомбинантная плазмида рas017, обеспечивающая синтез g-csf в клетках escherichia coli -  патент 2529363 (27.09.2014)
рекомбинантный штамм бактерий escherichia coli n41 (pbpun4/mr)-продуцент сайт-специфической эндонуклеазы рестрикции bpun4i -  патент 2529362 (27.09.2014)
рекомбинантная плазмидная днк ppa-oprf-eta, кодирующая синтез рекомбинантного белка oprf-eta pseudomonas aeruginosa, штамм escherichia coli pa-oprf-eta - продуцент рекомбинантного белка oprf-eta pseudomonas aeruginosa и способ получения рекомбинантного белка oprf-eta pseudomonas aeruginosa -  патент 2529359 (27.09.2014)
модифицированная дрожжевая двугибридная система для эффективного исследования взаимодействия между белками и их доменами. -  патент 2529356 (27.09.2014)
нуклеиноваяя кислота, обладающая активностью гена фосфатазы фосфатидной кислоты (варианты), белок, рекомбинантный вектор, трансформант и способ получения композиции жирной кислоты -  патент 2528875 (20.09.2014)
аптамер, специфичный к опухолевым тканям легкого человека -  патент 2528870 (20.09.2014)
лейколектины и их применение -  патент 2528860 (20.09.2014)
дисплей на поверхности клеток полипептидных изоформ на основе прочитывания терминирующего кодона -  патент 2528858 (20.09.2014)
модифицированный фактор виллебранда с удлиненным полупериодом существования in vivo, его применения и способы получения -  патент 2528855 (20.09.2014)

Класс C12N15/12 гены, кодирующие животные белки

модифицированная дрожжевая двугибридная система для эффективного исследования взаимодействия между белками и их доменами. -  патент 2529356 (27.09.2014)
лейколектины и их применение -  патент 2528860 (20.09.2014)
способ получения пептидов, специфично распознающих определенные типы клеток и предназначенных для терапевтических целей -  патент 2528739 (20.09.2014)
кодон-оптимизированная кднк, кодирующая дисферлин человека, генно-инженерная конструкция, рекомбинантный аденовирус и фармацевтическая композиция для лечения дисферлинопатий -  патент 2527073 (27.08.2014)
антитела против g-белка распираторно-синцитиального вируса (rsv) -  патент 2526517 (20.08.2014)
антитело к epha2 -  патент 2525133 (10.08.2014)
рекомбинантная плазмидная днк pqe30/derf2l, кодирующая белок der f 2l клеща dermatophagoides farinae и штамм бактерий escherechia coli m15/ pqe30/derf2l - продуцент такого белка. -  патент 2522817 (20.07.2014)
регулирование продуктивных признаков у птиц -  патент 2518681 (10.06.2014)
изолированный полипептид и его применение для лечения ракового заболевания или стимуляции иммунной системы, фармацевтическая композиция, содержащая такой полипептид и способ лечения рака. -  патент 2518236 (10.06.2014)
выделенная нуклеиновая кислота, кодирующая флуоресцентный биосенсор, кассета экспрессии, клетка продуцирующая флуоресцентный биосенсор, выделенный флуоресцентный биосенсор -  патент 2515903 (20.05.2014)

Класс C12P21/02 с известной последовательностью из двух или более аминокислотных остатков, например глутатиона

лейколектины и их применение -  патент 2528860 (20.09.2014)
модифицированный фактор виллебранда с удлиненным полупериодом существования in vivo, его применения и способы получения -  патент 2528855 (20.09.2014)
l-фукоза 1 6 специфичный лектин -  патент 2524425 (27.07.2014)
мутант тяжелой цепи, приводящий к повышенной выработке иммуноглобулина -  патент 2522481 (20.07.2014)
применение штамма дрожжей komagataella pastoris в качестве реципиента для конструирования продуцентов целевого белка -  патент 2522479 (20.07.2014)
гибридный белок на основе рекомбинантного эритропоэтина человека, обладающий пролонгированным действием (варианты), и способ его получения -  патент 2515914 (20.05.2014)
мутеины липокалина слезной жидкости, обладающие аффинностью к с-мет рецепторной тирозинкиназе человека и способы их получения -  патент 2515063 (10.05.2014)
способ получения токсина actinobacillus pleuropneumoniae apxi, используя культуральную среду, содержащую комплекс кальций-бороглюконат -  патент 2514667 (27.04.2014)
способ модификации изоэлектрической точки антитела с помощью аминокислотных замен в cdr -  патент 2510400 (27.03.2014)
способ получения токсинов actinobacillus pleuropneumoniae apxi или apxiii в жидкой культуральной среде, дополненной воздухом, обогащенным углекислым газом -  патент 2507267 (20.02.2014)
Наверх