способ лечения (коррекции) косметических и возрастных дефектов кожи при сочетанном применении технологии фракционного фототермолиза с биологически активными ингредиентами вне зависимости от способа введения

Классы МПК:A61K36/74 Rubiaceae (семейство мареновых)
A61N5/067 с использованием лазерного луча
A61P17/00 Лекарственные средства для лечения дерматологических заболеваний
Автор(ы):, ,
Патентообладатель(и):Лешков Сергей Юрьевич (RU),
Вихриева Нина Сергеевна (RU),
Ляшенко Алла Анатольевна (RU)
Приоритеты:
подача заявки:
2007-07-30
публикация патента:

Изобретение относится к медицине, а именно к косметологии, дерматологии. Способ включает проведение фракционного фототермолиза в сочетании с введением препарата «Кофеберри». Прием «Кофеберри» осуществляют по 1 капсуле 2 раза в день за три дня до проведения фракционного фототермолиза и в день его проведения. Способ обеспечивает уменьшение пост-лазерного отека, укорочение фаз воспалительного ответа, исключение боли и дискомфорта после процедуры. 1 з.п. ф-лы, 4 ил.

способ лечения (коррекции) косметических и возрастных дефектов   кожи при сочетанном применении технологии фракционного фототермолиза   с биологически активными ингредиентами вне зависимости от способа   введения, патент № 2370275 способ лечения (коррекции) косметических и возрастных дефектов   кожи при сочетанном применении технологии фракционного фототермолиза   с биологически активными ингредиентами вне зависимости от способа   введения, патент № 2370275 способ лечения (коррекции) косметических и возрастных дефектов   кожи при сочетанном применении технологии фракционного фототермолиза   с биологически активными ингредиентами вне зависимости от способа   введения, патент № 2370275 способ лечения (коррекции) косметических и возрастных дефектов   кожи при сочетанном применении технологии фракционного фототермолиза   с биологически активными ингредиентами вне зависимости от способа   введения, патент № 2370275

Формула изобретения

1. Способ коррекции возрастных дефектов кожи путем фракционного фототермолиза в сочетании с введением препарата «Кофеберри», прием которого осуществляют по 1 капсуле 2 раза в день за три дня до проведения фракционного фототермолиза и в день его проведения.

2. Способ коррекции по п.1, отличающийся тем, что его применяют для коррекции возрастных признаков увядания и старения кожи, включая снижение антиоксидантной защиты, снижения тургора кожи, в том числе образования коллагена и эластина, образование морщин; падение уровня увлажнения, снижения скорости регенерации, ослабление иммунной защиты, кислородного голодания, нарушения клеточного дыхания, прочих признаков возрастного старения и увядания кожи.

Описание изобретения к патенту

Область техники, к которой относится изобретение

Изобретение относится к области косметологии, дерматологии, эстетической медицины, пластической хирургии, медицины, и может быть использовано для лечения косметических дефектов кожи лица и тела, связанных с нарушением (изменением) метаболизма коллагена, образованием новых сосудов, пигментацией, естественным старением, антиоксидантной защитой, увлажнением. В частности, изобретение может применяться для устранения рубцов, шрамов, стрий, полученных в результате оперативного лечения, травм, ожогов, колебаний веса тела; глубоких и мелких морщин, вызываемых особенностями мимики либо связанных с естественным старением; гемангиом, «винных пятен», ангиом, телеангиоэктазий, других кожных сосудистых патологий; гиперпигментации, в том числе вызванной физиологическим старением кожи, пигментации после перенесенных воспалительных процессов (вызванных ожогами, угрями, иными воспалительными процессами), дисхромий, мелазмы, хлоазмы, прочих пигментаций, связанных с гормональными изменениями (менопауза, беременность), усиливаемых экспозицией под солнечными лучами, веснушек, слоев эумеланина, феомеланина, любых других проявлений пигментации, включающих также генетическую предрасположенность, применение веществ с известным или не известным "фотодинамическим" действием, систематически принимаемых внутрь или наносимых на кожу. Кроме того, изобретение может быть рекомендовано для лечения и устранения косметических дефектов кожи после перенесенных (либо хронических, в состоянии ремиссии) заболеваний, таких как псориаз, акне, герпес, дерматиты (аллергический, себорейный, периоральный), атопический дерматит (нейродермит), крапивница, прочие кожные заболевания, не ограничивающие объем изобретения.

Изобретение может быть использовано для коррекции возрастных признаков увядания и старения кожи, включая снижение антиоксидантной защиты, снижение тургора кожи, в том числе образование коллагена и эластина, образование морщин; падение уровня увлажнения, снижение скорости регенерации, ослабление иммунной защиты, кислородного голодания, нарушение клеточного дыхания, прочих признаков возрастного старения и изменения свойств кожи, не ограничивающих объем изобретения.

Уровень техники

Технология фракционного фототермолиза реализована в лазерной установке Fraxel® (Reliant Technologies). Принцип действия лазера основан на образовании микротермальных зон (МТЗ), повреждающих 20% обработанной поверхности. При этом 80% поверхности кожи, не подвергнутые воздействию лазера, остаются интактными. Эта ткань обеспечивает молекулярный базис для реструктуризации и омоложения всех 100% обработанной поверхности.

В основе молекулярных принципов омоложения лежат механизмы, связанные с внутриклеточным стрессом, источником которого является лазер. Оптимальная длина волны Fraxel (1500 нм), и зоны микротермального повреждения создают условия, при которых происходит активация внутриклеточных механизмов защиты клеток от гибели. При этом сила воздействия оказывается как раз такой, при которой запускаются внутриклеточные каскады анти-апоптотических сигнальных путей, результатом которых является увеличение времени жизни клеток с обновленным метаболизмом.

Из литературы известно, что слабые виды стресса, к которым относится, в частности, энергия света и тепла определенного диапазона, стимулируют клеточные культуры к выживанию (Rattan, 2004a; Rattan, 2004b). Механизм омоложения под влиянием «несмертельных» доз стресса назван гормезисом. В основе гормезиса лежит биологическая активность особых белков стресса, т.н. белков теплового шока (от англ. heat shock proteins - HSP). Гормезис стимулирует экспрессию HSP, которые принимают участие в решении структурной судьбы других белков, важных и не важных для клеточного метаболизма (т.е. выполняют т.н. чаперонную функцию). В клетке в процессе старения накапливается большое количество нефункциональных белков, не участвующих в нормальном клеточном метаболизме. К таковым относятся белки с повышенной степенью гликозилирования, белки с неправильной структурой (с нарушенным фолдингом), белки, подвергнутые воздействию свободных радикалов. Они подлежат деградации, но при нормальных условиях в клетке, которая подвергается хронологическому старению, существуют другие приоритеты, поэтому необходим дополнительный механизм запуска протеолитической деградации указанных белковых компонентов. Гормезис стимулирует активацию протеолитической активности указанных белковых компонентов, ускоряя, таким образом, процессы катаболизма. В основе протеолитической деградации лежит активация протестом - огромных олигомерных белковых комплексов. HSP стабилизируют структуру протеосомы, которые способствуют протеолитической деградации белков. В результате протеолиза полипептидных цепей образуются аминокислоты, пептиды, олигопептиды; некоторые из них способны стимулировать синтез новых белков. Под влиянием гормезиса, индуцируемого лазером, происходит стимуляция образования нового коллагена кожи.

Сочетанное применение фракционного фототермолиза с биологически активными ингредиентами выражается в получении более устойчивого результата, поскольку к общей стимуляции на фоне «эффекта гормезиса» добавляется специфическая коррекция косметических проблем. В зависимости от задачи это могут быть любые биологически активные ингредиенты, разрешенные к применению в косметических и медицинских целях. Так, например, сочетанное использование с коллагеназой камчатского краба позволяет добиться нормализации метаболизма коллагена, который в силу ряда причин оказался нефункциональным. Причинами этого, в числе прочих, могут быть гликозилирование, повреждение ультрафиолетом, воспаление, образование сшивок. Коллагеназа человека не «распознает» такой модифицированный коллаген, в силу чего его накопление и отсутствие стимула для его деградации отрицательно влияет на образование нового коллагена. Применение коллагеназы камчатского краба, биодоступность которой увеличивается на фоне фракционного фототермолиза, расщепляет такой коллаген на фрагменты; некоторые из них стимулируют фибробласты к активации и, следовательно, к неоколлагенезу.

Внедрение фракционного фототермолиза в дерматокосметологию известно с 2003 года, когда Huzaira с коллегами впервые предложили использование метода для лечения кожи, поврежденной ультрафиолетом (Huzaira et al., 2003). Последующие годы однозначно определили применение фракционного фототермолиза для лечения многих других кожных дефектов, включая рубцы, последствия акне, гиперпигментацию, прочие косметические дефекты кожи лица и тела. Так например, в работе Manstein и соавт. продемонстрирован и убедительно доказан клинически значимый эффект коррекции морщин и общего омоложения кожи лица (Manstein et al., 2004). В нескольких работах отмечается положительная динамика в элиминации гиперпигментации кожи лица при использовании фракционного фототермолиза (Rostan, 2005; Rokhsar & Fitzpatrick, 2005; Geronemus, 2006; Wanner et at., 2007). Общее омоложение обработанной лазером поверхности показано, в частности, в работе Laubach et al (2006). Другими авторами демонстрируются хорошие результаты лечения послеоперационных швов. Показано, что уже через 2 недели достигается значительное (75%-ное) улучшение внешнего вида шва (рубца), и положительная динамика сохранялась еще в течение 1 месяца (Behroozan et al., 2006). В недавней публикации отмечен положительный эффект лечение рубцовых изменений кожи при постакне (Hasegawa et al., 2006).

Известно об успешном применении фракционного фототермолиза в медицинских целях, а именно - для лечения особого вида пигментации кожи, - сетчатой пигментной пойкилодермии Сиватта (т.н. меланоз Риля) (Behroozan et al., 2006).

Таким образом, использование фракционного фототермолиза является относительно безопасной и легко переносимой процедурой. Однако в некоторых случаях у пациентов отмечались слабые побочные эффекты, такие как преходящая эритема, сухость кожи, поверхностные царапины, повышенная чувствительность, редко - провокация акне (Fisher & Geronemus, 2005).

В недавней работе расшифрован принцип действия фракционного фототермолиза на уровне клеток (Hantash et al., 2006). По мнению авторов, образование микротермальных зон на обрабатываемом участке кожи создает временную транспортную систему, по каналам которой происходит элиминация некротического дебриса, погибших клеток, пигментов старения, других продуктов деградации, вызванных фототермолизом. Через 4-14 дней происходит полная ре-эпителизация кожных покровов и эксфолиация клеточного дебриса.

Анализ патентного поиска показал широкое использование методов неаблятивного воздействия на кожу. Наибольшей популярностью среди всех типов фототермолиза обладает селективный фототермолиз. Однако его селективность обуславливает некоторые ограничения в его использовании: физико-химические характеристики лазеров, работающих на принципе селективного фототермолиза, и выбор хромофора (гем) ограничивает его использование в основном на уровне сосудистых патологий кожи. Патенты США № № 7066929, 6579284, 6391022, 6214034, 6171301, 5814040, 5766214, 5759200, 5749868, 5746735, 5632741, 5066293, 4829262 подтверждают его селективность воздействия на сосуды за счет влияния определенной длины волны; применение селективного фототермолиза не позиционируется на более широкий спектр воздействий.

В патенте США 6986903 описывается метод применения лазера (или химического пилинга) в сочетании с биологически активными ингредиентами (в частности с коэнзимом Q10 и фосфолипидами) в составе ламеллярной эмульсии «масло-в-воде». Изобретение относится к методам лечения заживления ран и улучшения регенеративной способности кожи. В Патенте США 6897238 предложен метод лазерного фотолечения себорейных проявлений кожных покровов, а также проявлений акне в сочетании с использованием 5-аминолевулиновой кислоты. Обсуждаются дозировки аппликативного нанесения препарата в сочетании с энергией при фотодинамической терапии.

В патенте 6663659 (прототип) обсуждается метод фотомодуляции метаболизма живых клеток, направленный на удаление либо стимуляцию роста волос, уменьшение глубины морщин, уменьшение акне, воздействие на витилиго, удаление швов и т.п. Метод подразумевает сочетанное использование (нанесенные аппликативно, либо принимаемое per os) с такими биологически активными ингредиентами, как витамины С, Е, А, К, F, ретин А (третиноин), адапален, ретинол, гидрохинон, койевая кислота, эхинацея, антибиотики, противогрибковые, отбеливающие вещества, альфа-гидроксикислоты, бета-гидроксикислоты, салициловая кислота, антиоксиданты, производные водорослей, гормоны, минералы, ферменты, генетически измененные биологически активные вещества, ингредиенты растительного происхождения, кофакторы, субстанции анти-старения, инсулин, микроэлементы, субстанции, ингибирующие либо стимулирующие рост волос, натуральный или синтетический меланин, ингибиторы металлопротеиназ, пролин, гидроксипролин, анестезирубщие субстанции, хлорофилл, каротеноиды, а также аналоги или производные вышеупомянутых ингредиентов, как натуральные, так и синтетические. При этом в прототипе не подразумевается технология фракционного фототермолиза, имеет место аппликативное воздействие биологически активных ингредиентов, а также охвачен не полный набор косметических дефектов, которые можно корректировать.

Что касается технологии фракционного фототермолиза, то в литературе опубликован лишь один пример «несамостоятельного» использования такого лазера, а именно в сочетании с охлаждением (Fisher et al., 2005). Следует отметить, что такой подход диктуется скорее неизбежностью анальгезирования кожи и представляет собой неразрывную часть традиционного метода фракционного фототермолиза как такового, при котором, кроме анальгезирующих средств, не используется никаких дополнительных биологически активных ингредиентов.

К недостаткам описываемых методов косметической коррекции можно отнести недостаточно полный охват молекулярных мишеней, вовлеченных в развитие и образование косметических дефектов; воздействие не на причину, а на последствия, что обычно приводит к временным видимым улучшениям и кратковременным результатам, а также осложнениям.

Постановка задачи

Изобретательской задачей является создание более универсального и эффективного способа лечения (устранения, коррекции) кожных дефектов и признаков старения кожи, с учетом молекулярных особенностей омоложения, охвата специфических молекулярных мишеней, вовлеченных в развитие косметических, в том числе возрастных дефектов кожи лица и тела.

Раскрытие изобретения.

Изобретательская задача решается тем, что предлагается сочетанное использование фракционного фототермолиза (Fraxel®, Reliant Technologies) с биологически активными ингредиентами. Биологически активные ингредиенты могут применяться как аппликативно, так и внутрь (перорально, парентерально).

В зависимости от целевого использования биологически активные ингредиенты могут быть представлены следующими вариантами, не ограничивающими объема изобретения.

В качестве отбеливающих средств могут быть использованы экстракт корня шелковицы белой, арбутин, бензойная кислота, глабридин, экстракт дудника (ангелика), земляника лесная, кинетин, койевая кислота, масло лиметта, ниацинамид, экстракт эклонии, экстракт олив, экстракт лимона, бензойная кислота, кислота лимонная, иные ингредиенты с отбеливающими свойствами природного и химического происхождения, разрешенные к применению с косметическими и терапевтическими целями, а также с целью восполнения дефицита нутриентов.

В качестве средств, регулирующих синтез коллагена, могут быть использованы экстракт нони, экстракт центеллы азиатской, коллаген, коллагенстимулирующие пептиды, коллагеназа гидробионтов, иные ингредиенты природного и химического происхождения, разрешенные к применению с косметическими и терапевтическими целями, а также с целью восполнения дефицита нутриентов.

В качестве антиоксидантных средств могут быть использованы кверцетин, коэнзим Q10 (убихинон), экстракт ягоды кофе, экстракт зеленого чая, экстракт гинкго билобы, аскорбил-пальмитат, экстракт календулы, кофейное масло, витамин Е (альфа-токоферол), L-карнозин, иные ингредиенты с антиоксидантными свойствами природного и химического происхождения, разрешенные к применению с косметическими и терапевтическими целями, а также с целью восполнения дефицита нутриентов.

В качестве увлажняющих средств могут быть использованы экстракты растений и фруктов, в том числе экстракт хлопка, экстракт бамбука, экстракт овса, экстракт алоэ, экстракт кактуса, экстракт боярышника, экстракт лотоса, экстракт апельсина, экстракт зеленого яблока, экстракт ванили, экстракт дыни, экстракт эхинацеи; экстракт дрожжей; экстракт морских водорослей, в том числе ламинарии; пчелиный воск, гидролизованный коллаген, омега-3, -6, (полиненасыщенные) жирные кислоты, в том числе масло косточек винограда; норковое масло, масло персика, лавандовое масло, вазелиновое масло, масло ши, масло жожоба, ланолин, гидролизованные растительные протеины, в том числе рисовый белок, белок пшеницы, белок сои; нуклеиновые кислоты молок и икры осетровых и морских рыб, термальная вода, гликолевая кислота, сафлор, натуральный увлажняющий фактор, в том числе креатинин; аминокислоты, в том числе лецитин, серин; хитозан, сорбит (сорбитол), аллантоин, силиконы, мочевина, витамин В5, витамин Е, гиалуроновая кислота, глицерин, керамиды, молочная сыворотка, молочная кислота и ее соли, в том числе лактат натрия; мед, иные увлажняющие ингредиенты природного и химического происхождения, разрешенные к применению с косметическими и терапевтическими целями, а также с целью восполнения дефицита нутриентов.

В качестве средств, обладающих общим положительным и регенеративным действием, могут быть использованы аллантоин, кротеин гидролизированный шелковый, экстракт душицы, экстракт женьшеня, лецитин, витамин К, масло иланг-иланга, эсцин, масла бурачника, черной смородины, энотеры (ослинника), масла авокадо, ши, оливковое, семян шиповника, зародышей пшеницы, рисовых отрубей, экстракт ромашки аптечной, алоэ, масло лаврового дерева, масло кокосовых орехов, масло какао, экстракт окопника, сквален, витамины, иные ингредиенты природного и химического происхождения, разрешенные к применению с косметическими и терапевтическими целями, а также с целью восполнения дефицита нутриентов.

В качестве средств, обладающих рост-стимулирующей и биологической активностью на специфические клетки-мишени, могут быть использованы факторы роста фибробластов (представители белкового семейства FGF - fibroblast growth factor), эпидермальный фактор роста (EGF - epidermal growth factor), факторы роста эндотелия сосудов (VEGF - vascular endothelial growth factor), клеточный материал (фибробласты человека), иные ингредиенты с биологической активностью белкового или клеточного происхождения, разрешенные к применению с косметическими и терапевтическими целями.

Предлагаемые сочетания биологически активных ингредиентов с фракционным фототермолизом могут быть использованы во всех случаях, при которых традиционные методы коррекции косметических дефектов оказываются несостоятельными.

Доказательства соответствия изобретательскому уровню

Несмотря на то, что отдельные способы лечения кожных дефектов известны, их сочетание в качестве омолаживающего и элиминирующего кожные дефекты способа предложено впервые, для которого заявителем установлен синергизм целевого действия, не вытекающего из уровня техники.

Примеры осуществления изобретения

Изобретение иллюстрируется следующими примерами.

Пример 1. Определение уровня экспрессии коллагена 1 типа в коже мышей в сочетании с центеллой азиатской.

Обработанную кожу мышей подвергали аппликативному воздействию центеллы азиатской, как в качестве моновоздействия, так и в сочетании с фракционным фототермолизом.

Выделение тотальной РНК. Определение уровня экспрессии коллагена проводили методом ОТ-ПЦР. Для контроля выделяли тотальную РНК из образцов кожи мышей в обработанной области и из участка здоровой кожи. Образцы были заморожены и хранились до выделения РНК при -70°С. Выделение РНК проводилось при помощи набора RNAeasy (Promega, USA) no стандартному протоколу. Полученную РНК растворяли в 50 мкл H2O DEPC и определяли количество спектрофотометрически при 260 нм/320 нм.

Построение кДНК. Для построения ДНК использовались следующие реактвы: 100 тМ дитиотрейтола, 2 mM dNTP, 200 U обратной транскриптазы, специальный буфер. 20 U IRNAsine, 100 U RNAseH, фенол. 3М ацетат натрия рН 4,0, изопропиловый спирт, 70% этиловый спирт, гликоген, ТЕ буфер рН 7.0. Построение кДНК проводилось по стандартному протоколу с использованием AdT15 праймера. Т отжига обратной транскриптазы = 37°С (Sambrook et al., 2001). Полученную кДНК растворяли в 15 мкл ТЕ буфера.

Полимеразная цепная реакция. Полимеразную цепную реакцию (ПЦР) проводили с использованием ДНК-специфичных праймеров:

прямой 5'GCCCAACTGTGAGCAAGGAG 3',

обратный 5'CAATGTGGGCTGGAATCCG 3',

mActin-S 5'GACCTGACAGACTACCTCATG3',

mАсtin-А 5'САGТААСАGТССGССТАGААG3'.

ПЦР осуществляли на матрице геномной ДНК с использованием 10 пмоль праймеров в буфере, содержащем 50 mM трис-HCl (рН 9.2), 16 mM (NH4)2SO4, 1.75 mM MgCl 2, 0.2 mM раствор каждого дезоксинуклеозидтрифосфата, 0.5 ед. Taq-полимеразы, 2% формальдегида. 25-35 циклов амплификации состояли из преденатурации при 95°С в течение 3 мин, денатурации при 95°С в течение 40 сек, отжига праймеров при 58°С (актин), 62°С (ЭФР-Р), 60°С (ЭФР)в течение 40 сек и элонгации цепей при 72°С в течение 1 минуты.

Электрофорез ДНК в агарозном геле. Электрофорез ДНК проводили при напряжении 5-10 В/см в 0.8-2%-ном агарозном геле в буфере ТАЕ (состав: 40 mM трис-ацетат, 2 mM ЭДТА, рН 8.0). Перед нанесением на гель к препарату ДНК добавляли 6-кратный буфер, содержащий 0.25% ксиленцианола и 30% глицерина. После электрофореза гель окрашивали в присутствии 1 мкг/мл бромида этидия в течение 15 мин. ДНК визуализировали в УФ свете при длине волны 254 нм.

Гель заворачивали в целлофановую мембрану и фотографировали цифровой камерой Kodak DC120. Изображение обрабатывали в редакторе Photoshop и программе GelQuant.

Интерпретация результатов проводилась с учетом нормальных значений, показателей, отмеченных у здоровых мышей нами и другими авторами. Экспрессия выражалась в виде значений относительного уровня и была нормирована по гену «домашнего хозяйства» (т.н house-keeping gene) способ лечения (коррекции) косметических и возрастных дефектов   кожи при сочетанном применении технологии фракционного фототермолиза   с биологически активными ингредиентами вне зависимости от способа   введения, патент № 2370275 -актину. Относительный уровень экспрессии гена (способ лечения (коррекции) косметических и возрастных дефектов   кожи при сочетанном применении технологии фракционного фототермолиза   с биологически активными ингредиентами вне зависимости от способа   введения, патент № 2370275 -актина у доноров был принят за единицу.

Пример 2. Определение экспрессии стрессовых белков.

Материалом для исследования служили биоптаты кожи, взятые у мышей в области, подвергнутой фракционному фототермолизу кожи, а также из участка интактной кожи. Биопсия проводилась под местной анестезией (2% раствором новокаина). Фракционный фототермолиз поводился по стандартной методике.

Биоптаты фиксировали в 10% растворе забуференного формалина, подвергали стандартной гистологической проводке, заливали в парафин. Срезы толщиной 4-5 микрон получали из парафиновых блоков на микротоме, растягивали на стеклах с полилизиновом покрытием. Окрашивали гематоксилин-эозином.

Иммуноморфологическое исследование проводили по следующей методике: после депарафинации в ксилоле осуществляли процедуру антигенного демаскирования путем кипячения в цитратном буфере (рН 6,0) в СВЧ-печи тремя циклами по 5 минут с 1-минутными перерывами. После остывания при комнатной температуре стекла промывали в растворе ТРИС-буфера рН 5,54, на срезы наносили 0,3% раствор перекиси водорода на метаноле (1:1) для предотвращения эндогенной пероксидазной активности.

Затем проводили иммуногистохимическую реакцию с применением моноклональных антител фирмы «Stressgene» (USA). Мышиные анти- HSP-70-антитела использовали к употреблению в разведении 1:150. Срезы с нанесением сыворотки инкубировались в течение 60 минут при комнатной температуре. Для визуализации использовали систему Novokastra SuperABC-Kit universal («Novokastra» Laboratories Ltd., Великобритания). Во всех случаях проводили докрашивание ядер гематоксилином.

Полученные препараты изучали в световом микроскопе «Nikon eklipse Е600»; документировали, фотографируя цифровой камерой Nikon D100. Определение количества HSP-70-позитивных клеток в эпидермисе проводили в расчете на 100 клеток базального слоя. Уровень экспрессии белков теплового шока HSP70 визуально детектировался (Фиг.2). Показано, что экспрессия HSP70 в интактной коже была значительно ниже (Фиг.2А), чем в коже, подвергнутой фракционному фототермолизу (Фиг.2 В). Этот механизм объясняет существенную разницу в стресс-индуцированном омоложении при использовании фракционного фототермолиза на коже пациентов до и после фототермолиза и согласуется с многочисленными литературными данными, объясняющими физиологическую роль белков теплового шока при слабых видах стресса. Проведенный эксперимент подтверждает прямое вовлечение антиапоптотических белков теплового шока (в данном случае, HSP-70) в постстрессовый метаболизм, выражающийся в проявлении признаков омоложения кожи под действием фракционного фототермолиза. Данный молекулярный механизм является биологической основой активации внутриклеточного (фибробластического) метаболизма, позволяющий добиться фоновой стимуляции обновления кожи, без учета специфики воздействия на проблемные участки. А в сочетании с биологическим активными ингредиентами наблюдается усиление эффекта за счет добавления специфического (целевого) воздействия.

Пример 3. Оценка постстресовой провоспалительной реакции при применении фракционного фототермолиза на фоне биологически активных ингредиентов (биологически активных добавок)

Для оценки сочетанного применения фракционного фототермолиза и биологически активных добавок проводилось исследование на контингенте добровольцев. К участию были приглашены пациенты - женщины в возрасте 45-50 лет, не имеющие никаких, кроме возрастного увядания, косметических дефектов кожи; не страдающие хроническими заболеваниями. Целью пациенток было улучшение внешнего вида кожи, омоложение, повышение тургора эластичности. Обрабатываемая поверхность состояла из кожи лица, области шеи и декольте.

К участию в исследовании пациенты допускались в соответствии с «Правилами проведения качественных клинических испытаний в Российской Федерации, стандарт отрасли ОСТ 42-511-99). Все пациенты были информированы о целях и последствиях процедуры, от всех испытуемых было получено документально оформленное добровольное согласие на участие в испытании.

К участию в исследовании было приглашено 40 человек, которые были разбиты на 4 группы, каждая по 10 человек. Группы формировались следующим образом: группа 1 - участие в процедуре фракционного фототермолиза (ФФ) на фоне приема препарата «Кофеберри» (КБ). Это биологически активная добавка (номер регистрационного свидетельства -77.99.23.3.У. 10842.10.06 от 13.10.2006), содержащая высокоэффективные антиоксидантные ингредиенты. Условное обозначение 1 группы - (+КБ+ФФ). Группа 2 принимала участие в процедуре фототермолиза без приема «Кофеберри» (-КБ+ФФ); группа 3 - прием «Кофеберри» без участия в процедуре фототермолиза (+КБ-ФФ), и контрольная, - без участия в процедуре фототермолиза и без приема препарата (-КБ-ФФ). За 3 дня до проведения процедуры, а также в день проведения процедуры фракционного фототермолиза первая группа получала препарат в дозировке «1 капсула 2 раза в день». После проведения фракционного фототермолиза в соответствии эффектами от постлазерного воздействия у всех пациентов в первых двух группах развился местный отек. Однако у пациентов первой группы он был кратковременным (несколько часов), не сопровождался болевыми или другими неприятными ощущениями, пациентки не отмечали каких-либо проявлений дискомфорта. Наблюдалось явное укорочение фаз воспалительного ответа. Пациентки второй (контрольной) группы отмечали небольшой дискомфорт от постлазерного воздействия, отек держался от суток до полутора, некоторым из них потребовалась симптоматическая терапия (анальгетики, НПВС). На вторые сутки во второй группе у всех испытуемых произошло полное восстановление исходного общего самочувствия. Результаты изменений на коже после лазерного воздействия в обеих группах, по оценкам испытуемых, были хорошими или очень хорошими. Отек и воспалительная реакция полностью нивелировались.

Критерием различий постстрессовой реакции являлся уровень провоспалительных цитокинов - фактора некроза опухоли-альфа и интерлейкина-1 (TNF-a, ILI-b) в сыворотке крови пациентов к концу 1-х суток после лазерного воздействия. Уровень цитокинов измерялся методом ELISA в соответствии со стандартным протоколом с помощью реагентов ProConTNFa и ProConIL-1b (ООО "Протеиновый контур", Россия). В качестве контроля использовалась сыворотка крови испытуемых из 4-й группы.

Статистический анализ проводился пакетом прикладных программ «Statistica». Поскольку полученные нами данные не подчиняются нормальному распределению и объем выборок достаточно мал, в качестве критерия оценки различий был выбран непараметрический ранговый критерий Вилкоксона для связанных пар переменных. В качестве сравниваемых переменных в каждой группе были взяты: уровни TNF-a и IL-1b на фоне приема «Кофеберри» и фототермолиза (+КБ+ФФ), на фоне фототермолиза без приема «Кофеберри» (-КБ+ФФ), на фоне приема «Кофеберри» без фототермолиза (+КБ-ФФ), и контрольная (-КБ-ФФ), общее число переменных - восемь. Получены статистически значимые отличия по уровню исследуемых цитокинов во всех исследуемыми группах по сравнению с контролем (уровень значимости р<0.05) (Фигура 3). Исключения составили переменные «-КБ+ФФ» для TNF-a и IL-1b (р=0.16), "-КБ+ФФ" и "-КБ-ФФ" для уровня TNF-a (р=0.068), и те же переменные для IL-b (p=0.57). Отсутствие статистически значимых различий между этими парами переменных еще раз доказывает эффект «совместного участия» обоих провоспалительных цитокинов в развитии воспалительной постстрессовой реакции. Кроме того, отсутствие различий по уровню провоспалительных цитокинов в группах, которые не подвергались фракционному фототермолизу, объясняется их банальным отсутствием, что подтверждается низким средним уровнем цитокинов в этих группах (52 пкг/мл для TNF-a и 32 пкг/мл для IL-1b).

Пример 4. Оценка эффективности фракционного фототермолиза в сочетании с биологически активными ингредиентами

Данный пример наглядно иллюстрирует возможности фракционного фототермолиза в сочетании с биологически активными ингредиентами на добровольцах (Фигура 4). Фототермолиз проводился по стандартной методике, в качестве дополнительного ингредиента использовалась коллагеназа камчатского краба.

Краткое описание чертежей.

Фиг.1. Разница в экспрессии коллагена 1 типа в коже мышей под влиянием центеллы азиатской и в сочетании с фракционным фототермолизом (Уровень экспрессии гена способ лечения (коррекции) косметических и возрастных дефектов   кожи при сочетанном применении технологии фракционного фототермолиза   с биологически активными ингредиентами вне зависимости от способа   введения, патент № 2370275 -актина не показан).

Фиг.2. Иммуногистохимическое окрашивание на HSP-70 под действием фракционного фототермолиза. А - интактная кожа, В - после фракционного фототермолиза. Увеличенная экспрессия HSP-70 показана стрелками.

Фиг.3. Исследование уровней провоспалительных цитокинов TNF-a и IL-1b в группах испытуемых. Условные обозначения: прием «Кофеберри» и участие в процедуре фототермолиза (Группа 1, +КБ+ФФ); участие в процедуре фототермолиза без приема «Кофеберри» (Группа 2, -КБ+ФФ); на фоне приема «Кофеберри» без фототермолиза (Группа 3, +КБ-ФФ); и контрольная (Группа 4, -КБ-ФФ). Р - уровень значимости, при котором нулевая гипотеза отвергается (<0.05).

Фиг.4. Результаты использования фракционного фототермолиза в сочетании с коллагеназой камчатского краба. Фиг.4А, 4Е, - внешний вид рубцов до процедур, Фиг.4 В и 4F - после; Фиг.4С и 4D - элиминация кожного дефекта после акне (до и после, соответственно).

Литература

1. Behroozan D.S., Goldberg L.H., Dai T., Geronemus R.G., Friedman P.M. Fractional photothermolysis for the treatment of surgical scars: a case report. J. Cosmet. Laser. Ther. 2006, Apr.; 8(1): 35-8.

2. Behroozan D.S., Goldberg L.H., Glaich A.S., Dai T., Friedman P.M. Fractional photothermolysis for treatment of poikiloderma of civatte. Dermatol Surg. 2006 Feb.; 32(2): 298-301.

3. Fisher G.H., Geronemus R.G. Short-term side effects of fractional photothermolysis. Dermatol. Surg. 2005 Sep.; 31(9 Pt 2): 1245-9; discussion 1249.

4. Fisher G.H., Kirn K.H., Bernstein L.J., Geronemus R.G. Concurrent use of a handheld forced cold air device minimizes patient discomfort during fractional photothermolysis. Dermatol. Surg. 2005, Sep.; 31(9 Pt 2): 1242-3; discussion 1244.

5. Geronemus R.G. Fractional photothermolysis: current and future applications. Lasers Surg. Med. 2006 Mar.; 38(3): 169-76.

6. Hantash B.M., Bedi V.P., Sudireddy V., Struck S.K. Herron G.S., Chan K.F. Laser-induced transepidermal elimination of dermal content by fractional photothermolysis. J. Biomed. Opt. 2006, Jul.-Aug.; 11(4): 041115.

7. Hasegawa T., Matsukura T., Mizuno Y., Suga Y., Ogawa H., Ikeda S. Clinical trial of a laser device called fractional photothermolysis system for acne scars. J. Dermatol. 2006, Sep.; 33(9): 623-7.

8. Huzaira M., Anderson R.R., Sink K., Manstein D. Intradermal focusing of nearinfrared optical pulses: a new approach for nonablative laser therapy. Lasers Surg. Med. 2003: 15: (Suppl.):66.

9. Laubach H.J., Tannous Z. Anderson R.R., Manstein D. Skin responses to fractional photothermolysis. Lasers Surg. Med. 2006, Feb.; 38(2): 142-9.

10. Manstein D., Herron G.S., Sink R.K., Tanner H., Anderson R.R. Fractional photothermolysis: a new concept for cutaneous remodeling using microscopic patterns of thermal injury. Lasers Surg. Med. 2004; 34(5): 426-38.

11. Rattan S.I. Hermetic mechanisms of anti-aging and rejuvenating effects of repeated mild heat stress on human fibrobtasts in vitro. Rejuvenation Res. 2004a Spring; 7(1): 40-8.8:

12. Rattan S.I. Mechanisms of hormesis through mild heat stress on human cells. Ann N. Y.Acad. Sci. 2004b Jun.; 1019:554-8.

13. Rokhsar C.K., Fitzpatrick R.E. The treatment of melasma with fractional photothermolysis: a pilot study. Dermatol. Surg. 2005, Dec.; 31 (12): 1645-50.

14. Rostan E.F. Laser treatment of photodamaged skin. Facial Plast Surg. 2005, May; 21(2): 99-109.

15. Sambrook, Russel "Molecular Cloning: A Laboratory Manual (Third Edition)", Cold Spring Harbor Press, 2001.

16. Wanner M., Tanzi E.L., Alster T.S. Fractional photothermolysis: treatment of facial and nonfacial cutaneous photodamage with a 1,550-nm erbium-doped fiber laser. Dermatol. Surg. 2007 Jan.; 33(1): 23-8.

Скачать патент РФ Официальная публикация
патента РФ № 2370275

patent-2370275.pdf

Класс A61K36/74 Rubiaceae (семейство мареновых)

вагинальные суппозитории (варианты) -  патент 2514630 (27.04.2014)
способ получения средства, обладающего нефропротекторной активностью -  патент 2505309 (27.01.2014)
лекарственный сбор растений для лечения сердечно-сосудистых заболеваний -  патент 2484843 (20.06.2013)
экстракт из растительного сырья с высоким содержанием полифенола -  патент 2466736 (20.11.2012)
травяной состав для заживления ран -  патент 2451518 (27.05.2012)
фитосредство для лечения и профилактики мочекаменной болезни -  патент 2445970 (27.03.2012)
способ лечения синдрома хронической усталости (варианты) -  патент 2406525 (20.12.2010)
экстракт коры дерева рода corynanthe и его применение, лекарственные средства, пищевые продукты и фармацевтические композиции, его содержащие -  патент 2399378 (20.09.2010)
лечебно-профилактическая композиция -  патент 2393871 (10.07.2010)
способ разгрузочно-диетической терапии -  патент 2392943 (27.06.2010)

Класс A61N5/067 с использованием лазерного луча

лазерное терапевтическое устройство -  патент 2528659 (20.09.2014)
волоконно-оптический инструмент с изогнутой дистальной рабочей частью -  патент 2528655 (20.09.2014)
способ лечения туберкулезного спастического микроцистиса -  патент 2527905 (10.09.2014)
устройство для воздействия инфракрасным излучением на коллагеновый слой кожи человека с визуализацией процесса -  патент 2527318 (27.08.2014)
способ лечения инфицированных ран и свищей у онкологических больных -  патент 2527175 (27.08.2014)
способ лечения пациентов с заболеваниями пульпы зуба и периодонта -  патент 2526961 (27.08.2014)
способ лечения деструктивных форм хронических верхушечных периодонтитов -  патент 2525702 (20.08.2014)
способ комплексной терапии впервые выявленного туберкулеза легких -  патент 2525580 (20.08.2014)
способ восстановления функций кишечной трубки при синдроме короткой кишки -  патент 2525530 (20.08.2014)
способ лечения кожных заболеваний и лазерное терапевтическое устройство для его осуществления -  патент 2525277 (10.08.2014)

Класс A61P17/00 Лекарственные средства для лечения дерматологических заболеваний

Наверх