Поиск патентов
ПАТЕНТНЫЙ ПОИСК В РФ

производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие противовирусную активность в отношении рнк-вирусов

Классы МПК:C12N7/04 инактивация или истощение; получение субъединиц вирусов
C07D487/08 мостиковые системы
Автор(ы):, , , , , , ,
Патентообладатель(и):Учреждение Российской академии наук Институт химической биологии и фундаментальной медицины Сибирского отделения РАН (СО РАН) (RU)
Приоритеты:
подача заявки:
2008-12-17
публикация патента:

Изобретение относится к области химии и медицины и касается новых соединений, являющихся производными N-замещенного 1,4-диазабицикло[2.2.2.]октана. Предложенные соединения проявляют противовирусную активность и могут найти применение в медицине как активные компоненты для разработки лекарственных форм препаратов, используемых для лечения вирусных заболеваний. 7 ил, 4 табл.

Рисунки к патенту РФ 2399669

производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669

Изобретение относится к области химии и медицины, а именно к новым соединениям, проявляющим противовирусную активность в отношении РНК-вирусов.

Вирусные заболевания представляют собой общую угрозу здоровью населения во всем мире. Среди вирусов, вирусы, содержащие геном в виде РНК, вызывают целый ряд серьезных заболеваний животных (домашних и диких) и являются одними из наиболее опасных для человека. Высоко патогенные РНК-вирусы, такие как вирус гриппа птиц (Avian Influenza Virus), клещевой энцефалит (Tick-borne enchefalitis), вирус Денге (Denge virus), коронавирус (SARS) и т.д., являются постоянной угрозой для здоровья населения. На сегодняшний день особую опасность представляют вирусы птиц и животных, способных заражать людей (Lipsitch, M. et al. Science, 2006, 312, 845; Krug, R.M. Science, 2006, 311, 1562-1563; Chen, H. et al. Nature, 2005, 436,191-192). Например, долгое время считалось, что вирус гриппа птиц не может переходить к людям, однако в последние годы было зарегистрировано большое число передач вируса от птиц к человеку, что вызывало смертельные исходы у заразившихся людей. (Subbarao, K. et al. Science, 1998, 279, 393-396; Fouchier, R.A. et al. Proc. Natl. Acad. Sci., USA, 2004, 101, 1356-1361). Вспышки высокопатогенного вируса гиппа H5N1 в некоторых азиатских и европейских странах вызвало серьезное опасение со стороны мирового сообщества (Koopmans, M. et al. Lancet, 2004, 363, 587-593; Enserink, M., Science, 2006, 311, 932; Fabain, N.J. Environ. Health 2006, 68, 46-63). Опасность эпидемий и пендемий, вызванных РНК-вирусами, делает разработку новых противовирусных препаратов и новых средств и способов их инактивации одной из наиболее актуальных задач сегодняшнего дня.

В настоящее время в качестве средств инактивации вирусов используют физические методы (облучение ультрафиолетовым светом, ионизирующее излучение, нагревание при повышенном давлении) и целый ряд химических соединений (формалин, производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 -пропиолактон, этиленимин, ряд детергентов), которые различаются механизмом действия и, следовательно, областью применения, токсичностью, эффективностью инактивации вируса и стоимостью (De Benedictis, P. et al. Zoonoses Public Health. 2007, 54(2), 51-68.).

Спектр соединений, позволяющих инактивировать вирус, в том числе и для получения цельновирионных вакцин, ограничен несколькими соединениями: это формальдегид, производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 -пропиолактон (Goldstein M. and Tauraso N., Applied Microbiol., 1970, 19, 290-294), этиленимин и его производные (Budowsky E.I., et al., Vaccine, 1991, 9, 473-476; Aarthi d., et al, Biologicals, 2004, 32, 153-156), облучение УФ-светом (Budowsky E.I., et al., Arch. Virol., 1981, 68-239-246) или УФ-светом в присутствии соединений, повышающих фоточувствительность вируса (Kasermann F. and Kempf C., Antiviral Res., 1997, 34, 65-70), окисление кислородом воздуха на свету (Kasermann F. and Kempf C., Rev. Med. Virol., 1998, 8, 143-151). Известно, что обработка вируса такими соединениями приводит к частичному разрушению вирусных антигенных детерминант, и тем самым к снижению иммуногенных свойств вакцин, а выборочное разрушение формалином антигенных детерминант поверхностных гликопротеидов вирусов может индуцировать развитие несбалансированного иммунного ответа (Kasermann F., et al., Antiviral Res., 2001, 52, 33-41).

Идеальной мишенью для инактивации вируса гриппа является его геномная РНК. После разрушения геномной РНК-вирус теряет способность к репликации и, таким образом, не может размножаться.

Наиболее ближайшими к заявляемым соединениям - прототипом являются производные 1,4-диазабицикло[2.2.2.]октана общей формулы Dxn, обладающие высокой рибонуклеазной активностью [N.Koval'ov, et al., Nucleosides, Nucleotides and Nucleic Acids. 2004, 32, 981-985.] На Фиг.1 представлена структурная формула соединений Dxn, где n=1, 4, 6 или 12, х - положение в бензольном кольце - орто, мета или пара. Было показано, что рибонуклеазная активность этих соединений возрастает с увеличением длины алкильного фрагмента у кватернизованного атома азота 1,4-диазабицикло[2.2.2.]октана. Кроме того, активность соединений зависела от взаимного расположения двух замещенных остатков диазабициклооктана в бензольном кольце - наибольшая рибонуклеазная активность наблюдалась у пара-изомера.

Недостатками известных соединений Dxn являются относительно невысокая рибонуклеазная активность, высокая цитотоксичность и низкая эффективность инактивации РНК-вирусов.

Технической задачей изобретения является получение новых эффективных, низкотоксичных синтетических соединений (искусственных рибонуклеаз), обладающих рибонуклеазной, мембранолитической и противовирусной активностью.

Поставленная техническая задача решается предлагаемыми соединениями, представляющими собой производные N-замещенного 1,4-диазабицикло[2.2.2.]октана общей формулы [D(R)] 2L,

производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669

где R=-(СН2)3 C6F13 для (1), -C12H25 для (2) и (3), a L=-С6Н4- для (1); 1,4-замешенный бут-2-ин - для (2) и 1,5-замещенный пентан - для (3).

На фигуре 2 представлены структурные формулы соединений (1), (2), и (3).

Новые соединения (1), (2), и (3) общей формулы [D(R)]2L были получены по общей схеме, представленной на фигуре 3. Процесс получения заявляемых соединений включает в себя реакцию коммерчески доступных 1,4-диазабицикло[2.2.2]октана (D) с галогенпроизводным углеводорода, с образованием монозамещенного 1,4-диазабицикло-[2.2.2]октана (DR), как описано в (Katritzky A.R.; Rao M.S.C. J.Heterocyclic Chem. 1991, 28, 1115), которое далее вступает в реакцию с коммерчески доступными дигалоген производными различных углеводородов. В результате реакции с высокими выходами образуется продукт, содержащий два N-замещенных остатка 1,4-диазабицикло[2.2.2]октана, связанных различными линкерами (бензол - в случае (1), бутин-2 - в случае (2) и пентан - в случае (3)).

Спектры ЯМР 1H, 13С и 19F регистрировались на спектрометрах "Bruker АМ-400" (1Н - 400, 19F - 100, 13С - 100 МГц соответственно). В качестве внутреннего стандарта использовали сигналы остаточных протонов растворителя (производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 /м.д., J/Гц). ИК-спектры регистрировали на спектрометре "Bruker Vector-22" (Германия) в таблетках KBr. В работе использованы изомеры бис(хлорметил)бензола, 1,8-бис(бромметил)нафталин, 2,2'-бис(бромметил)бифенил, цис-1,4-дихлоробут-2-ен, транс-1,4-дибромобут-2-ен и 1,4-дихлоробут-2-ин фирмы Aldrich (США), остальные реактивы были отечественного производства квалификации «х.ч.» и «о.с.ч.». Все растворители очищали по стандартным методикам.

Для повышения рибонуклеазной активности заявляемых соединений была увеличена гидрофобность углеводородных заместителей путем замены в них части водородных атомов на атомы фтора (соединение (1)). Для оптимизации геометрии молекулы и взаиморасположения двух остатков N-замещенного 1,4-диазабицикло[2.2.2]октана были получены соединения (2) и (3), содержащие жесткий и гибкий линкеры, отличные от ранее описанных соединений Dxn.

Для изучения рибонуклеазной активности заявляемых соединений использовали 96-звенный фрагмент РНК-вируса иммунодефицита человека HIVI и синтетический олигорибонуклеотид ON21, r(UCGAAUUUCCACAGAAUUCGU). ON21 был синтезирован в Лаборатории химии РНК ИХБФМ СО РАН фосфитамидным методом на синтезаторе ASM-102U (ТОО "БИОССЕТ", Новосибирск) и очищен ионообменной и обращеннофазовой хроматографией или препаративным электрофорезом в денатурирующих условиях. Чистоту олигонуклеотида проверяли с помощью электрофореза в 15% ПААГ в денатурирующих условиях, визуализацию олигонуклеотида в геле проводили с помощью окраски Stains-All. Фрагмент РНК был получен с помощью реакции транскрипции in vitro, согласно опубликованному протоколу (Maniatis Т., Fritsch Е.F., Sambrook J. Molecular cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, 1989).

Была исследована рибонуклеазная активность соединений (1), (2), и (3) в реакции расщепления in vitro двух РНК-субстратов - олигорибонуклеотида ON21 и РНК96 и антивирусная активность этих соединений в экспериментах по инактивации РНК содержащих вирусов (вирус гриппа и вирус клещевого энцефалита) и в экспериментах по подавлению репродукции этих вирусов в культуре эукариотических клеток in vitro.

Сопоставительный анализ заявляемых соединений с известными и широко используемыми соединениями, такими как формалин, УФ-свет или мономерный или бинарный этиленимина (Budowsky. E.I., et al., Vac. Res., 1996, 5, 29-39), показал, что предлагаемые соединения обладают следующими преимуществами.

1) Заявляемые соединения обладают одновременно рибонуклеазной, мембранолитической и антивирусной активностями, что позволяет рассматривать их как перспективные лекарственные агенты.

2) Заявляемые соединения малотоксичны для человека и не требуют особых мер предосторожности (противогаз, перчатки, работа под вытяжкой) при работе с ними. Кроме того, эти соединения стабильны при хранении в виде концентрированных водных растворов или растворов в апротонных растворителях, таких как диметилсульфоксид.

3) Заявляемые соединения не оказывают побочного действия на белковые компоненты вирионов, что не снижает иммуногенные свойства инактивированных вирусов и улучшает свойства получаемых на их основе вакцин.

Поиск по источникам научно-технической и патентной литературы показал, что производные N-замещенного 1,4-диазабицикло[2.2.2.]октана общей формулы [D(R)]2L, обладающие одновременно рибонуклеазной, мембранолитической и противовирусной активностями в известных источниках не описаны. Изобретение иллюстрируется следующими примерами.

Пример 1. Получение 1,4-бис-(4-(4,4,5,5,6,6,7,7,8,8,9,9,9-тридекафторнонил)-1,4-диазониабицикло[2.2.2]октил-1-метил)бензола дихлорид дибромида (1)

Схема синтеза соединения (1) представлена на фигуре 4. К раствору 1,4-бис(хлорметил)бензола (4) (17.5 мг, 0.1 ммоль) в 3 мл ацетонитрила добавили раствор бромида 1-(4,4,5,5,6,6,7,7,8,8,9,9-тридекафторнонил)-4-аза-1-азонийбицикло-[2.2.2]октана (5) (116 мг, 0.21 ммоль) в 10 мл смеси ацетонитрил-ацетон. После перемешивания в течение 30-40 ч выпавший осадок отфильтровали, промыли ацетонитрилом (3 раза по 10 мл) и высушили в вакууме. Продукт - гигроскопичный мелкокристаллический порошок белого цвета. Масса полученного соединения (1) 72 мг (выход 67%).

Спектр ЯМР 1H, производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 , м.д. (J, Гц): 2.17 (м, 4H, CH2CH 2CH2N+), 2.37 (м, 4H, CH 2CH2N+); 3.69 (м, 4H, (CH2 )2CH2N+); 4.12 (м, 24H, +N(CH2CH2) 3N+); 4.98 (с, 4H, PhCH2N +); 7.83 (с, 4H). Спектр ЯМР 13C, производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 , м.д.: 13.67 (2C, CH2CH2N +); 26.85 (2C, CF2CH2); 50.56 и 51.18 (12C, NCH2CH2N); 63.17 (2C, CH2N); 67.16 (2C, CH2 Ph); 128.77(4C, C3, 4, 5, 6); 133.66 (2C, C1,2 ). Спектр ЯМР F19, производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 , м.д.: 35.96 (2F, CF2CH2); 38.89 (2F, CF2CF2CH2); 39.42 (2F, CF2(CF2)2CH 2); 40.42 (2F, CF2(CF2) 3CH2); 48.23 (2F, CF3CF 2); 80.90 (3F, CF3).

Пример 2. Получение 1,4-бис-(4-додецил-1,4-диазониабицикло[2.2.2]октил-1-метил)бут-2-ина терахлорида (2)

Схема синтеза соединения (2) представлена на фигуре 5. К раствору хлорида 1-додецил-4-аза-1-азониабицикло[2.2.2]октана (6) (349 мг, 1.1 ммоль) в 20 мл ацетонитрила добавили по каплям раствор 1,4-дихлоробут-2-ина (7) (61.5 мг, 0.5 ммоль) в 5 мл ацетонитрила. После перемешивания в течение 24 ч выпавший осадок отфильтровали, промыли ацетонитрилом (3×15 мл) и высушили в вакууме. Продукт - гигроскопичный мелкокристаллический порошок желтоватого цвета. Масса полученного соединения (2) 296 мг (выход 78%).

Спектр ЯМР 1H, производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 , м.д. (J, Гц): 0.89 (уш. т, 6H, CH3(CH 2)11N+, J 6.6), 1.27 (м, 36H, CH 3(CH2)9CH2CH 2N+); 1.73 (м, 4H, CH3(CH2 )9CH2CH2N+ );

3.55 (м, 4H, CH3(CH2) 10CH2N+); 4.15 (м, 24H, +N(CH2CH2)3 N+); 5.09 (с, 4H, CHCH2N+ ). Спектр ЯМР 13С, производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 , м.д.: 13.73 (CH3(CH2) 11N+); 21.27 (CH3(CH2) 9CH2CH2N+); 21.88 (CH3CH2(CH2)10 N+); 25.43, 28.27, 28.50, 28.56, 28.74, 28.82, 31.10 (CH3(CH2)2(CH2 )8CH2N+); 53.22 (CH3 (CH2)10CH2N+); 50.31 и 50.97 (+N(CH2CH2 )3N); 63.62 (CCH2N+); 80.16 (CCH2N+).

ИК спектр: 850.76 1061, 1113, 1173, 1468, 1636, 2058 (мал), 2853, 2923, 3417.

Пример 3. Получение 1,5-бис-(4-додецил-1,4-диазониабицикло[2.2.2]октан-1-ил)пентан дихлорид дибромида (3)

Схема синтеза соединения (3) представлена на фигуре 6. К раствору хлорида 1-додецил-4-аза-1-азониабицикло[2.2.2]октана (6) (349 мг, 1.1 ммоль) (схема 4) в 10 мл диметилформамида добавили по каплям 1,5-дибромидпентана (8) (115 мг, 0.5 ммоль). После перемешивания в течение 24 ч при 80°C выпавший осадок соединения (3) отфильтровали, промыли ацетонитрилом (3 раза по 15 мл) и высушили в вакууме. Получено гигроскопичное мелкокристаллическое вещество. Масса полученного соединения (3) 247 мг (выход 57%).

Спектр ЯМР 1H, производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 , м.д. (J, Гц): 0.93 (уш. т, 6H, CH3(CH 2)11N+, J 6.6), 1.32-1.45 (м, 36H, CH3(CH2)9CH2 CH2N+); 1.32 (м, 2Н, +NCH 2CH2CH2CH2CH 2N+); 1.88 (м, 4H, CH3(CH2 )9CH2CH2N+ ); 1.98 (м, 4H, +NCH2CH2 CH2CH2CH2N+ ); 3.62 (м, 4H, CH3(CH2)10C H2N+); 3.75 (м, 4Н, CH2C H2N+); 4.07-4.12 (м, 24H, + N(CH2CH2)3N +). Спектр ЯМР 13C, производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 , м.д.: 12.95 (CH3(CH2) 11N+); 21.27 (CH3(CH2) 9CH2CH2N+); 21.64 (CH3CH2(CH2)10 N+); 22.21 (2С, 2xC10); 25.63 (2, 2xC9); 25.63 (2C, C2, C4); 28.66 (2C, 2xC8); 28.95 (4C, 2xC7, 2xC6,); 29.10 (4C, 2xC5, 2xC4); 29.10 (1C, C3); 29.21 (2C, 2xC3); 31.54 (2C, 2xC2); (CH3(CH2)2(CH2 )8CH2N+); 64.24 (CH3 (CH2)10CH2N+ ); 50.81 и

51.03 (+N(CH 2CH2)3N); 64.71 (CC H2N+).

Пример 4. Расщепление олигонуклеотида ON21 соединениями (1), (2) и (3).

Эксперименты по расщеплению РНК заявляемыми соединениями проводили в следующих условиях: стандартная реакционная смесь объемом 10 мкл содержала 10000 имп/мин по Черенкову [5'-32 P]-меченого ON21 (стабилизированного немеченым ON21 в концентрации 5×10-6 М), [5'-32P]-РНК96 одно из соединений (1), (2), (3) в концентрациях от 10-6 до 10-3 M и 50 mM Tris-HCl pH 7.0, содержащий 0.2 М KCl, 0.5 mM EDTA.

Реакции проводили при 37°C в течение 1-20 ч и останавливали путем осаждения продуктов реакции 10 объемами (100 мкл) 2%-го раствора LiClO4 в ацетоне. Осадок РНК и продуктов ее расщепления отделяли центрифугированием, растворяли в 5 мкл буфера для нанесения на гель. Продукты расщепления РНК анализировали электрофорезом в 15%-ном ПААГ, содержащем 8 М мочевину. Гель после электрофореза высушивали и анализировали с помощью прибора фосфоримиджер "Molecular Imager FX". Степень расщепления РНК определяли как отношение количества радиоактивности в полосе, соответствующей продукту расщепления, к общей радиоактивности, нанесенной на дорожку.

При установлении зависимости степени расщепления РНК от концентрации соединений (1), (2), (3) было обнаружено, что зависимость имеет вид колоколообразной кривой с оптимумами для соединения (1) при концентрации 0.1 мМ, а для соединений (2) и (3) при концентрации 0.01 мМ. При концентрациях соединений выше или ниже оптимальной степень расщепления РНК понижается.

В таблице 1 представлены зависимости степени расщепления РНК от концентрации соединений (1), (2), (3). Выделенные ячейки соответствуют наибольшей степени расщепления РНК данным соединением.

производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669

При установлении зависимости степени расщепления РНК соединениями (1), (2), (3) от времени выяснилось, что степень расщепления РНК линейно возрастает с увеличением времени инкубации вплоть до 20 часов, а через 24 ч инкубации в реакционной смеси остается не более 20% исходной РНК (Таблица 2). На линейном участке кинетической кривой по уравнению [P] t=[P]производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 ×(l-e-Kobs×t), где [P]t и [P]производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 , - степени расщепления субстрата за время t и за бесконечное время (можно принять, что за бесконечное время субстрат расщепится на 100%) были найдены константы скорости реакции K obs, равные 0.068, 0.063 и 0.059 ч-1 для (1), (2), (3) соответственно.

Таблица 2
Зависимость степени расщепления РНК в присутствии соединений (1), (2), (3) от времени
Время, ч Степень расщепления РНК, %
(1)(2) (3)
0 0 0производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669
17 76
3 1410 11
7 25 2318
12 5147 42
24 81 8487

Приведенные данные подтверждают высокую рибонуклеазную активность соединений (1), (2), (3).

Пример 5. Влияние соединений (1), (2), (3) на жизнеспособность клеток MDCK

Клетки линии MDCK (клетки почек собаки) культивировали в среде IMDM, содержащей 10%-ную эмбриональную телячью сыворотку, антибиотики (100 ед./мл пенициллина и 0.1 мг/мл стрептомицина) и антимикотик амфотерицин (0.25 мкг/мл), в атмосфере 5%-ного CO2 при 37°C.

Жизнеспособность клеток после инкубации с соединениями (1), (2), (3) определяли с помощью МТТ теста, который основан на способности живых клеток превращать соединения на основе тетразола (МТТ) в ярко окрашенные кристаллы формазана, что позволяет спектрофотометрически оценивать количество живых клеток в препарате. Для этого клетки высаживали в 96-луночные планшеты (104 клеток на лунку). Через 24 ч в лунках меняли среду и к клеткам добавляли водный раствор соединения (1), (2) или (3) в воде до конечной концентрации в среде от 10-8 до 10-4 M. Клетки инкубировали в присутствии соединений еще в течение суток в тех же условиях. По окончании инкубации без смены среды к клеткам добавляли раствор МТТ (5 мг/мл) в фосфатно-солевом буфере до концентрации 0.5 мг/мл и инкубировали в течение 3 ч в тех же условиях. Среду удаляли, к клеткам добавляли по 100 мкл диметилсульфоксида, в котором происходит растворение образовавшихся в клетках кристаллов формазана, и измеряли оптическую плотность на многоканальном спектрофотометре на длинах волн 570 и 630 нм, где A570 - поглощение формазана, а A630 - фон клеток.

Из экспериментальных данных вычисляли значение IC50, концентрацию соединений, при которой наблюдается гибель 50% клеток. Значения IC50 соединений (1), (2) или (3) для клеток MDCK приведены в таблице 3.

Таблица 3.
Значения IC50 соединений (1), (2) или (3) для клеток MDCK
Соединение IC50, мкМ
(1) 55±15
(2)53±15
(3) 12±3

Из приведенных данных видно, что обработка клеток соединениями (1), (2) или (3) вызывает их эффективную гибель только при концентрациях соединений выше 10 мкМ, что свидетельствует о низкой токсичности соединений.

Пример 6. Инактивация вируса гриппа соединениями (1), (2), (3).

Вирулицидную активность искусственных рибонуклеаз (1), (2), (3) изучали на модели вируса гриппа A/WSN/33, (H1N1).

Использовали вирус гриппа A/WSN/33, (H1N1) с инфекционным титром 106 фокус-образующих единиц (ФОЕ) вируссодержащего материала. Инфекционную активность вируса определяли методом ФОЕ на клетках MDCK (клетки почки собаки). В основе метода лежит модифицированная иммуноферментная реакция: вирусные белки, экспрессирующиеся в инфицированных вирусом клетках, специфически связываются с моноклональными антителами, мечеными ферментом. Далее фермент взаимодействует с субстратом, что приводит к окрашиванию инфицированной клетки. Инактивацию вируса гриппа соединениями (1), (2), (3) проводили при 37°C в 50 мМ Трис-HCl буфере, pH 7.0, содержащем 0.2 M KCl и 2 мМ EDTA, в течение 18 ч при 37°C при концентрациях соединений (1), (2), (3) от 2 мкМ до 100 мкМ.

Соединения (1), (2), (3) эффективно инактивируют вирус гриппа, причем уровень инактивации вируса повышается с увеличением концентрации соединений, при которой проводили инактивацию вируса. Так, инкубация вируса в течение 18 ч при 37°C с соединениями (1), (2), (3) в концентрации 10 мкМ снижает титр вируса на 2.4 порядка по сравнению с контролем. При увеличении концентрации соединений (1), (2), (3) до 20 мкМ наблюдается полная инактивация вируса гриппа (таблица 4), причем для соединений (1) и (2) эта концентрация в 2,5 раза меньше значения IC50.

Пример 7. Инактивация вируса клещевого энцефалита (КЭ) соединениями (1), (2), (3).

Вирулицидную активность соединений (1), (2), (3) изучали на модели вируса КЭ (штамм Софьин) с инфекционным титром 106 бляшкообразующих единиц (БОЕ). Инфекционную активность вируса КЭ определяли на клетках СПЭВ.

Инактивацию вируса КЭ соединениями (1), (2), (3) проводили при 37°C в 50 мМ буфере Трис-HCl, pH 7.0, содержащем 0.2 M KCl и 2 мМ EDTA, в течение 18 ч при концентрации 20 мкМ.

Соединения (1), (2), (3) в этих условиях (концентрация 20 мкМ, 18 ч, 37°C) полностью инактивируют вирус КЭ (таблица 4).

Таблица 4.
Вирулицидное действие соединений (1), (2), (3).
Название соединения Вирус гриппа Вирус КЭ
Концентрации соединений, использованные для инактивации вируса Титр вируса при инкубации 18 ч при 37°C, lg (ФОЕ/мл) Концентрации соединений, использованные для инактивации вируса Титр вируса при инкубации 18 ч при 37°C, lg (БOE/мл)
(1)20 мкМ <120 мкМ <1
(2)20 мкМ <120 мкМ <1
(3)20 мкМ <120 мкМ <1
контроль- 5,2- 4,2

Инкубация клеток, инфицированных вирусом КЭ с соединением (2) в концентрации 20 мкМ, приводила к снижению репродукции вируса на порядок, по сравнению с контролем.

Полученные результаты однозначно свидетельствуют о высокой антивирусной активности соединений (1), (2), (3).

Пример 8. Исследование мембранолитической активности соединений (1), (2), (3)

Исследование морфологии вирусных частиц после инкубации с соединениями (1), (2), (3) проводили с помощью электронной микроскопии методом негативного контрастирования. Исследуемые образцы сорбировали на опорные электронно-микроскопические сетки, покрытые формоваровой пленкой, в течение 1.5 минут, остаток жидкости убирали, сетку высушивали и помещали в контрастирующий раствор (2% раствор фосфорно-вольфрамовой кислоты в дистиллированной воде) на 45 сек, остаток раствора убирали, сетку высушивали. Образцы (4-6 сеток) изучали в трансмиссионном электронном микроскопе Hitachi-H800 при увеличениях от 10000 до 200000.

Электронно-микроскопическое исследование морфологии вирусных частиц, инактивированных соединениями (1), (2), (3), выявило вирионы с поврежденной липидной оболочкой, у небольшой части вирусных частиц также наблюдали изменение толщины липидного слоя, пепломеры на поверхности вирусной оболочки были сохранены. Степень повреждения структуры вирионов прямо зависела от концентрации соединений (1), (2), (3). По мере возрастания концентрации соединений с 10-7 до 10-3 М происходило развитие повреждений их структуры.

На фиг.7 представлены электронные микрофотографии частиц вируса гриппа, где на снимке (а) изображен интактный вирус (на поверхности сферической частицы видны пепломеры, оболочка не повреждена), на снимках (б) и (в) - вирус гриппа, обработанный искусственной рибонуклеазой в стандартных условиях (на поверхности частиц видны пепломеры, разрывы оболочки, частицы деформированы). Негативное контрастирование ФВК. Длина масштабной линии 50 нм.

На основании результатов электронно-микроскопических исследований можно заключить, что соединения (1), (2), (3) дезинтегрируют липидные оболочки вирионов, то есть обладают мембранолитической активностью, что приводит к инактивации вируса.

Таким образом, приведенные примеры однозначно указывают на высокую рибонуклеазную, мембранолитическую и антивирусную активность соединений (1), (2) и (3), что позволяет использовать их в качестве активных компонентов для разработки лекарственных форм препаратов, предназначенных для лечения вирусных заболеваний.

ФОРМУЛА ИЗОБРЕТЕНИЯ

Производные N-замещенного 1,4-диазабицикло[2.2.2.]октана со структурными формулами

производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669 производные n-замещенного 1,4-диазабицикло-[2.2.2]-октана, проявляющие   противовирусную активность в отношении рнк-вирусов, патент № 2399669

проявляющие противовирусную активность в отношении РНК-вирусов.


Скачать патент РФ Официальная публикация
патента РФ № 2399669

patent-2399669.pdf
Патентный поиск по классам МПК-8:

Класс C12N7/04 инактивация или истощение; получение субъединиц вирусов

Патенты РФ в классе C12N7/04:
поликатионное соединение "тривирон (triviron)" и способ его получения -  патент 2527256 (27.08.2014)
аттенуированный рекомбинантный парвовирус, пригодный для защиты собак от инфицирования парвовирусом -  патент 2527157 (27.08.2014)
вирус диареи крупного рогатого скота с модифицированным белком erns -  патент 2524426 (27.07.2014)
рекомбинантный вирус классической чумы свиней (csfv), содержащий модифицированный белок е2, и способы создания указанного рекомбинантного csfv -  патент 2501854 (20.12.2013)
способ определения вирулентных и патогенных форм вирусов гриппа -  патент 2489488 (10.08.2013)
способ получения вируса гриппа -  патент 2484136 (10.06.2013)
способы упаковки олигонуклеотидов в вирусоподобные частицы рнк-содержащих бактериофагов -  патент 2476595 (27.02.2013)
ингибитор репродукции вируса гриппа а на основе комплекса наночастиц диоксида титана и олигонуклеотида -  патент 2466188 (10.11.2012)
способы и композиции для экспрессии антисмысловой вирусной рнк в клетках собаки -  патент 2457250 (27.07.2012)
новый тип частиц-носителей (платформ) для получения активных комплексов -  патент 2441667 (10.02.2012)

Класс C07D487/08 мостиковые системы

Патенты РФ в классе C07D487/08:
поликатионное соединение "тривирон (triviron)" и способ его получения -  патент 2527256 (27.08.2014)
производное бензола или тиофена и его применение в качестве ингибитора vap-1 -  патент 2526256 (20.08.2014)
замещенные аминоинданы и их аналоги, и их применение в фармацевтике -  патент 2522586 (20.07.2014)
способ получения 5-метокси-4-азатрицикло[4.3.1.1 3,8]ундец-4-ена -  патент 2515500 (10.05.2014)
пролекарства нестероидных противовоспалительных средств (nsaia) c очень высокой скоростью проникновения через кожу и мембраны и новые медицинские применения указанных пролекарств -  патент 2509076 (10.03.2014)
макроциклические ингибиторы серинпротеазы -  патент 2490272 (20.08.2013)
алициклические производные n, n'-замещенных 3,7-диазабицикло[3.3.1]нонанов, обладающие фармакологической активностью, и лекарственные средства на их основе -  патент 2489436 (10.08.2013)
средство, проявляющее противирусную активность в отношении днк-вирусов -  патент 2487876 (20.07.2013)
макроциклические индолы в качестве ингибиторов вируса гепатита с -  патент 2486190 (27.06.2013)
диметил 4-ацил-1-гидрокси-3-метил-7-оксо-6-фенил-2,6-диазабицикло[3.2.1]окт-3-ен-5,8-дикарбоксилаты и способ их получения -  патент 2478638 (10.04.2013)

Наверх