экспрессионная генетическая конструкция poptivec/f8bdd, кодирующая рекомбинантный фактор свертываемости крови viii человека с делецией в-домена, и клеточная линия dg-ov-f8bdd-18, продуцирующая рекомбинантный фактор свертываемости крови viii человека с делецией в-домена

Классы МПК:C12N15/12 гены, кодирующие животные белки
C12N15/79 векторы или экспрессионные системы, специально приспособленные для эукариотических хозяев
C12N15/06 клетки животных
Автор(ы):, , , , ,
Патентообладатель(и):Учреждение Российской академии наук Институт биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова РАН (RU),
Учреждение Российской академии медицинских наук Гематологический научный центр РАМН (RU)
Приоритеты:
подача заявки:
2009-10-23
публикация патента:

Изобретение относится к области биотехнологии, конкретно к получению рекомбинантного фактора свертываемости крови VIII, и может быть использовано в медицине. Конструируют экспрессионную плазмидную ДНК pOptivec/F8BDD, кодирующую рекомбинантный фактор свертываемости крови VIII с делецией В-домена, которой трансформируют клетки линии DG-OV-F8BDD-18 для продуцирования. Изобретение обеспечивает высокий уровень секреции рекомбинантного фактора свертываемости крови VIII с делецией В-домена в бессывороточную культуральную среду. 2 н.п. ф-лы, 1 ил. экспрессионная генетическая конструкция poptivec/f8bdd, кодирующая   рекомбинантный фактор свертываемости крови viii человека с делецией   в-домена, и клеточная линия dg-ov-f8bdd-18, продуцирующая рекомбинантный   фактор свертываемости крови viii человека с делецией в-домена, патент № 2429294

экспрессионная генетическая конструкция poptivec/f8bdd, кодирующая   рекомбинантный фактор свертываемости крови viii человека с делецией   в-домена, и клеточная линия dg-ov-f8bdd-18, продуцирующая рекомбинантный   фактор свертываемости крови viii человека с делецией в-домена, патент № 2429294 экспрессионная генетическая конструкция poptivec/f8bdd, кодирующая   рекомбинантный фактор свертываемости крови viii человека с делецией   в-домена, и клеточная линия dg-ov-f8bdd-18, продуцирующая рекомбинантный   фактор свертываемости крови viii человека с делецией в-домена, патент № 2429294 экспрессионная генетическая конструкция poptivec/f8bdd, кодирующая   рекомбинантный фактор свертываемости крови viii человека с делецией   в-домена, и клеточная линия dg-ov-f8bdd-18, продуцирующая рекомбинантный   фактор свертываемости крови viii человека с делецией в-домена, патент № 2429294 экспрессионная генетическая конструкция poptivec/f8bdd, кодирующая   рекомбинантный фактор свертываемости крови viii человека с делецией   в-домена, и клеточная линия dg-ov-f8bdd-18, продуцирующая рекомбинантный   фактор свертываемости крови viii человека с делецией в-домена, патент № 2429294 экспрессионная генетическая конструкция poptivec/f8bdd, кодирующая   рекомбинантный фактор свертываемости крови viii человека с делецией   в-домена, и клеточная линия dg-ov-f8bdd-18, продуцирующая рекомбинантный   фактор свертываемости крови viii человека с делецией в-домена, патент № 2429294 экспрессионная генетическая конструкция poptivec/f8bdd, кодирующая   рекомбинантный фактор свертываемости крови viii человека с делецией   в-домена, и клеточная линия dg-ov-f8bdd-18, продуцирующая рекомбинантный   фактор свертываемости крови viii человека с делецией в-домена, патент № 2429294 экспрессионная генетическая конструкция poptivec/f8bdd, кодирующая   рекомбинантный фактор свертываемости крови viii человека с делецией   в-домена, и клеточная линия dg-ov-f8bdd-18, продуцирующая рекомбинантный   фактор свертываемости крови viii человека с делецией в-домена, патент № 2429294 экспрессионная генетическая конструкция poptivec/f8bdd, кодирующая   рекомбинантный фактор свертываемости крови viii человека с делецией   в-домена, и клеточная линия dg-ov-f8bdd-18, продуцирующая рекомбинантный   фактор свертываемости крови viii человека с делецией в-домена, патент № 2429294

Формула изобретения

1. Плазмидная ДНК pOptivec/F8BDD, имеющая молекулярную массу 6,64 мДа и уникальные сайты узнавания эндонуклеазами рестрикции - FspI (8918); MfeI (4940); PsiI (1039); PvuI (9065); RleAI (2281); SapI (7686); SnaBI (9995); SphI (3663); SwaI (3650); состоящая из фрагмента ДНК с SEQ ID NO:2 длиной 6359 п.о., содержащего последовательность кДНК гена человеческого фактора свертываемости крови VIII с делецией В-домена, аминокислотная последовательность которого приведена в SEQ ID NO:1, и фрагмента 4382 п.о. плазмиды pOptivec, содержащего:

- регуляторные элементы, обеспечивающие экспрессию гена фактора свертываемости крови VIII с делецией В-домена: конститутивный промотор вируса CMV, последовательность Козак (сайт связывания рибосом) и сигнал полиаденилирования вируса простого герпеса (HSV);

- последовательность фактора устойчивости трансфецированных клеток к воздействию метотрексата - дигидрофолатредуктазы (DHFR) и регуляторные элементы для экспрессии DHFR - последовательность IRES вируса энцефаломиокардита (EMCV), обеспечивающая бицистронную экспрессию в животных клетках и сигнал полиаденилирования;

- ген устойчивости к антибиотику ампициллин и бактериальный промотор гена устойчивости к ампициллину, позволяющие проводить препаративную наработку плазмиды в E.coli;

2. Линия клеток яичника китайского хомячка DG-OV-F8BDD-18 - продуцент рекомбинантного фактора свертываемости крови VIII с делегированным В-доменом, обладающая продуктивностью 0,5 ЕД/млн клеток/сутки, полученная путем липосомальной трансфекции клеток яичника китайского хомячка линии СНО DG-44 плазмидой по п.1 и последующего селективного культивирования в присутствии возрастающих концентраций метотрексата от 25 до 500 нМ.

Описание изобретения к патенту

Изобретение относится к области биотехнологии, а именно к технологии получения биологически активных веществ (БАВ) методами генной инженерии, точнее, к методам получения фактора свертываемости крови VIII с делецией В-домена (BDD-rfVIII).

Структура гена фактора VIII (fVIII) и его связь с генетикой гемофилии были установлены в 1984-85 годах (Vehar G. A. and R. M. Lawn (1986). "The cloning of factor VIII and the genetics of hemophilia A". Hosp Pract (Off Ed), 21(5): 111-116). Ген фактора VIII локализован на большом плече Х-хромосомы, на участке длиной порядка 186 Кб, состоит из 26 экзонов размером от 69 п.о. до 3106 п.о. и интронов, достигающих до 32,4 Кб. Область, кодирующая фактор VIII, занимает до 1% длины Х-хромосомы.

Экспрессия гена фактора VIII преимущественно происходит в гепатоцитах (Zelechowska M.G., J.A. van Mourik, et al. (1985). "Ultrastructural localization of factor VIII procoagulant antigen in human liver hepatocytes". Nature, 317(6039): 729-730), где обнаруживается его мРНК, а также полипептид в эндоплазматическом ретикулуме. Кроме того, показано, что промоторная область фактора VIII содержит регуляторные последовательности, специфичные для гепатоцитов.

Исходный полипептид фактора VIII транслоцируется в люмен эндоплазматического ретикулума (ЭР), где происходит N-гликозилирование. В ЭР fVIII взаимодействует с рядом шаперонов, включая кальретикулин, кальнексин, BiP. Транспорт в аппарат Гольджи (АГ) до сих пор описан не полностью, есть данные, что в нем принимет участие взаимодействие с внутриклеточным мембранным лектином, ERGIC-53 (Endoplasmatic Reticule Golgi Intermediate Compartment). Внутри АГ происходит N- и O-гликозилирование, сульфатирование остатков тирозина, а также ограниченный протеолиз. Критическая аминокислота для процессинга в АГ - Arg 2307, ее замена на Glu или Leu ведет к значительному увеличению секреции зрелого белка (Gitschier J., W.I. Wood, et al. (1986). "Identification of a missense mutation in the factor VIII gene of a mild hemophiliac". Science, 232(4756): 1415-1416).

Зрелый природный fVIII представлен в плазме крови серией форм с массами, лежащими в пределах от 170 до 280 кДа. В норме он экспрессируется in vivo как одноцепочечный полипептид, длиной 2332 аминокислоты, включающий структурные домены А1(1-336)-А2(372-710)-В(741-1648)-А3(1896-2019)-С1(2020-2172)-С2(2173-2332), в физиологических концентрациях представленный мономерной формой. Физиологически активный в кровотоке фактор VIII представляет собой гетеродимер, состоящий из легкой цепи (домены А3-С1-С2; молекулярная масса (ММ) 80 кДа) и различных вариантов тяжелой цепи (домены А1-А2-В; ММ 90-200 кДа). Легкая и тяжелая цепи фактора VIII удерживаются за счет координирования иона меди и стабилизируются в кровотоке шапероном - фактором фон Виллебрандта (vWF), выделяющимся клетками эндотелия сосудов. Двуцепочечная форма образуется в результате протелитического расщепления предшественника (Lenting P. J., J. А. van Mourik, et al. (1998). "The life cycle of coagulation factor VIII in view of its structure and function". Blood, 92(11): 3983-3996), гетерогенность длины тяжелых цепей обусловлена ограниченным протеолизом (С)-конца В-домена.

В терапии гемофилии применяются: 1) препараты природного фактора VIII, 2) препараты рекомбинантного полноразмерного фактора VIII, 3) препараты на основе рекомбинантного фактора VIII с делецией В-домена (BDD-rfVIII). Препараты природного фактора VIII традиционно получают из фракции криопреципитата пулированной донорской плазмы. В целом количество извлекаемого из плазмы донорской крови фактора VIII физически ограничено объемом полученной плазмы с учетом потерь фактора при получении криопреципитата и очистке и не может быть увеличено никакими методами. Необходимо отметить, что около четверти больных гемофилией А развивают так называемую ингибиторную форму болезни, то есть в их организме начинают вырабатываться антитела к фактору VIII, вследствие чего таким больным необходимо вводить большее количество фактора. Частота возникновения ингибиторной формы гемофилии значительно увеличилась за последние 20 лет, что, возможно, связано с использованием очищенного фактора VIII. Тем не менее необходимость вирусной инактивации природного фактора VIII не позволяет продолжать использовать неочищенный слабоиммуногенный криопреципитат. Естественным выходом из сложившейся ситуации было создание рекомбинантных (генно-инженерных) вариантов фактора VIII. Фактор VIII представляет собой полипептид (>200 кДа), имеющий множество разнообразных посттрансляционных модификаций и in vivo циркулирующий только в комплексе с шапероном - фактором фон Виллебрандта. Вследствие этого промышленно пригодные способы получения полноразмерного рекомбинантного фактора VIII были основаны на его экспрессии в животных клетках при одновременной коэкспресии моноклональных антител, стабилизирующих продукт в культуральной среде, либо коэкспресии фактора фон Виллебрандта, либо введении в культуральную среду белков плазмы человека. Последний способ фактически приводит к тому, что рекомбинантный фактор VIII обладает большинством недостатков природного.

На протяжении последних 20 лет в мире активно проводят исследования влияния мутаций на активность, стабильность и иммуногенность препаратов фактора VIII, целью которых было получить экспрессирующийся с большей продуктивностью и более стабильный в среде аналог природного фактора, сохраняющий прогоагулянтную активность и не иммуногенный. В основном работы сосредоточены в области удаления участка кДНК, кодирующего В-домен (D. D. Pittman, E. M. Alderman, et al. (1993). "Biochemical, immunological, and in vivo functional characterization of В-domain-deleted factor VIII". Blood, 81(11): 2925-2935). Наилучшие результаты по получению линий продуцентов делеционных форм фактора VIII с определенной аминокислотной последовательностью были получены исследовательским подразделением компании Pharmacia (Lind P., K. Larsson, et al. (1995). "Novel forms of B-domain-deleted recombinant factor VIII molecules. Construction and biochemical characterization". Eur J Biochem, 232(1): 19-27).

На настоящий момент существует лишь одна одобренная для клинического использования мутантная форма - делеционный мутант фактора VIII, вариант SQ.

Известен способ создания эукариотических продуцентов рекомбинантного фактора свертываемости крови VIII с делецией В-домена в клетках млекопитающих (патент США US 4868112). Он состоит в конструировании плазмиды, содержащей целевой ген и ген дигидрофолатредуктазы (DHFR), трансфекции данной плазмиды, в клетки млекопитающих линий COS-1, CHO (DUKX-B11), получении колоний стабильно трансфицированных клеток и их селекции в среде, содержащей метотрексат. При использовании данного способа уровень секреции целевого белка в культуральную среду составляет 2 ЕД/мл/сутки при плотности клеток 1 млн/мл. При этом культивацию производят в присутствии сыворотки крупного рогатого скота, содержащей фактор фон Виллебрандта, плотно связывающийся с фактором VIII.

Способов получения продуцентов для промышленного производства целевого белка без использования белковых препаратов природного происхождения не известно.

Для увеличения уровня секреции продуцентов BDD-rfVIII известны различные способы, основой которых является оптимизация доменной структуры и аминокислотного состава целевого белка. Так, в патентах США US 6376463, US 7122634 помимо делетирования В-домена применяют внесение точечных мутаций в домены А и создание слитных белков на основе генов фактора VIII свиньи и человека. Данный способ имеет ограниченную практическую пригодность, поскольку, как и при использовании природного свиного фактора VIII для больных ингибиторной формой гемофилии А, присутствует риск развития вторичной резистентности к фактору VIII из-за иммуногенности препарата (Parker Е. Т., Н. N. Craddock, et al. (2004). "Comparative immunogenicity of recombinant В domain-deleted porcine factor VIII and Hyate:C in hemophilia A mice presensitized to human factor VIII". J Thromb Haemost, 2(4): 605-611).

Известен также способ увеличения продуктивности систем экспрессии, основанный на введении в геном культивируемых клеток бицистронных генетических конструкций с последующей амплификацией гена целевого белка (патент США US 6114146). Клетки линий 293 и SK-HEP1 трансфецируют плазмидой pCMVF/EDHPro, содержащей ген DHFR и искусственный ген фактора VIII с делецией В-домена, соединенные участком, содержащим сайт внутреннего связывания рибосомы (IRES). При последующем культивировании в присутствии увеличивающихся концентраций метотрексата получают клеточные линии-продуценты, секретирующие BDD-rfVIII в культуральную среду с уровнем от 0,1 до 3 ЕД/млн клеток в сутки. Однако получение продуцентов по предлагаемой способу требует использования эмбриональной сыворотки крупного рогатого скота в составе культуральной среды, что приводит к образованию плотного комплекса фактора VIII и бычьего фактора фон Виллебрандта.

Наиболее близким по технической реализации аналогом изобретения является описанная в патенте США US 6358703 гетерологическая система экспрессии, полученная трансфекцией бицистронного плазмидного вектора pCIS25DTR в клетки линии HKB11. Использование данного продуцента в масштабе 15-литрового перфузионного биореактора позволяет достичь суммарной продуктивности 4 млн МЕ/сутки, вероятный уровень продуктивности при стандартных параметрах культивирования клеток должен находиться в диапазоне 10-30 МЕ/млн клеток в сутки. Недостатком известного технического решения является использование гибридной линии клеток, полученной слиянием клеток линии 293 S и раковых клеток лимфомы Беркитта, культивируемых в присутствии эмбриональной сыворотки крупного рогатого скота в составе культуральной среды. Сыворотка также применяется при селекции мастер-клона конечной линии продуцента и только при получении банка рабочих продуцентов производится ее замена на препараты фракционированной плазмы человека. Кроме того, применимость использования раковых клеток человека для создания клеточных линий продуцентов имеет ряд ограничений по соображениям безопасности (Yallop С.А., Р.L. Norby, et al. (2003). "Characterisation ofG418-induced metabolic load in recombinant CHO and BHK cells: effect on the activity and expression of central metabolic enzymes". Cytotechnology, 42(2): 87-99); патентная заявка США US 2006/0099685 A1, п.0058).

Технической задачей изобретения является создание высокопродуктивной и свободной от использования продуктов животного происхождения линии клеток яичника китайского хомячка для получения рекомбинантного фактора свертываемости крови VIII с делецией В-домена для биофармацевтического производства.

Поставленная задача решается за счет создания экспрессионной плазмидной ДНК pOptivec/F8BDD, включающей область ДНК, последовательность которой приведена в SEQ ID 2, и кодирующей полипептид, приведенный в SEQ ID 1, содержащий последовательность фактора свертываемости крови VIII с делегированным В-доменом;

а также за счет создания линии клеток яичника китайского хомячка DG-OV-F8BDD-18, в геноме которой содержится последовательность плазмидной ДНК pOptivec/F8BDD, - продуцента рекомбинантного фактора свертываемости крови VIII с делегированным В-доменом.

Технический результат заключается в повышении выхода целевого белка в культуральную среду определенного химического состава, то есть не содержащую продуктов животного или растительного происхождения или гидролизаты таких продуктов, и проведении работ по созданию линии-продуцента без использования продуктов животного происхождения, что позволяет минимизировать риск присутствия в продукте патогенных вирусов и прионов.

Экспрессионная плазмидная ДНК pOptivec/F8BDD состоит из фрагмента ДНК, длиной 6359 п.о., содержащего последовательность кДНК гена человеческого фактора свертываемости крови VIII с делецией В-домена SQ, и фрагмента 4382 п.о. плазмиды pOptivec, содержащего

- регуляторные элементы, обеспечивающие экспрессию фактора VIII: конститутивный промотор вируса CMV, последовательность Козак (сайт связывания рибосом), и сигнал полиаденилирования вируса простого герпеса (HSV);

- последовательность фактора устойчивости трансфицированных клеток к воздействию метотрексата - дигидрофолатредуктазы (DHFR) - и регуляторные элементы для экспрессии DHFR - последовательность IRES вируса энцефаломиокардита (EMCV), обеспечивающая бицистронную экспрессию в животных клетках и сигнал полиаденилирования;

- ген устойчивости к антибиотику ампициллин и бактериальный промотор гена устойчивости к ампициллину, позволяющие проводить препаративную наработку плазмиды в E.coli.

Плазмида pOptivec/F8BDD содержит уникальные сайты узнавания эндонуклеазами рестрикции - FspI (8918); MfeI (4940); PsiI (1039); PvuI (9065); RleAI (2281); SapI (7686); SnaBI (9995); SphI (3663); SwaI (3650). Имеет молекулярную массу 6,64 мДа. Плазмиду вводят в клетки СНО DG-44 методом липосомальной трансфекции (Straus S.E., T. Wilson, et al. (1981). "Transfection of KB cells by liposomes containing adenovirus type 2 DNA". J Virol, 39(1): 290-294), получают пул стабильно трансфицированных клеток при помощи культивирования в среде химически определенного состава, не содержащей гипоксантина и тимидина. Амплификацию кассеты в геноме клеток проводят путем последовательных культивирований в присутствии возрастающих концентраций метотрексата от 25 нМ до 500 нМ. Получают пул клеток, устойчивых к высокой концентрации метотрексата, и используют для клонирования методом предельного разведения. Полученные клоны клеток-продуцентов анализируют методом иммуноферментного анализа и отбирают клоны, дающие максимальный уровень экспрессии целевого белка. Среди них выбирают клон DG-OV-F8BDD-18, при культивировании которого в суспензионной форме в бессывороточной среде уровень секреции В-домен делетированного фактора свертываемости крови VIII в норме составляет не менее 500 МЕ/л. Особенности созданной плазмиды приведены на чертеже.

На чертеже показана схематическая карта pOptivec/F8BDD.

Обозначения

Стрелками экспрессионная генетическая конструкция poptivec/f8bdd, кодирующая   рекомбинантный фактор свертываемости крови viii человека с делецией   в-домена, и клеточная линия dg-ov-f8bdd-18, продуцирующая рекомбинантный   фактор свертываемости крови viii человека с делецией в-домена, патент № 2429294 обозначены области, кодирующие полипептид фактора свертывания крови VIII (включая и не включая область лидерного пептида).

Курсивом обозначены характеристические сайты рестрикции, в скобках указана позиция разрезания. NotI - рестриктазы, фланкирующие область вставки фрагмента кДНК фактора VIII в материнский вектор pOptivec.

Ampicillin (bla) resistance gene - ген устойчивости к ампициллину.

blа promoter - бактериальный промотор гена устойчивости к ампициллину.

CMV Promoter - конститутивный эукариотический промотор цитомегаловируса.

Kozak - сайт связывания рибосом - последовательность Козак.

Start ATG - первый кодон рамки считывания полипептида фактора VIII.

polyA - область, соответствующая поли-А тракту кДНК фактора VIII.

ECMV IRES - сайт связывания рибосом - последовательность IRES энцефаломиокардита, обеспечивающая бицистронную экспрессию в животных клетках.

DHFR - последовательность фактора устойчивости трансфицированных клеток к воздействию метотрексата - дигидрофолатредуктазы (DHFR).

ТК polyA signal - сигнал полиаденилирования.

pUC origin - область начала репликации (ориджин) плазмид семейства pUC.

Изобретение иллюстрируют примеры.

Пример 1. Получение плазмидной ДНК pOptivec/F8BDD, кодирующей белок человеческого фактора свертываемости крови VIII с делецией В-домена, для трансфекции линии клеток CHO-DG-44.

В качестве акцепторной плазмиды для клонирования делеционного варианта гена BDD-rfVIII используют экспрессионный вектор pOptivec, ранее полученный в лаборатории медицинской биотехнологии ГУ ГНЦ РАМН на основе коммерчески доступной линеаризованной плазмидной ДНК pOptivec-TOPO при инкубации в деионизованной воде 30 минут с последующим лигированием ДНК-лигазой фага Т4 (Fermentas, Литва), проводившемся в стандартном буферном растворе по методике производителя фермента. Полученной лигазной смесью трансформируют клетки Е.coli штамма DH5экспрессионная генетическая конструкция poptivec/f8bdd, кодирующая   рекомбинантный фактор свертываемости крови viii человека с делецией   в-домена, и клеточная линия dg-ov-f8bdd-18, продуцирующая рекомбинантный   фактор свертываемости крови viii человека с делецией в-домена, патент № 2429294 , с генотипом F-экспрессионная генетическая конструкция poptivec/f8bdd, кодирующая   рекомбинантный фактор свертываемости крови viii человека с делецией   в-домена, и клеточная линия dg-ov-f8bdd-18, продуцирующая рекомбинантный   фактор свертываемости крови viii человека с делецией в-домена, патент № 2429294 80lacZэкспрессионная генетическая конструкция poptivec/f8bdd, кодирующая   рекомбинантный фактор свертываемости крови viii человека с делецией   в-домена, и клеточная линия dg-ov-f8bdd-18, продуцирующая рекомбинантный   фактор свертываемости крови viii человека с делецией в-домена, патент № 2429294 M15 экспрессионная генетическая конструкция poptivec/f8bdd, кодирующая   рекомбинантный фактор свертываемости крови viii человека с делецией   в-домена, и клеточная линия dg-ov-f8bdd-18, продуцирующая рекомбинантный   фактор свертываемости крови viii человека с делецией в-домена, патент № 2429294 (lacZYA-argF) U169 recA1 endA1 hsdR17 (rk-, mk+) phoA supE44 экспрессионная генетическая конструкция poptivec/f8bdd, кодирующая   рекомбинантный фактор свертываемости крови viii человека с делецией   в-домена, и клеточная линия dg-ov-f8bdd-18, продуцирующая рекомбинантный   фактор свертываемости крови viii человека с делецией в-домена, патент № 2429294 - thi-1 gyrA96 relA1. Для этого к 200 мкл замороженной суспензии клеток Е.coli добавляют 5 мкл лигазной смеси, инкубируют на льду 30 минут для сорбции плазмидной ДНК, нагревают до 42°C на 60 секунд и инкубируют на льду 5 минут. После чего добавляют 800 мкл питательного бульона SOC (20 г/л триптона, 5 г/л дрожжевого экстракта, 0,5 г/л NaCl, 250 мМ KCl, 10 мМ MgCl2) и инкубируют при 37°C 60 минут. После инкубации переносят суспензию на чашку Петри с твердой агаризованной средой 2xYT-агар (16 г/л триптона, 10 г/л дрожжевого экстракта, 10 г/л NaCl, 18 г/л агара), содержащей ампициллин в концентрации 100 мкг/мл, и помещают в термостат на 37°C 18 часов. Отдельные клоны трансформантов инокулируют в 5 мл питательного бульона LB с добавлением ампициллина в концентрации 50 мкг/мл, наращивают 18 часов при 37°C и проводят выделение плазмидной ДНК с использованием набора реактивов "Wizard Plus SV Minipreps" («Promega», США) по стандартному протоколу фирмы-производителя.

В качестве матрицы для получения вставки используют плазмиду pCMV6-XL4/NM_000132 (Origene, США), содержащую полную последовательность полноразмерной кДНК fVIII, совпадающую с теоретически определенной кДНК fVIII, опубликованной в базе данных GenBank. Методом ПЦР со специфических праймеров O1KpnIfor (5'GCTGGTACCTCACAGAGAATATACA3'), O1Hindrev (5' GGAGAAGCTTCTTGGTTCAATG3'), O2Hindfor (5'CCAAGCTTCTCCCAAAACCC ACCAGTCTTGAAAC3'), O2Blprev (5'CTGCCCATGCTGAGCAGATAC3'), содержащих сайты узнавания специфических эндонуклеаз, получают два ПЦР-продукта F1 и F2, фланкирующие делегируемый участок кодирующий В-домен, общая длина которых не превышает полутора тысяч пар оснований, то есть при условии проведения амплификации смесью высокоточных полимераз - вероятность мутации будет минимальной. ПЦР-продукты клонируют в Т-вектор и определяют первичную нуклеотидную последовательность по обеим цепям. Для секвенирования 350 нг плазмидной ДНК смешивают с праймером (3,2 pmol) и упаривают пробы при 65°C. Секвенирование проводится с помощью набора реактивов ABI PRISMR BigDyeэкспрессионная генетическая конструкция poptivec/f8bdd, кодирующая   рекомбинантный фактор свертываемости крови viii человека с делецией   в-домена, и клеточная линия dg-ov-f8bdd-18, продуцирующая рекомбинантный   фактор свертываемости крови viii человека с делецией в-домена, патент № 2429294 Terminator v. 3.1, с последующим анализом продуктов реакции на автоматическом секвенаторе ДНК ABI PRISM 3100-Avant. Анализ хроматограмм проводят при помощи программы Chromas v 2.13 или пакета VNT Suite.

Фрагмент F3, соответствующий N-концевому участку тяжелой цепи fVIII, получают без использования ПЦР, путем препаративной рестрикции плазмиды pCMV6-XL4/NM_000132 эндонуклеазами рестрикции NotI и KpnI. Продукты рестрикции разделяют в 1% агарозном геле, буферный раствор ТВЕ, с добавлением бромистого этидия (0,4 мкг/мл). Для выделения ДНК полосу, соответствующую продукту амплификации, визуализируют при помощи УФ-облучения, вырезают из агарозного геля, помещают в пробирку объемом 1,5 мл и проводят экстракцию ДНК, используя набор реактивов "Wizard SV Gel and PCR Clean-Up System" («Promega», США) согласно протоколу фирмы-производителя.

Сборку трех фрагментов F1, F2, F3 ведут в плазмидном векторе pAL-TA (Евроген, РФ), что обеспечивает ряд методических преимуществ по сравнению со сборкой в векторе большего размера.

Отбор позитивных клонов E.coli проводят методом ПЦР с клонов с использованием праймера Odelf (5'GCCACAACTCAGACTTTCG3') и стандартных праймеров к последовательности вектора: M13for и M13rev. Амплификацию проводят при помощи прибора "Терцик" (ДНК-технология, РФ) по следующей схеме: инкубационную смесь из расчета 25 мкл на одну реакцию (2,5 мкл 10х буферного раствора для Taq-полимеразы; по 10 пМ прямого и обратного праймера; по 2 мМ каждого дезоксирибонуклеотидтрифосфата; воды до 24 мкл). Полученную смесь разносят по пробиркам по 22 мкл, в каждую пробирку помещают кусочек парафина. Бактериальные колонии переносят петлей в пробирки и одновременно делают штрихи на свежей, размеченной чашке Петри с твердой питательной средой (которую затем помещают в воздушный термостат на 37°C). Помещают пробирки в прибор, проводят денатурацию при 94°C 3 мин, добавляют в остававшуюся инкубационную смесь по 0,5 ЕД Taq-полимеразы и разносят по пробиркам на последней минуте первого цикла денатурации. Проводят 25 циклов ПЦР (денатурация: 94°C 30 с, отжиг праймера Х=2°C × n (А/Т) + 4°C × n (Г/Ц) -5°C 30 с, элонгация 72°C 30-90 с). Продукты полимеразной цепной реакции анализируют электрофорезом в 1% агарозном геле. Для отобранных позитивных клонов проводят выделение плазмиды и ее секвенирование. После подтверждения корректности сборки фрагментов дают выбранной плазмиде обозначение pAL-TA/F123.

Переносят фрагмент NotI-NotI из плазмиды pCMV6-XL4/NM_000132 в плазмиду pOptivec, линеаризованную NotI при помощи процедур, изложенных выше. После подтверждения идентичности последовательности гена фактора VIII в составе полученной плазмиды pOptivec/F8 методом полного секвенирования обеих цепей в области вставки, фрагмент BlpI-BlpI в pOptivec/F8 заменяют на фрагмент BlpI-BlpI из pAL-TA/F123.

Для этого полученный искусственный фрагмент гена В-домен делетированного фактора VIII лигируют с рестрицированным по сайту BlpI и дефосфорилированным вектором pOptivec/F8 и продуктом лигирования трансформируют клетки E.coli штамма ТОР10. Первичный анализ полученных клонов ведут при помощи метода ПЦР с колоний с использованием праймеров 8sq4f (5'TGTATTTGATGAGAACCGAAGC3') и 8sq5r (5'GCCACTCTGAGCCCTGTT3') или CMVfor (Invitrogen, США) и 8sq15r (5'GAGTTCTTTGTTTCTGAGTGCC3'). Последовательность полученных плазмидных конструкций pOptivec/F8BDD верифицируют методом секвенирования по обеим цепям кодирующей области на протяжении всего вставленного участка. Данные определения первичной нуклеотидной последовательности области плазмиды, кодирующей рекомбинантный фактор VIII человека с делетированным В-доменом, полученные с прибора для автоматического капиллярного электрофореза, анализируют в приложении ContigExpress программного пакета VectorNTI Suite (Invitrogen, США). С использованием стандартного алгоритма проводят тримминг 5'-концевых и/или 3'-концевых областей фрагментов. После этого проводят сборку контига с использованием стандартных настроек. Проводят понуклеотидное сравнение полученной консенсусной последовательности с теоретически предсказанной последовательностью BDD-rfVIII, проверяют отсутствие нуклеотидных замен. Помимо кодирующей области, по аналогичному алгоритму проводят также секвенирование областей рестриктных сайтов, по которым производят клонирование фрагмента кДНК, а также области промотора CMV и участка внутреннего связывания рибосомы (IRES) экспрессионного вектора pOptivec, проверяют отсутствие точечных мутаций.

Полученная экспрессионная плазмидная ДНК pOptivec/F8BDD кодирует фактор свертываемости VIII человека с делетированным В-доменом, имеет размер 10741 пара нуклеотидных оснований и содержит уникальные сайты рестрикции FspI (8918); MfeI (4940); PsiI (1039); PvuI (9065); RleAI (2281); SapI (7686); SnaBI (9995); SphI (3663); SwaI (3650). Данная конструкция предназначена для конститутивной трансфекции эукариотических клеток геном фактора свертываемости VIII человека с делетированым В-доменом с последующим отбором и амплификацией по сцепленному признаку DHFR+.

Сообщает клеткам-реципиентам следующие фенотипические признаки: при трансформации прокариот - устойчивость к ампициллину; при трансфекции клеток эукариот - ограниченная устойчивость к метотрексату, увеличивающаяся при селективном отборе, потеря ауксотрофности по гипоксантину и тимидину, экспрессия белка BDD-rfVIII в ростовую среду.

Созданную плазмидную ДНК используют для получения линии-продуцента.

Пример 2. Получение клональной линии эукариотических продуцентов рекомбинантного фактора свертываемости крови VIII с делецией В-домена DG-OV-F8BDD-18, производного линии клеток яичника китайского хомячка DG-44

Экспрессионную плазмидную ДНК pOptivec/F8BDD, кодирующую рекомбинантный фактор свертываемости крови VIII с делецией В-домена, сконструированную по методке, приведенной в Примере 1, амплифицируют в клетках бактерий в препаративных количествах. Для этого клетки штамма E.coli ТОР10, трансформированные верифицированной плазмидной ДНК, культивируют в 0,5 л жидкой среды LB в течение 14 часов. Выделение плазмидной ДНК проводят методом щелочного лизиса бактерий набором для препаративного выделения ДНК (EndoFree Plasmid MaxiKit, Qaigen) no методике производителя. Концентрация высокоочищенной плазмидной ДНК, не содержащей пирогенов, составляет при этом 190 мкг/мл. Для проведения конститутивной трансфекции эукариотических клеток выделенной плазмидной ДНК ее дополнительно переводят в линейную форму, рестрицировав количественно эндонуклеазой PvuI, что приводит к разрушению гена бета-лактамазы (устойчивости к ампициллину). Затем плазмидную ДНК очищают от рестриктазы, осаждая 70% этанолом. Выделенную плазмиду, предназначенную для транзиентной трансфекции, рестрикции не подвергают. Полученные формы плазмиды растворяют в фосфатно-солевом буфере и стерилизуют при помощи фильтра 0,22 мкм.

Клетки линии СНО DG-44 (Invitrogen, США) получают от производителя в криопробирках по 1 мл, содержащих замороженную суспензию клеток плотностью приблизительно 10 млн клеток на мл в среде CD DG-44 (Gibco, США) с 10% диметилсульфоксида (DMSO). Содержимое сосуда размораживают при 37°C и добавляют к 30 мл полной среды CD DG-44. Полная среда состоит из CD DG-44, 8 мМ L-глутамина и 1,8 мл/л сурфактанта Pluronic F-68 (BASF Inc., США) и содержит достаточные для роста DHFR-отрицательных клеток количества гипоксантина и тимидина. Клетки культивируют в колбах Эрленмеера на орбитальной качалке при 130 об/мин в атмосфере, содержащей 8% углекислого газа, при температуре 37°C. Подсчет плотности клеточной суспензии и доли живых клеток проводят в счетной камере Горяева, при окрашивании трипановым синим. Субкультивируют с частотой 1 раз в 24-48 часов по достижении концентрации живых клеток 1,2 млн кл./мл. Для этого удаляют кондиционированную среду центрифугированием в течение 5 минут на скорости 1200 об/мин, ресуспендируют клеточный осадок свежей средой и распределяют в новые колбы Эрленмеера с отношением субкультивирования 1:6.

За 48 часов до трансфекции клетки высевают по описанной методике в количестве 9 млн клеток на 1 колбу. Из этих клеток за 24 часа до трансфекции также высевают 9 млн клеток на 1 колбу. В день трансфекции доля живых клеток должна составлять не менее 95%. Клетки в день трансфекции, не центрифугируя, разводят до конечной концентрации 0,5 млн кл./мл в среде DG-44 в колбах Эрленмеера. Стерильную, осажденную этанолом плазмидную ДНК растворяют в фосфатно-солевом растворе и используют для получения трансфекционной смеси.

Трансфекцию полученной плазмиды pOptivec/F8BDD в клетки линии СНО DG-44 проводят при помощи липосомного реагента FreeStyle MAX (Invitrogen) в бессывороточной среде OptiPro SFM (Invitrogen). Клетки в день трансфекции, не центрифугируя, разводят до конечной концентрации 0,5 млн кл./мл в среде DG-44 в колбах Эрленмеера. Стерильную, осажденную этанолом плазмидную ДНК растворяют в PBS буфере и используют для получения трансфекционной смеси, содержащей 18 мкг плазмидной ДНК, 15 мкл трансфекционного агента.

Плазмидная ДНК, используемая для трансфекции, представляет собой смешанные в соотношении 20:1 по массе плазмиды pOptivec/F8BDD, линеаризованную эндонуклеазой рестрикции PvuI, и сверхспирализованную контрольную плазмиду pEGFP (Clontech, США). Трансфекционную смесь осторожно перемешивают и инкубируют от 10 до 20 минут, а затем осторожно добавляют во вращающуюся колбу, содержащую клетки СНО DG-44, в указанном выше количестве. Экспрессируемый в трансфицированных клетках флуоресцентный белок используется для оценки эффективности трансфекции. Для этого через 12 часов после трансфекции в пробе клеток определяют долю флуоресцирующих при анализе с помощью пары оптических фильтров EGFP. Полученное соотношение характеризует интенсивность транзиентной экспрессии в трансфицированных клетках.

Для отбора стабильных трансформантов с включением в хромосомную последовательность плазмидной ДНК pOptivec/F8BDD трансфицированные клетки СНО DG-44 пересаживают в среду CD OptiCHO (Invitrogen), не содержащую гипоксантин и тимидин, и культивируют по следующей методике.

Проводят подсчет плотности клеточной суспензии и доли живых клеток в счетной камере Горяева при окрашивании трипановым синим. Затем удаляют старую среду центрифугированием в течение 5 минут на скорости 1200 об/мин, ресуспендируют клеточный осадок свежей средой CD OptiCHO (Invitrogen), с добавлением L-глутамина в конечной концентрации 8 мМ, и распределяют в новые колбы Эрленмеера по 9×106 клеток на колбу. Клетки культивируют в колбах Эрленмеера на орбитальной качалке при 130 об/мин в атмосфере, содержащей 8% углекислого газа, при температуре 37°C. Субкультивируют с частотой 1 раз в 2 дня в течение 10-14 дней до достижения доли живых клеток более 90%. По достижении доли живых клеток 90% и более замораживают промежуточный клеточный банк с образцами, содержащими по 107 клеток в 1 мл среды CD OptiCHO с добавлением 10% DMSO. Полученный по приведенной методике пул трансфицированных клеток в форме суспензионной культуры обогащают путем культивации в ростовой среде, не содержащей гипоксантина и тимидина, в течение 14 дней.

Для амплификации целевого гена BDD-rfVIII проводят селекционное культивирование в присутствии нарастающих доз метотрексата путем последовательных пассажей в ростовой среде, дополнительно содержащей 50, 100, 250, 500 нМ метотрексата. Для этого образцы из промежуточного банка размораживают по описанному выше протоколу, с теми изменениями, что в качестве культивационной среды используется CD OptiCHO (Invitrogen), с добавлением L-глутамина в конечной концентрации 8 мМ. Затем в культивационную среду добавляют метотрексат в диапазоне концентраций от 50 нМ до 500 нМ с удвоением рабочей концентрации метотрексата на каждом шаге амплификации. Переход к следующему шагу амплификации осуществляют каждые 14-21 день по достижении доли живых клеток более 90%.

Обогащенную культуру трансфицированных клеток используют для создания первичного криобанка и для получения клонов трансфицированных клеток.

На каждом шаге амплификации уровень экспрессии целевого белка в культуре клеток определяют иммуноферментным анализом. Клетки продуценты последнего шага амплификации клонируются методом предельных разведений, в расчете конечной концентрации 2 клетки на лунку в условиях адгерентной культивации.

Получают 22 жизнеспособных клона клеток, секретирующих В-домен делегированный фактор свертываемости крови VIII человека в ростовую среду. Среди них отбирают 4 клона, дающих наибольшую концентрацию рекомбинантного белка в пересчете на число клеток в лунке.

Отобранные клоны культивируют в течение четырех последовательных пассажей и подвергают криопрезервации для создания мастер-банка клеток-продуцентов. Затем эти клоны реадаптируют к суспензионному культивированию еще в течение трех пассажей для получения кондиционированной ростовой среды, содержащей целевой белок. Для отобранных клонов проводят анализ контаминации микоплазмой, проверяют, что ни один из клонов не содержит ДНК микоплазмы.

Измерение концентрации рекомбинантного фактора свертываемости крови VIII с делецией В-домена в кондиционированной ростовой среде, проведенное при помощи ИФА, показало, что продуктивность гетерологической системы экспрессии, созданной на основе наилучшего клона, составляет около 0,5 ЕД/млн клеток/сутки. Продуктивность системы была приблизительно постоянна в течение трех последовательных пассажей, что указывает на стабильность всех или большинства геномных копий ДНК BDD-rfVIII. Выбранный клон (код DG-OV-F8BDD-18) последовательно культивируют в 3, 15, 100 и 200 мл ростовой среды CD OptiCHO до достижения клеточной плотности 3 млн/мл. Культивирование в объеме ростовой среды дополнительно проводят в течение 3 дней, ежедневно добавляя глютамин до 4 мМ и глюкозу до 3 мМ.

Кондиционированную ростовую среду отделяют от клеточной массы, концентрируют, обессоливают и замораживают. Содержание целевого рекомбинантного белка определяют при помощи ИФА. Было показано, что концентрация целевого белка составляет не менее 500 ЕД/л/сутки при концентрации клеток в с суспензии 1 млн/мл. При проведении всех работ не используются материалы животного происхождения, что позволяет избежать контаминации создаваемой линии клеток вирусами животных, включая не охарактеризованные на настоящий момент, и прионами. Созданная линия клеток получена на основе широко распространенной в биофармацевтической промышленности линии СНО DG-44 и обеспечивает максимально возможную вирусную и прионную безопасность продукта.

Скачать патент РФ Официальная публикация
патента РФ № 2429294

patent-2429294.pdf

Класс C12N15/12 гены, кодирующие животные белки

модифицированная дрожжевая двугибридная система для эффективного исследования взаимодействия между белками и их доменами. -  патент 2529356 (27.09.2014)
лейколектины и их применение -  патент 2528860 (20.09.2014)
способ получения пептидов, специфично распознающих определенные типы клеток и предназначенных для терапевтических целей -  патент 2528739 (20.09.2014)
кодон-оптимизированная кднк, кодирующая дисферлин человека, генно-инженерная конструкция, рекомбинантный аденовирус и фармацевтическая композиция для лечения дисферлинопатий -  патент 2527073 (27.08.2014)
антитела против g-белка распираторно-синцитиального вируса (rsv) -  патент 2526517 (20.08.2014)
антитело к epha2 -  патент 2525133 (10.08.2014)
рекомбинантная плазмидная днк pqe30/derf2l, кодирующая белок der f 2l клеща dermatophagoides farinae и штамм бактерий escherechia coli m15/ pqe30/derf2l - продуцент такого белка. -  патент 2522817 (20.07.2014)
регулирование продуктивных признаков у птиц -  патент 2518681 (10.06.2014)
изолированный полипептид и его применение для лечения ракового заболевания или стимуляции иммунной системы, фармацевтическая композиция, содержащая такой полипептид и способ лечения рака. -  патент 2518236 (10.06.2014)
выделенная нуклеиновая кислота, кодирующая флуоресцентный биосенсор, кассета экспрессии, клетка продуцирующая флуоресцентный биосенсор, выделенный флуоресцентный биосенсор -  патент 2515903 (20.05.2014)

Класс C12N15/79 векторы или экспрессионные системы, специально приспособленные для эукариотических хозяев

искусственный ген mel-tci-a0201, кодирующий полиэпитопный белок-иммуноген mel-tci-a0201, рекомбинантная плазмидная днк pmel-tci-a0201, обеспечивающая экспрессию искусственного гена mel-tci-a0201 и искусственный белок-иммуноген mel-tci-a0201, содержащий множественные ctl- и th-эпитопы антигенов меланомы -  патент 2522830 (20.07.2014)
полинуклеотидная последовательность, кодирующая сконструированный белок пертактин, вектор, включающий такую последовательность, и вакцинные композиции, содержащие белок пертактина или вектор -  патент 2499046 (20.11.2013)
вектор экспрессии млекопитающих -  патент 2494147 (27.09.2013)
способ стимулирования нейрогенерации с помощью генетических конструкций -  патент 2459630 (27.08.2012)
способ получения иммортализованной клетки человека, стабильно трансфицированная иммортализованная клетка человека, способ рекомбинантной продукции целевого белка человека, применение вектора трансфекции -  патент 2453597 (20.06.2012)
получение биологически активных белков -  патент 2441911 (10.02.2012)
рекомбинантная плазмидная днк pbmc-rt(а)-hum для экспрессии белка обратной транскриптазы вируса иммунодефицита человека -  патент 2355764 (20.05.2009)
выделенный полипептид, связывающий рецептор zalpha11-лиганда (варианты), кодирующий его полинуклеотид (варианты), вектор экспрессии (варианты) и клетка-хозяин (варианты) -  патент 2346951 (20.02.2009)
рекомбинантная плазмидная днк, кодирующая последовательность белка фактора vii человека, линия клеток внк/f7, трансформированная плазмидной днк -  патент 2337965 (10.11.2008)
вакцинные композиции, способы их применения для профилактики и лечения меланомы и генетические конструкции для получения действующих компонентов композиции -  патент 2333767 (20.09.2008)

Класс C12N15/06 клетки животных

Наверх