ПАТЕНТНЫЙ ПОИСК В РФ
НОВЫЕ ПАТЕНТЫ, ЗАЯВКИ НА ПАТЕНТ
БИБЛИОТЕКА ПАТЕНТОВ НА ИЗОБРЕТЕНИЯ

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина

Классы МПК:A61K31/55  содержащие семичленные кольца, например азеластин, пентиленететразол
C07D255/04 конденсированные с карбоциклическими кольцами или циклическими системами
A61P1/00 Лекарственные средства для лечения расстройства пищеварительного тракта или пищеварительной системы
Автор(ы):, , , , , , , , , , ,
Патентообладатель(и):ДЖЕЙМС БЛЭК ФАУНДЕЙШН ЛИМИТЕД (GB)
Приоритеты:
подача заявки:
2002-11-12
публикация патента:

Изобретение относится к области медицины, органической химии и фармакологи и касается применения соединения формулы (I) для получения лекарственного средства для лечения нарушений, связанных с гастрином, способа лечения указанных нарушений, фармацевтической композиции для лечения указанных нарушений, содержащей ингибитор протонного насоса и соединение формулы (I), способа ее получения, набора, содержащего соединение формулы (I) и ингибитор протонного насоса, а также новых соединений формул (IIa) и (IIb). Изобретение обеспечивает повышенную эффективность лечения. 16 н. и 34 з.п. ф-лы, 3 табл.

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

Данное изобретение относится к лигандам рецепторов гастрина и холецистокинина (CKK). (Рецептор, ранее известный как рецептор ССКВ/гастрина, в настоящее время называют рецептор ССК2). Кроме того, изобретение относится к способам получения указанных выше лигандов и соединениям, которые полезны в качестве промежуточных продуктов в таких способах. Далее изобретение относится к фармацевтическим композициям, содержащим указанные лиганды, и способам получения таких фармацевтических композиций.

Гастрин и холецистокинины являются структурно родственными нейропептидами, которые существуют в ткани желудочно-кишечного тракта и (тканях) центральной нервной системы (Mutt, V., Gastrointestinal Hormones, Glass G.B.J., ed., Raven Press, New York, p. 169, Nisson G., ibid., p. 127).

Гастрин является одним из трех основных стимуляторов секреции желудком кислоты (HCl). Обнаружено несколько форм гастрина, включая разновидности из 34-, 17- и 14-аминокислот, при этом минимальным активным фрагментом является С-концевой тетрапептид (TrpMetAspPhe-NH2), который, как следует из литературы, имеет полную фармакологическую активность (Tracy H.J. and Gregory R.A., Nature (London), 1964, 204, 935). Много усилий было затрачено на синтез аналогов указанного выше тетрапептида (и N-защищенного производного Boc-TrpMetAspPhe-NH 2) при попытке установления взаимосвязи между структурой и активностью.

Природный холецистокинин представляет пептид из 33 аминокислот (СКК-33), 5 аминокислот С-концевого фрагмента которого идентичны таковым гастрина. Также был обнаружен в природе С-концевой октапептид (ССК-8) холецистокинина ССК-33.

Холецистокинины, как сообщают, являются важными для регуляции аппетита. Они стимулируют подвижность кишечника, сокращение желчного пузыря, секрецию панкреатических ферментов и, как известно, оказывают трофическое действие на поджелудочную железу. Кроме того, они ингибируют опорожнение желудка и выполняют различные функции в центральной нервной системе.

Соединения, которые связываются с рецепторами холецистокинина и/или гастрина, являются важными вследствие их потенциального фармацевтического использования в качестве антагонистов, инверсных агонистов или частичных агонистов природных пептидов. Такие соединения описаны в данном описании как лиганды. Используемый термин лиганд означает либо антагонист, частичный или полный агонист, либо инверсный агонист. Обычно термин лиганд относится к антагонисту.

Ряд лигандов гастрина был предложен для различных терапевтических применений, включая профилактику расстройств, связанных с гастрином, включая язвы желудочно-кишечного тракта, диспепсию, рефлюкс-эзофагиты (гастроэзофагеальная рефлюксная болезнь (GERD), как эрозивная, так и неэрозивная), путем уменьшения секреции желудком кислоты и/или усиления ослабленной моторной (двигательной) активности в сфинктере нижнего отдела пищевода, синдром Золлингера-Эллисона, синдром Беррета (хроническая пептическая язва нижней части пищевода [специализированная кишечная метаплазия дистальной части пищевода]), гиперплазия клеток ECL, рикошетная гиперсекреция (после прекращения противосекреторной терапии), полипы желудка, происходящие от ECL, чаще всего обнаруживаемые у пациентов с атрофическим гастритом как с (пернициозная анемия) или без дефицита витамина В 12; гиперплазия G клеток, локализованных в слизистой антральной части желудка, и другие состояния, при которых желательно более низкая активность гастрина или более низкая секреция кислоты. Кроме того, как было показано, гормон имеет трофическое действие на клетки, и поэтому можно ожидать, что антагонист будет полезным при лечения рака, в частности, в желудочно-кишечном тракте, особенно в желудке, пищеводе и колоректальных областях. Кроме того, можно лечить опухоли, обнаруженные в других органах, таких как поджелудочная железа, легкое (мелкоклеточные карциномы легкого) и щитовидная железа (медуллярные опухоли щитовидной железы).

Другие возможные применения лежат в потенцировании анальгезии, вызываемой опиатами (например, морфином). Кроме того, как было заявлено, лиганды для рецепторов холецистокинина в головном мозге (так называемых рецепторов ССК2) обладают анксиолитической (трансквилизирующей) активностью.

Известным антагонистом рецептора ССК2 является L-365,260 (M.G. Bock et al., J. Med Chem., 1989, 32, 13-16), который основан на структуре бензодиазепина. При испытании на крысином желудке, представленном ниже, было показано, что L-365,260 имеет аффинность к рецептору CCK2 pK В=7,61±0,12 (S.B. Kalindjian et al., J. Med. Chem., 1994, 37, 3671-3).

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

Совсем недавно другой бензодиазепин, YF476, был разработан в качестве сильнодействующего антагониста ССК 2 (A. Nishida et al., Journal of Pharmacology and Experimental Therapeutics, 1994, 269, 725-731). В крысиных кортикальных мембранах YF476, как было установлено, имеет аффинность к рецептору CCK2 pKi=10,17±0,03.

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

L-365,260 и YF476 по своей структуре близки. Оба соединения являются 1,4-бензодиазепинами. Углерод в положении три указанных 1,4-бензодиазепинов представляет хиральный центр. В обоих случаях оптические соединения имеют R-конфигурацию в этом центре. В самом деле, все 1,4-бензодиазепины, которые оказались полезными в качестве антагонистов гастрина, имеют хиральный центр на кольце диазепина, и было установлено, что более выраженный антагонизм к рецептору гастрина проявляется одной конфигурацией по сравнению с другой.

Потребность в одном энантиомере из известных 1,4-бензодиазепиновых лигандов рецептора гастрина не является желательной. Синтез отдельных энантиомеров из ахиральных предшественников, как и в указанных случаях, является дорогостоящим и относительно сложным технологическим процессом. Этот процесс обычно требует, например, либо стадии разделения, обычно неэффективной, поскольку один энантиомер отбрасывают, либо использования во время синтеза зачастую дорогостоящего хирального вспомогательного вещества, в сочетании с увеличением (числа) химических стадий. По указанным выше причинам кандидат лекарственного средства без стереоцентров на семичленном кольце обеспечил бы явное преимущество над хиральными альтернативами.

Патент США 5091381 описывает бензотриазепины, которые, как сообщается, связываются с периферическими бензодиазепиновыми рецепторами.

EP-A-0645378 описывает класс бициклических соединений, которые, как считают, ингибируют сквален-синтетазу.

Цель настоящего изобретения заключается в обеспечении сильнодействующих и селективных лигандов рецепторов гастрина и ССК. Другая цель настоящего изобретения заключается в обеспечении лигандов рецепторов гастрина и ССК, которые не имеют хирального центра на 7-членном кольце и которые поэтому можно получить, используя прямые синтетические способы.

Согласно настоящему изобретению обеспечивается применение соединений формулы (I)

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

где W представляет N или N+-;

R1 и R 5 представляют, независимо, H, C1 -C6алкил,

1 -C6алкил)окси, тио, (С1 -C6алкил)тио, карбокси,

карбокси(С 1-C6алкил), формил, (C 1-C6алкил)карбонил,

(C 16алкил)оксикарбонил, (С 1-C6алкил)карбонилокси, нитро,

тригалогенметил, гидрокси, гидрокси(C16алкил), амино,

(C 1-C6алкил)амино, ди(C 1-C6алкил)амино, аминокарбонил, галоген,

галоген(C1-C6алкил), аминосульфонил, (C1-C6 алкил)сульфониламино,

(C1-C 6алкил)аминокарбонил, ди(C1-C 6алкил)аминокарбонил,

[N-Z](C 16алкил)карбониламино, формилокси, формамидо,

(C16 алкил)аминосульфонил, ди(C1-C 6алкил)аминосульфонил,

[N-Z](C 1-C6алкил)сульфониламино или циано или R1 и R5 вместе образуют метилендиоксигруппу;

R2 представляет H или необязательно замещенную С 118углеводородную группу, где вплоть до трех атомов С могут быть необязательно заменены атомами N, O и/или S;

R3 представляет -(CR 11R12)m-X-(CR 13R14)p-R 9;

m равно 0, 1, 2, 3 или 4;

p равно 0, 1 или 2;

X представляет связь, -CR15=CR 16-, -Cбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C-, C(O)NH, NHC(O), C(O)NMe, NMeC(O), C(O)O, NHC(О)NH, NHC(О)О, OC(O)NH, NH, O, CO, SO2, SO 2NH, C(O)NHNH,

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

R9 представляет H, C 1-C6алкил или фенил, нафтил, пиридил, бензимидазолил, индазолил, хинолинил, изохинолинил, тетрагидроизохинолинил, индолинил, изоиндолинил, индолил, изоиндолил или 2-пиридонил, все необязательно замещенные 1, 2 или 3 группами, независимо выбранными из -L-Q,

где L представляет связь, или группу формулы

-(CR17R18 )v-Y-(CR17R 18)w, где v и w равны, независимо, 0, 1, 2 или 3 и Y представляет связь, -CR 15=CR16-, фенил, фуранил, тиофенил, пирролил, тиазолил, имидазолил, оксазолил, изоксазолил, пиразолил, изоксазолонил, пиперазинил, пиперидинил, морфолинил, пирролидинил, изотиазолил, триазолил, оксадиазолил, тиадиазолил, пиридил или пиридазил и

Q представляет H, (C1 -C6алкил)окси, [N-Z](C 1-C6алкил)окси(C1 -C6алкил)амино, тио, (C 16алкил)тио, карбокси(C 1-C6алкил)тио, карбокси, карбокси(C 1-C6алкил), карбокси(C 1-C6алкенил), [N-Z]карбокси(C 16алкил)амино, карбокси(C 1-C6алкил)окси, формил, (C 1-C6алкил)карбонил, (C 1-C6алкил)оксикарбонил, (С 1-C6алкил)карбонилокси, нитро, тригалогенметил, гидрокси, амино, [N-Z](C1-C 6алкил)амино, аминокарбонил, (C1-C 6алкил)аминокарбонил, ди(C1-C 6алкил)аминокарбонил, [N-Z](C1 -C6алкил)карбониламино, С 5-C8циклоалкил, [N-Z](C 1-C6алкил)карбонил(C 1-C6алкил)амино, галоген, галоген(C 1-C6алкил), сульфамоил, [N- Z](C1-C6алкил)сульфониламино, (C1-C6алкил)сульфониламинокарбонил, карбокси(C1-C6алкил)сульфонил, карбокси(C1-C6алкил)сульфинил, тетразолил, [N-Z]тетразолиламино, циано, амидино, амидинотио, SO3H, формилокси, формамидо, С 3-C8циклоалкил, (C 1-C6алкил)сульфамоил, ди(C 1-C6алкил)сульфамоил, (C 1-C6алкил)карбониламиносульфонил, 5-оксо-2,5-дигидро[1,2,4]оксадиазолил, карбокси(C 1-C6алкил)карбониламино, тетразолил(C 1-C6алкил)тио, [N-Z]тетразолил(C 1-C6алкил)амино, 5-оксо-2,5-дигидро[1,2,4]тиадиазолил, 5-оксо-1,2-дигидро[1,2,4]триазолил, [N-Z](C1- C6алкил)амино(C1- C6алкил)амино или группу формулы

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

где P представляет O, S или NR 19;

Z представляет H, C1 6алкил, трет-бутоксикарбонил, ацетил, бензоил или бензил;

R4 представляет необязательно замещенную С118 углеводородную группу, где вплоть до трех атомов С могут быть необязательно заменены атомами N, O и/или S;

R 11, R12, R13 , R14, R15, R 17, R18 и R19 представляют независимо H или C1 3алкил и

R16 представляет H, C13алкил или ацетиламино,

или их фармацевтически приемлемой соли

для получения лекарственного средства для лечения нарушений, связанных с гастрином.

Предпочтительно W представляет N.

Типичными нарушениями, связанными с гастрином, являются язвы желудочно-кишечного тракта, диспепсия, рефлюкс-эзофагит (гастроэзофагеальная рефлюксная болезнь (GERD), как эрозивная, так и неэрозивная), синдром Золлингера-Эллисона, синдром Беррета (хроническая пептическая язва нижней части пищевода [специализированная кишечная метаплазия дистальной части пищевода]), гиперплазия клеток ECL, рикошетная гиперсекреция (после прекращения противосекреторной терапии), полипы желудка, происходящие от ECL, рак желудочно-кишечного тракта, в частности желудка, пищевода и колоректальных областей, а также опухоли, обнаруженные в других органах, таких как поджелудочная железа, легкое (мелкоклеточные карциномы легкого) и щитовидная железа (медуллярные опухоли щитовидной железы), и тревога (страх).

Потенцирование анальгезии, индуцированной опиатами, может также предусматривать роль лигандов гастрина настоящего изобретения.

Кроме того, настоящее изобретение предлагает соединения формулы (IIa)

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

где W представляет N или N+-;

R1 и R 5 представляют, независимо, H, C1 -C6алкил,

(C1 -C6алкил)окси, тио, (C1 -C6алкил)тио, карбокси,

карбокси(C 1-C6алкил), формил, (C 1-C6алкил)карбонил,

(C 1-C6алкил)оксикарбонил, (C 1-C6алкил)карбонилокси, нитро,

тригалогенметил, гидрокси, гидрокси(С1 -C6алкил), амино,

(C 1-C6алкил)амино, ди(C 1-C6алкил)амино, аминокарбонил, галоген,

галоген(C1-C6алкил), аминосульфонил, (C1-C6 алкил)сульфониламино,

(C1-C 6алкил)аминокарбонил, ди(С1-C 6алкил)аминокарбонил,

[N-Z](C 1-C6алкил)карбониламино, формилокси, формамидо,

1-C6 алкил)аминосульфонил, ди(C1 6алкил)аминосульфонил,

[N-Z](C 1-C6алкил)сульфониламино или циано или R1 и R5 вместе образуют метилендиоксигруппу;

R2 представляет -(CH2)s -C(О)-(CH2)t-R 8;

s равно 0, 1, 2 или 3;

t равно 0, 1, 2 или 3;

R8 выбран из H, OH, С112алкила, (С 112алкил)окси,

C 3-C12циклоалкила, фенила, нафтила, пиридила, пирролила, имидазолила, пиразолила, пиридазинила, пиримидинила, триазолила, фуранила, тиенила, фуразанила, оксазолила, изоксазолила, тиазолила, тиазинила, индолила, индолинила, изоиндолила, изоиндолинила, изохинолинила, хинолинила, бензофуранила, бензотиенила, пиперазинила, пиперидинила, пирролидинила, пирролинила, дигидропиранила, тетрагидропиранила, пиранила, тетрагидрофуранила, морфолинила, тиазолидинила, тиоморфолинила или тиоксанила (все необязательно замещенные 1, 2 или 3 группами, независимо выбранными из С1 6алкила,

1 6алкил)окси, тио, (С1 6алкил)тио, карбокси,

карбокси(С16алкила), формила, (С 16алкил)карбонила,

16алкил)оксикарбонила, (С 16алкил)карбонилокси, нитро,

тригалогенметила, гидрокси, гидрокси(С16алкила), амино,

16алкил)амино, ди(С 16алкил)амино, аминокарбонила, галогена,

галоген(С1 6алкила), аминосульфонила, (С1 6алкил)сульфониламино

или циано);

R 3 представляет -(CR11R 12)m-X-(CR13 R14)p-R 9;

m равно 0, 1, 2, 3 или 4 (предпочтительно 1 или 2);

p равно 0, 1 или 2;

X представляет связь, -CR15=CR16 -, -Cбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C-, C(O)NH, NHC(O), C(O)NMe, NMeC(O), C(O)O, NHC(О)NH, NHC(О)О, OC(O)NH, NH, O, CO, SO2, SO 2NH, C(O)NHNH,

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

R9 представляет H, С 16алкил или фенил, нафтил, пиридил, бензимидазолил, индазолил, хинолинил, изохинолинил, тетрагидроизохинолинил, индолинил, изоиндолинил, индолил, изоиндолил или 2-пиридонил, все необязательно замещенные 1, 2 или 3 группами, независимо выбранными из -L-Q,

где L представляет связь или группу формулы

-(CR17R18 )V-Y-(CR17R 18)W, где v и w равны, независимо, 0, 1, 2 или 3 и Y представляет связь, -CR 15=CR16-, фенил, фуранил, тиофенил, пирролил, тиазолил, имидазолил, оксазолил, изоксазолил, пиразолил, изоксазолонил, пиперазинил, пиперидинил, морфолинил, пирролидинил, изотиазолил, триазолил, оксадиазолил, тиадиазолил, пиридил или пиридазил и

Q представляет H, (С16алкил)окси,

[N-Z](С 16алкил)окси(С16алкил)амино, тио, (С 16алкил)тио,

карбокси(С 16алкил)тио, карбокси, карбокси(С 16алкил),

карбокси(С 16алкенил), [N-Z]карбокси(С 16алкил)амино,

карбокси(С 16алкил)окси, формил, (С 16алкил)карбонил,

16алкил)оксикарбонил, (С 16алкил)карбонилокси, нитро,

тригалогенметил, гидрокси, амино, [N-Z](С 16алкил)амино,

аминокарбонил, (С16алкил)аминокарбонил,

ди(С16алкил)аминокарбонил, [N-Z](С16 алкил)карбониламино,

С5-C 8циклоалкил, [N-Z](С1 6алкил)карбонил(С1 6алкил)амино,

галоген, галоген(С16алкил), сульфамоил,

[N- Z](С16алкил)сульфониламино,

16алкил)сульфониламинокарбонил,

карбокси(С16 алкил)сульфонил, карбокси(С1 6алкил)сульфинил,

тетразолил, [N-Z]тетразолиламино, циано, амидино, амидинотио,

SO3H, формилокси, формамидо, C3-C 8циклоалкил,

1 6алкил)сульфамоил, ди(С1 6алкил)сульфамоил,

1 6алкил)карбониламиносульфонил,

5-оксо-2,5-дигидро[1,2,4]оксадиазолил,

карбокси(С16 алкил)карбониламино, тетразолил(С1 6алкил)тио,

[N-Z]тетразолил(С 16алкил)амино,

5-оксо-2,5-дигидро[1,2,4]тиадиазолил,

5-оксо-1,2-дигидро[1,2,4]триазолил,

[N-Z](С 16алкил)амино(С 16алкил)амино или группу формулы

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

где P представляет O, S или NR 19;

Z представляет H, С1 6алкил, трет-бутоксикарбонил, ацетил, бензоил или бензил;

R4 представляет необязательно замещенный С118 углеводородную группу, где вплоть до трех атомов С могут быть заменены атомами N, O и/или S;

R11 , R12, R13, R 14, R15, R17 , R18 и R19 представляют, независимо, H или С13 алкил и

R16 представляет H, С 13алкил или ацетиламино,

или их фармацевтически приемлемую соль,

при условии, что R2 не является CH2 CO2H или C(O)CH3, когда R4 представляет фенил.

Кроме того, настоящее изобретение обеспечивает соединения формулы (IIb)

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

где W представляет N или N+ -O-;

R1 и R 5 представляют, независимо, H, С16алкил,

16алкил)окси, тио, (С16алкил)тио, карбокси,

карбокси(С 16алкил), формил, (С 16алкил)карбонил,

16алкил)оксикарбонил, (С 16алкил)карбонилокси, нитро,

тригалогенметил, гидрокси, гидрокси(С16алкил), амино,

16алкил)амино, ди(С 16алкил)амино, аминокарбонил, галоген,

галоген(С16алкил), аминосульфонил, (С16 алкил)сульфониламино,

1 6алкил)аминокарбонил, ди(С1 6алкил)аминокарбонил,

[N-Z](С 16алкил)карбониламино, формилокси, формамидо,

16 алкил)аминосульфонил, ди(С1 6алкил)аминосульфонил,

[N-Z](С 16алкил)сульфониламино или циано или R1 и R5 вместе образуют метилендиоксигруппу;

R2 представляет H или необязательно замещенную

С 118углеводородную группу, где вплоть до трех атомов С могут быть необязательно заменены атомами N, O и/или S;

R3 представляет -(CR 11R12)m-X-(CR 13R14)p-R 9;

m равно 0, 1, 2, 3 или 4 (предпочтительно 1 или 2);

p равно 0, 1 или 2;

X представляет связь, -CR15=CR16 -, -Cбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C-, C(O)NH, NHC(O), C(O)NMe, NMeC(O), C(O)O, NHC(O)NH, NHC(O)O, OC(O)NH, NH, O, CO, SO2, SO 2NH, C(O)NHNH,

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

R9 представляет H, С 16алкил или фенил, нафтил, пиридил, бензимидазолил, индазолил, хинолинил, изохинолинил, тетрагидроизохинолинил, индолинил, изоиндолинил, индолил, изоиндолил или 2-пиридонил, все необязательно замещенные 1, 2 или 3 группами, независимо выбранными из -L-Q,

где L представляет связь или группу формулы

-(CR17R18 )V-Y-(CR17R 18)W, где v и w равны, независимо, 0, 1, 2 или 3 и Y представляет связь, -CR 15=CR16-, фенил, фуранил, тиофенил, пирролил, тиазолил, имидазолил, оксазолил, изоксазолил, пиразолил, изоксазолонил, пиперазинил, пиперидинил, морфолинил, пирролидинил, изотиазолил, триазолил, оксадиазолил, тиадиазолил, пиридил или пиридазил и

Q представляет H, (С16алкил)окси,

[N-Z](С 16алкил)окси(С16алкил)амино, тио, (С 16алкил)тио,

карбокси(С 16алкил)тио, карбокси, карбокси(С 16алкил),

карбокси(С 16алкенил), [N-Z]карбокси(С 16алкил)амино,

карбокси(С 16алкил)окси, формил, (С 16алкил)карбонил,

16алкил)оксикарбонил, (С 16алкил)карбонилокси, нитро,

тригалогенметил, гидрокси, амино, [N-Z](С 16алкил)амино,

аминокарбонил, (С16алкил)аминокарбонил,

ди(С16алкил)аминокарбонил, [N-Z](С16 алкил)карбониламино,

С5 8циклоалкил, [N-Z](С16алкил)карбонил(С16алкил)амино,

галоген, галоген(С 16алкил), сульфамоил,

[ N-Z](С16 алкил)сульфониламино,

1 6алкил)сульфониламинокарбонил,

карбокси(С 16алкил)сульфонил, карбокси(С 16алкил)сульфинил,

тетразолил, [N-Z]тетразолиламино, циано, амидино, амидинотио,

SO3H, формилокси, формамидо, С 38циклоалкил,

16алкил)сульфамоил, ди(С 16алкил)сульфамоил,

16алкил)карбониламиносульфонил,

5-оксо-2,5-дигидро[1,2,4]оксадиазолил,

карбокси(С 16алкил)карбониламино, тетразолил(С 16алкил)тио,

[N-Z]тетразолил(С 16алкил)амино,

5-оксо-2,5-дигидро[1,2,4]тиадиазолил,

5-оксо-1,2-дигидро[1,2,4]триазолил,

[N-Z](С 16алкил)амино(С 16алкил)амино или группу формулы

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

где P представляет O, S или NR 19;

Z представляет H, С1 6алкил, трет-бутоксикарбонил, ацетил, бензоил или бензил;

R4 имеет формулу

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

где q равно 0, 1, 2 или 3;

T представляет связь, O, S, NH или N(С1 6алкил) и

R10 представляет С112алкил, С 312циклоалкил, фенил, нафтил, пиридил, пирролил, имидазолил, пиразолил, пиридазинил, пиримидинил, триазолил, фуранил, тиенил, фуразанил, оксазолил, изоксазолил, тиазолил, тиазинил, индолил, индолинил, изоиндолил, изоиндолинил, изохинолинил, хинолинил, бензофуранил, бензотиенил, пиперазинил, пиперидинил, пирролидинил, пирролинил, дигидропиранил, тетрагидропиранил, пиранил, тетрагидрофуранил, морфолинил, тиазолидинил, тиоморфолинил или тиоксанил (все необязательно замещенные 1, 2 или 3 группами, независимо выбранными из С1 6алкила, (С16 алкил)окси, С38 циклоалкила,

3 8циклоалкил)окси, тио, (С1 6алкил)тио, карбокси, карбокси(С16алкила), формила, (С 16алкил)карбонила,

16алкил)оксикарбонила, (С 16алкил)карбонилокси, нитро, тригалогенметила, гидрокси, гидрокси(С1 6алкила), амино,

1 6алкил)амино, ди(С1 6алкил)амино, аминокарбонила, галогена, галоген(С 16алкила), аминосульфонила, (С 16алкил)сульфониламино или циано);

R11, R12, R 13, R14, R15 , R17, R18 и R 19 представляют, независимо, H или С13алкил и

R16 представляет H, С13 алкил или ацетиламино,

или их фармацевтически приемлемую соль,

при условии, что R10 не является фенилом или замещенным фенилом, когда q равен 0 и T представляет связь.

Предпочтительно R1 и R 5 представляют, оба, H. Однако следует учесть, что бензо-конденсированная кольцевая система может иметь один или два заместителя на бензольном кольце, как указано здесь выше. Заместители могут оказывать едва различимые стерические и/или электронные воздействия, которые изменяют активность соединения в отношении рецептора гастрина. Однако присутствие или отсутствие определенных заместителей на бензольном кольце не является существенным для проявления общей фармакологической активности предлагаемых соединений.

Предпочтительно в соединении формулы (IIa) или (IIb) W представляет N.

Предпочтительно в соединении формулы (I) или (IIb) R 2 имеет формулу

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

где R6 и R 7 независимо выбраны из H, С1 6алкила или OH или R6 и R 7 вместе представляют =O группу;

n равно 0 или 1;

s равно 0, 1, 2 или 3;

t равно 0, 1, 2 или 3 и

R8 выбран из H, С 112алкила, (С112алкил)окси,

С 312циклоалкила, фенила, нафтила, пиридила, пирролила, имидазолила, пиразолила, пиридазинила, пиримидинила, триазолила, фуранила, тиенила, фуразанила, оксазолила, изоксазолила, тиазолила, тиазинила, индолила, индолинила, изоиндолила, изоиндолинила, изохинолинила, хинолинила, бензофуранила, бензотиенила, пиперазинила, пиперидинила, пирролидинила, пирролинила, дигидропиранила, тетрагидропиранила, пиранила, тетрагидрофуранила, морфолинила, тиазолидинила, тиоморфолинила или тиоксанила (все необязательно замещенные 1, 2 или 3 группами, независимо выбранными из С1 6алкила, (С16 алкил)окси,

тио, (С1 6алкил)тио, карбокси, карбокси(С16алкила), формила,

16алкил)карбонила, (С 16алкил)оксикарбонила,

16алкил)карбонилокси, нитро, тригалогенметила, гидрокси,

гидрокси(С1 6алкила), амино, (С1 6алкил)амино,

ди(С1 6алкил)амино, аминокарбонила, галогена,

галоген(С 16алкила), аминосульфонила, (С 16алкил)сульфониламино

или циано).

Предпочтительной группой соединений согласно настоящему изобретению является группа соединений, где R 2 имеет формулу

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

где R8 представляет разветвленную С312алкильную группу (такую как трет-бутил, втор-бутил, изопропил, изобутил или изовалерил) или R8 представляет С 312циклоалкильную (такую как циклопентил, циклогексил, циклогептил или адамантил), фенильную, пиридильную, пирролидинильную или пиперидинильную группу (все необязательно замещенные 1, 2 или 3 С1 6алкильными группами).

Предпочтительно R 11, R12, R13 , R14, R15, R 16, R17, R18 и R19 представляют, все, H.

Предпочтительной группой соединений в соответствии с настоящим изобретением является группа соединений, где R2 имеет формулу

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

где X представляет C(O)NH или NHC(O), более предпочтительно X представляет C(O)NH.

Предпочтительно R 9 представляет фенил, замещенный карбокси,

карбокси(С 16алкилом), тетразолилом,

тетразолил-N-(С1 6алкил)амино, карбокси(С1 6алкил)тио,

карбокси(С1 6алкил)сульфонилом, (С1 6алкил)амино или

5-оксо-2,5-дигидро[1,2,4]оксадиазолильной группой, или

R9 представляет [ N-[карбокси(С16 алкил)]индолинильную или

N-[карбокси(С 16алкил)]индолильную группу.

Когда R9 представляет замещенную фенильную группу, заместитель предпочтительно находится в положении 3 фенильной группы.

Предпочтительно в соединениях согласно формуле (I) или (IIa) R4 имеет формулу

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

где q равно 0, 1, 2 или 3;

T представляет связь, O, S, NH или N(С1 6алкил) и

R10 представляет С112алкил, С 312циклоалкил, фенил, нафтил, пиридил, пирролил, имидазолил, пиразолил, пиридазинил, пиримидинил, триазолил, фуранил, тиенил, фуразанил, оксазолил, изоксазолил, тиазолил, тиазинил, индолил, индолинил, изоиндолил, изоиндолинил, изохинолинил, хинолинил, бензофуранил, бензотиенил, пиперазинил, пиперидинил, пирролидинил, пирролинил, дигидропиранил, тетрагидропиранил, пиранил, тетрагидрофуранил, морфолинил, тиазолидинил, тиоморфолинил или тиоксанил (все необязательно замещенные 1, 2 или 3 группами, независимо выбранными из С1 6алкила, (С16 алкил)окси, С38 циклоалкила,

3-С 8циклоалкил)окси, тио, (С1 6алкил)тио, карбокси,

карбокси(С16алкила), формила, (С 16алкил)карбонила,

16алкил)оксикарбонила, (С 16алкил)карбонилокси, нитро,

тригалогенметила, гидрокси, гидрокси(С16алкила), амино,

16алкил)амино, ди(С 16алкил)амино, аминокарбонила, галогена,

галоген(С1 6алкила), аминосульфонила, (С1 6алкил)сульфониламино

или циано).

Более предпочтительно в соединениях согласно формуле (I) или (IIa) R 4 выбирают из С1 12алкила (такого как трет-бутил, втор-бутил, изопропил, изобутил или изовалерил), С3- С12циклоалкила (такого как циклопентил, циклогексил, циклогептил или адамантил), пиридила или фенила (все из которых могут быть необязательно замещены 1, 2 или 3 группами, выбранными из OMe, NMe2, CF 3, Me, F, Cl, Br или I).

Во всех соединениях настоящего изобретения, предпочтительно когда q равен 0 и T представляет связь. Более предпочтительно, когда R4 представляет C3-C12 циклоалкил, и более предпочтительно R4 представляет циклогексил.

Некоторые соединения изобретения существуют в различных региоизомерных, энантиомерных, таутомерных и диастереомерных формах. Следует иметь в виду, что изобретение охватывает различные региоизомеры, энантиомеры, таутомеры и диастереомеры отдельно друг от друга, а также в виде их смесей.

Соединения настоящего изобретения, где W представляет N, могут быть получены репрезентативным способом, представленным реакционной схемой 1.

Реакционная схема 1

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

Кетон (III) подвергают взаимодействию с NH 2NHR3' (где R 3' представляет либо R3, либо его подходящий предшественник) с получением гидразона (IV). Затем гидразон (IV) подвергают циклизации, используя бифункциональный карбонилсодержащий реагент, получая бензотриазепинон (V). Бифункциональные карбонилсодержащие реагенты хорошо известны специалисту в данной области и включают, например, карбонилдиимидазол (CDI), трифосген, фосген или бромциан. Алкилирование в обычных условиях с последующей модификацией R3' дает требуемый бензотриазепинон (VII).

Соединения, где W представляет N +-O-, можно получить обработкой соединения VII непосредственно или соответствующим образом защищенного производного соединения VI окисляющим агентом, таким как MCPBA. Такие производные соединения VI дают требуемый N-оксид после снятия защиты.

R3' группы, которые являются подходящими предшественниками R3, обычно зависят от конкретной природы R3. Например, когда R3 представляет -(CH2 )mC(O)NH-(CH2) p-R9, подходящей группой R 3' может быть -(CH2) mCO21 6алкил). В этом случае требуемые группы R 3 могут быть легко доступны через гидролиз сложного эфира с последующей реакцией сочетания с простым амидом. Для специалиста в данной области очевиден подбор многих других подходящих групп R3', легко превращаемых в R 3, в зависимости от природы последней.

Алкилирование может быть осуществлено путем, например, замещения алкилгалогенидом в присутствии основания. Способы алкилирования очевидны для квалифицированного специалиста в данной области.

Следовательно, настоящее изобретение также обеспечивает способ получения соединений настоящего изобретения, соответствующих формуле (I), формуле (IIa) или формуле (IIb).

Важное преимущество синтеза, описанного выше, состоит в том, что во время синтеза в кольцевой системе бензотриазепинона не генерируется никаких хиральных центров.

Кроме того, изобретение охватывает производные соединений ("пролекарства"), которые расщепляются in vivo, образуя разновидность формулы (IIa) или (IIb). Пролекарства обычно (но не всегда) имеют более низкую активность по отношению к рецептору-мишени, чем разновидность, в которую они превращаются в результате расщепления. Пролекарства, в частности, используют, когда требуемая разновидность имеет химические или физические свойства, которые делают ее введение трудным или неэффективным. Например, требуемая разновидность может быть лишь малорастворимой, она может плохо транспортироваться сквозь относящийся к слизистой оболочке эпителий или она может иметь нежелательно короткий полупериод существования в плазме. Дополнительные сведения о пролекарствах можно найти у Stella, V.J. et al., "Prodrugs", Drug Delivery Systems, 1985, pp.112-176, и Drugs, 1985, 29, pp.455-473.

Пролекарственные формы фармакологически активных соединений изобретения обычно представляют собой соединения согласно формуле (II), имеющие кислотную группу, которая этерифицирована или амидирована. К таким этерифицированным кислотным группам относятся также группы формы -COORa, где Ra представляет C1-C5 алкил, фенил, замещенный фенил, бензил, замещенный бензил или одну из нижеследующих групп:

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

Амидированные кислотные группы включают группы формулы -CONRbRc, где R b представляет Н, С1 5алкил, фенил, замещенный фенил, бензил или замещенный бензил, и Rc представляет -ОН или одну из групп, только что перечисленных для Rb .

Соединения формулы (IIa) или (IIb), имеющие аминогруппу, могут быть превращены в другие производные при взаимодействии с кетоном или альдегидом, таким как формальдегид, с получением основания Манниха. Оно может гидролизоваться в водном растворе по кинетике первого порядка.

Другим аспектом настоящего изобретения является фармацевтическая композиция, содержащая соединение формулы (IIa) или (IIb), по существу, описанное выше, вместе с фармацевтически приемлемым разбавителем или носителем.

Очередным аспектом настоящего изобретения является способ получения фармацевтической композиции, включающей соединение формулы (II), по существу, описанное выше, включающий смешивание указанного выше соединения с фармацевтически приемлемым разбавителем или носителем.

Фармацевтически приемлемые соли кислых или основных соединений изобретения можно, конечно, получить обычными способами, как, например, взаимодействием свободного основания или кислоты с, по крайней мере, стехиометрическим количеством желаемой солеобразующей кислоты или основания.

Фармацевтически приемлемые соли кислых соединений изобретения включают соли с неорганическими катионами, такими как натрий, калий, кальций, магний, цинк и аммоний, и соли с органическими основаниями. Подходящие органические основания включают N-метил-D-глюкамин, аргинин, бензатин, диоламин, оламин, прокаин и трометамин.

Фармацевтически приемлемые соли основных соединений изобретения включают соли, полученные из органических и неорганических кислот. Подходящие анионы включают ацетат, адипат, безилат, бромид, камзилат, хлорид, цитрат, эдисилат, эстолат, фумарат, глюцептат, глюконат, глюкуронат, гиппурат, гиклат, гидробромид, гидрохлорид, иодид, изэтионат, лактат, лактобионат, малеат, мезилат, метилбромид, метилсульфат, напзилат, нитрат, олеат, памоат, фосфат, полигалактуронат, стеарат, сукцинат, сульфат, сульфосалицилат, таннат, тартрат, терефталат, тозилат и триэтиодид.

Ожидается, что соединения изобретения могут быть введены оральным или парентеральным путями, включая внутривенное, внутримышечное, интраперитонеальное, подкожное, ректальное и местное введение, и путем ингаляции.

В случае орального введения, соединения изобретения обычно предлагаются в форме таблеток или капсул или в виде водного раствора или суспензии.

Таблетки для орального использования могут включать активный компонент, смешанный с фармацевтически приемлемыми эксципиентами, такими как инертные разбавители, дезинтегрирующие средства, связующие средства, лубриканты, подслащивающие вещества, ароматизаторы, красители и консерванты. Подходящие инертные разбавители включают карбонат натрия и кальция, фосфат натрия и кальция и лактозу. Кукурузный крахмал и альгиновая кислота являются подходящими дезинтегрирующими средствами. Связующие средства могут включать крахмал и желатин. Лубрикант, если присутствует, обычно представляет стеарат магния, стеариновую кислоту или тальк. Если требуется, таблетки могут быть покрыты веществом, таким как глицерилмоностеарат или глицерилдистеарат, чтобы замедлить абсорбцию (всасывание) в желудочно-кишечном тракте.

Капсулы для орального использования включают твердые желатиновые капсулы, в которых активный компонент смешан с твердым разбавителем, и мягкие желатиновые капсулы, где активный компонент смешан с водой или маслом, таким как арахисовое масло, жидкий парафин или оливковое масло.

В случае внутримышечного, интраперитонеального, подкожного и внутривенного использования, соединения изобретения обычно находятся в стерильных водных растворах или суспензиях, забуференных до соответствующего рН и изотоничности. Подходящие водные наполнители включают раствор Рингера и изотонический хлорид натрия. Водные суспензии согласно изобретению могут включать суспендирующие средства, такие как производные целлюлозы, альгинат натрия, поливинилпирролидон и трагакантовая камедь, и увлажняющее средство, такое как лецитин. Подходящие консерванты для водных суспензий включают этил- и н-пропил-п-гидроксибензоат.

Эффективные дозы соединений настоящего изобретения могут быть установлены обычными методами. Конкретный уровень дозы, требуемый для любого отдельного пациента, обычно зависит от ряда факторов, включая тяжесть (серьезность) состояния, подлежащего лечению, путь введения и массу тела пациента. В общем, однако, предполагается, что суточная доза (независимо от того, вводится ли она в виде разовой дозы или в виде небольших (разделенных) доз, повторяемых через определенные промежутки времени) обычно находится в диапазоне от 0,001 до 5000 мг в день, более предпочтительно от 1 до 1000 мг в день и наиболее предпочтительно от 10 до 200 мг в день. Выраженная в виде дозировки на единицу массы тела типичная доза, как предполагается, находится между 0,01 мкг/кг и 50 мг/кг, в частности между 10 мкг/кг и 10 мг/кг, например между 100 мкг/кг и 2 мг/кг.

В другом аспекте настоящего изобретения обеспечиваются фармацевтические композиции, содержащие соединение согласно формуле (I) и ингибитор протонного насоса. Композиции, включающие антагонист ССК2/гастрина и ингибитор протонного насоса, описаны в Международной патентной заявке WO93/12817, включенной в настоящее описание посредством ссылки.

В одном аспекте настоящего изобретения ингибитором протонного насоса является

омепразол, который представляет собой 5-метокси-2-[[(4-метокси-3,5-диметил-2-пиридинил)метил]сульфинил]-1H-бензимидазол;

BY308;

SK&F 95601, который представляет собой 2-[[(3-хлор-4-морфолино-2-пиридил)метил]сульфинил]-5-метокси-(1H)-бензимидазол;

SK & 96067, который представляет собой 3-бутирил-4-(2-метилфениламино)-8-метоксихинолин;

5-трифторметил-2-[4-метокси-3-метил-2-пиридилметил]тио-[1H]-бензимидазол;

или их фармацевтически приемлемые соли.

Приведенные выше ингибиторы протонного насоса описаны и заявлены в патентах США 4472409 и 4255431. Эти патенты входят составной частью в настоящее описание посредством ссылки.

В другом аспекте настоящего изобретения, ингибитором протонного насоса является

лансопразол, который представляет собой 2-[[[3-метил-4-(2,2,2-трифторэтокси)-2-пиридинил]метил]сульфинил]-1H-бензимидазол;

пантопразол, который представляет собой 5-(дифторметокси)-2-[[(3,4-диметокси-2-пиридинил)метил]сульфинил]-1H-бензимидазол;

перпразол;

рабепразол, который представляет собой 2-[[4-(3-метоксипропокси)-3-метилпиридин-2-ил]метилсульфинил]-1H-бензимидазол;

[[4-(2,2,2-трифторэтокси)-3-метил-2-пиридил]метил]сульфенамид;

(Z)-5-метил-2-[2-(1-нафтил)этенил]-4-пиперидинопиридин HCl;

2-(4-циклогексилокси-5-метилпиридин-2-ил)-3-(1-нафтил)-1-пропанол;

метил-2-циано-3-(этилтио)-3-(метилтио)-2-пропеноат;

2-((4-метокси-2-пиридил)метилсульфинил)-5-(1,1,2,2-тетрафторэтокси)-1H-бензимидазолнатрий;

2-[[[4-(2,2,3,3,4,4,4-гептафторбутокси)-2-пиридил]метил]сульфинил]-1H-тиено[3,4-d]имидазол;

2-[[[4-(2,2,2-трифторэтокси)-3-метил-2-пиридил]метил]сульфинил]-1H-бензимидазол;

2-[[[4-(2,2,2-трифторэтокси)-3-метил-2-пиридил]метил]сульфинил]-1H-бензимидазол;

2-метил-8-(фенилметокси)имидазо[1,2-a]пиридин-3-ацетонитрил;

(2-((2-диметиламинобензил)сульфинил)бензимидазол);

4-(N-аллил-N-метиламино)-1-этил-8-((5-фтор-6-метокси-2-бензимидазолил)сульфинилметил-1-этил-1,2,3,4-тетрагидрохинолон;

2-[[(2-диметиламинофенил)метил]сульфинил]-4,7-диметокси-1H-бензимидазол;

2-[(2-(2-пиридил)фенил)сульфинил]-1H-бензимидазол;

(2-[(2-амино-4-метилбензил)сульфинил]-5-метоксибензо[d]имидазол;

(4-(2-метилпиррол-3-ил)-2-гуанидизотиазол);

4-(4-(3-(имидазол)пропокси)фенил)-2-фенилтиазол;

(E)-2-(2-(4-(3-(дипропиламино)бутокси)фенил)этенил)бензоксазол;

(E)-2-(2-(4-(3-(дипропиламино)пропокси)фенил)этенил)бензотиазол;

2-[[(5-метокси-1H-бензимидазол-2-ил)сульфинил]метил]-4-метилбензоламин;

пумилацидин A;

2,3-дигидро-2-метоксикарбонил амино-1,2-бензизотиазол-3-он;

2-(2-этиламинофенилметилсульфинил)-5,6-диметоксибензимидазол;

2-метил-8-(фенилметокси)имидазо[1,2-a]пиридин-3-ацетонитрил;

3-амино-2-метил-8-фенилметоксиимидазо[1,2-a]пиразин HCl;

2-[[(3-хлор-4-морфолино-2-пиридил)метил]сульфинил]-5-метокси-(1H)-бензимидазол;

[3-бутирил-4-(2-метилфениламино)-8-метоксихинолин];

2-инданил-2-(2-пиридил)-2-тиокарбамоилацетат HCl;

2,3-дигидро-2-(2-пиридинил)тиазоло[3,2-a]бензимидазол;

3-цианометил-2-метил-8-(3-метил-2-бутенилокси)-[1,2-a]имидазопиридин;

цинк L-карнозин;

или их фармацевтически приемлемые соли.

Рабепразол описан в патенте США 5045552. Лансопразол описан в патенте США 4628098. Пантопразол описан в патенте США 4758579. Приведенные выше патенты входят составной частью в настоящее описание путем ссылки.

Предпочтительно ингибитор протонного насоса выбирают из (RS)-рабепразола, (RS)-омепразола, лансопразола, пантопразола, (R)-омепразола, (S)-омепразола, перпразола, (R)-рабепразола, (S)-рабепразола или их щелочных солей. Щелочные соли могут представлять собой, например, соли лития, натрия, калия, кальция или магния.

Композиции данного изобретения, содержащие соединение формулы (I) и ингибитор протонного насоса, могут вводиться, как описано выше. Предпочтительно доза каждого из активных компонентов в вышеуказанных композициях может быть равной или меньше дозы, которая апробирована и показана при монотерапии с использованием отдельного указанного компонента.

В другом аспекте данного изобретения обеспечивается набор, содержащий соединение формулы (I) и ингибитор протонного насоса. Набор используют в качестве комбинированного препарата для одновременного, раздельного или последовательного использования при лечении пациентов, страдающих желудочно-кишечными расстройствами.

В очередном аспекте настоящего изобретения обеспечивается способ получения фармацевтической композиции, содержащей соединение формулы (I), в основном, описанное выше, и ингибитор протонного насоса, включающий смешивание указанного соединения и указанного ингибитора протонного насоса с фармацевтически приемлемым носителем или разбавителем.

Используемый термин "углеводородный" относится к моновалентным группам, состоящим из (атомов) углерода и водорода. В соответствии с этим углеводородные группы включают алкильные, алкенильные и алкинильные группы (в формах как с прямыми, так и с разветвленными цепями), циклоалкильные (включая полициклоалкильные группы, такие как бициклооктил и адамантил), циклоалкенильные и арильные группы и комбинации из указанных выше групп, как, например, алкилциклоалкильные, алкилполициклоалкильные, алкиларильные, алкениларильные, алкиниларильные, циклоалкиларильные и циклоалкениларильные группы.

Когда ссылаются на атом углерода углеводородной группы, который подлежит замене атомом N, O или S, то в таком случае подразумевается, что бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 заменяют бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

или что -CH2- заменяют -О- или -S-.

Когда ссылаются на необязательно замещенную углеводородную группу, то речь идет о том, что углеводородная группа замещена 1, 2 или 3 группами, независимо выбранными из -L-Q,

где L представляет связь, или группу формулы

-(CR 17R18)V-Y-(CR 17R18)W, где v и w равны, независимо, 0, 1, 2 или 3 и Y представляет связь, -CR15=CR16 -, фенил, фуранил, тиофенил, пирролил, тиазолил, имидазолил, оксазолил, изоксазолил, пиразолил, изоксазолонил, пиперазинил, пиперидинил, морфолинил, пирролидинил, изотиазолил, триазолил, оксадиазолил, тиадиазолил, пиридил или пиридазил;

Q представляет H, (С16алкил)окси, [N-Z](С16 алкил)окси(С16алкил)амино, тио, (С16алкил)тио, карбокси(С16алкил)тио, карбокси, карбокси(С1 6алкил), карбокси(С1 6алкенил), [N-Z]карбокси(С16алкил)амино, карбокси(С 16алкил)окси, формил, (С 16алкил)карбонил, (С 16алкил)оксикарбонил, (С 16алкил)карбонилокси, нитро, тригалогенметил, гидрокси, амино, [N-Z](С1 6алкил)амино, аминокарбонил, (С1 6алкил)аминокарбонил, ди(С1 6алкил)аминокарбонил, [N-Z](С16алкил)карбониламино, C 5-C8циклоалкил, [N-Z](С 16алкил)карбонил(С 16алкил)амино, галоген, галоген(С 16алкил), сульфамоил, [N -Z](С16алкил)сульфониламино, (С16алкил)сульфониламинокарбонил, карбокси(С16алкил)сульфонил, карбокси(С16алкил)сульфинил, тетразолил, [N-Z]тетразолиламино, циано, амидино, амидинотио, SO3H, формилокси, формамидо, С 38циклоалкил, (С 16алкил)сульфамоил, ди(С 16алкил)сульфамоил, (С 16алкил)карбониламиносульфонил, 5-оксо-2,5-дигидро[1,2,4]оксадиазолил, карбокси(С 16алкил)карбониламино, тетразолил(С 16алкил)тио, [N-Z]тетразолил(С 16алкил)амино, 5-оксо-2,5-дигидро[1,2,4]тиадиазолил, 5-оксо-1,2-дигидро[1,2,4]триазол, [N-Z](С 16алкил)амино(С 16алкил)амино или группу формулы

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

где P представляет O, S или NR 19 и

Z представляет H, С1 6алкил, трет-бутоксикарбонил, ацетил, бензоил или бензил.

Используемый термин "алкил" относится как к формам с прямой цепью, так и формам с разветвленной цепью. Кроме того, алкильная цепь может включать кратные связи. Следовательно, термин "алкил" также охватывает алкенильные и алкинильные группы, Аналогично термин "циклоалкил" также охватывает циклоалкенильные группы. Предпочтительно алкильные и циклоалкильные группы, используемые в настоящем изобретении, не содержат кратных связей. Там где имеются предпочтительные алкенильные группы, их определяют как алкенильные группы. Однако конкретную ссылку на алкенильные группы не следует рассматривать как какое-либо ограничение алкильных групп, описанных выше.

В тех случаях, когда ссылаются на диалкильные группы [например, ди(С 16алкил)аминогруппы], то подразумевается, что две алкильные группы могут быть одинаковыми или различными.

В интересах простоты изложения, термины, которые обычно используют для указания моновалентных групп (таких как "алкил" или "фенил"), также используют для указания двухвалентных мостиковых групп, которые образуются из соответствующей моновалентной группы при потере одного атома водорода. Относится ли указанный термин к моновалентной группе или к двухвалентной группе становится очевидным из контекста. Например, когда L представляет -(CR 17R18)V-Y-(CR 17R18)W-, то очевидно, что Y должен представлять двухвалентную группу. Таким образом, когда Y определяют как тиазолил, например, это относится к дивалентной группе, имеющей структуру

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

Там где, как в данном примере, двухвалентная мостиковая группа образуется из циклической части, связывающие связи могут находиться на любом подходящем атоме кольца, при условии соблюдения обычных правил валентности. Соответственно, в качестве другого примера термин пирролил в определении Y включает все из следующих групп:

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

Используемый в настоящем описании термин "галоген" или "гало" относится к любому из атомов фтора, хлора, брома и иода. Чаще всего, однако, галогензаместителями в соединениях изобретения являются хлор и фтор. Группы, такие как галоген(С 1-С6алкил), включают моно-, ди- или тригалогензамещенные С1 6алкильные группы. Кроме того, замещение галогеном может быть в любом положении в алкильной цепи.

Префикс [N -Z] относится к возможному замещению аминогруппы в приведенном далее названии соединения или заместителя. Например, [N -Z]алкиламино относится к группам формулы

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

Аналогично [N-Z]тетразолиламино, где Z представляет С1-С6алкил, включает группы, такие как тетразолил[N-метил]амино и тетразолил[ N-этил]амино. Конечно, когда Z представляет Н, замещение отсутствует.

В случае, если имеется какое-либо сомнение, группа, называемая как 5-оксо-2,5-дигидро[1,2,4]оксадиазолил, имеет следующую формулу:

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

и охватывает таутомерные формы.

Далее настоящее изобретение более подробно иллюстрируется нижеследующими примерами.

Экспериментальная часть

Все реакции осуществляли в атмосфере сухого аргона, если не оговорено особо. Использовали коммерчески доступные дихлорметан (ДХМ), тетрагидрофуран (ТГФ) и N,N-диметилформамид (ДМФА). В реакциях, в которых использовали анилины, если это необходимо, непрореагировавший анилин удаляли либо хроматорафией, либо путем перемешивания с избытком полистирол-метилизоцианатной смолы HL, (200-400 меш, 2 ммоль/г) в ДХМ (R.J. Booth et al., J. Am. Chem. Soc. (1997), 119, 4882). Флэш-хроматографию осуществляли на колонке с силикагелем 60 Merck (40-63 мкм), используя указанные системы растворителей. Спектры 1 H-ЯМР регистрировали на приборе Bruker DRX-300 при 300 МГц, химические сдвиги (бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 H) представлены относительно внутреннего стандарта. (2-Аминофенил)циклогексилметанон получали согласно опубликованному способу (M.S. Chambers et al., Bioorg. Med. Chem. Lett. (1993), 3, 1919), (2-аминофенил)циклопентилметанон и 1-(2-аминофенил)-3-метилбутан-1-он получали способом, представляющим собой модификацию указанного выше. 2-Бром-1-циклопентилэтанон и 2-бром-1-циклогексилэтанон получали опубликованным способом (M. Gaudry, A. Marquet, Org. Synth., (1976), 55 , 24), и 2-бром-1-циклопропилэтанон получали способом, представляющим собой модификацию указанного выше. 2-Бром-1-(1-метилциклопентил)этанон получали согласно опубликованному способу (T.S. Sorensen, J. Am. Chem. Soc. (1969), 91, 6398). Замещенные анилины либо коммерчески доступны, либо их получали синтетически описанным в литературе способом, в котором впервые упоминались анилины, либо получали через ряд стадий и из исходного вещества, как указано, используя стандартные химические превращения.

Пример 1. Метиловый эфир 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты.

Стадия a. Этиловый эфир.

{N'-[(2-Аминофенил)циклогексилметилен]гидразино}уксусной кислоты. Смесь (2-аминофенил)циклогексилметанона (20,3 г, 0,1 моль), гидрохлорида этилгидразиноацетата (23,25 г, 0,15 моль) и пиридина (12,1 мл, 0,15 моль) нагревают при температуре кипения с обратным холодильником в EtOH (400 мл) в течение 72 ч. После охлаждения непрореагировавший гидрохлорид этилгидразиноацетата кристаллизуется из раствора и его удаляют фильтрованием. Фильтрат упаривают и остаток распределяют между насыщенным NaHCO 3 (250 мл) и EtOAc (250 мл). Органическую фазу промывают насыщенным раствором соли (250 мл), сушат над MgSO 4, затем растворитель выпаривают при пониженном давлении. Остаток очищают колоночной флэш-хроматографией (EtOAc-гексан (1:4)), получая этиловый эфир {N'-[(2-аминофенил)циклогексилметилен]гидразино}уксусной кислоты в виде бледно-желтой пены (21,2 г, 71%) и непрореагировавший (2-аминофенил)циклогексилметанон (2,40 г).

1H ЯМР (CDCl3) 7,17 (1Н, дт), 6,98 (1H, дд), 6,80 (1H, дт), 6,73 (1H, дд), 5,32 (1Н, т), 4,16 (2H, м), 3,95 (2H, шир.с), 3,89 (2H, м), 2,37 (1Н, м), 1,80 (1H, м), 1,75-1,61 (4H, м), 1,33-1,19 (8H, м).

Стадия b . Этиловый эфир (5-циклогексил-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил)уксусной кислоты. К раствору продукта стадии a (23,39 г, 77,0 ммоль) и триэтиламина (26,8 мл, 0,19 моль) в ДХМ (300 мл) при 0°C добавляют по каплям раствор трифосгена (11,4 г, 39 ммоль) в ДХМ (100 мл) на протяжении 1 ч. Реакционную смесь перемешивают при этой температуре в течение 1 ч, промывают H 2O (300 мл), насыщенным NaHCO3 (300 мл) и насыщенным раствором соли (300 мл). Органическую фазу сушат над MgSO4, фильтруют и растворитель выпаривают при пониженном давлении. Неочищенный продукт перекристаллизовывают из смеси Et2O-гексан (1:3), получая основной продукт, этиловый эфир (5-циклогексил-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил)уксусной кислоты (15,8 г, 62%), в виде желтого твердого вещества. Концентрирование маточных растворов и перекристаллизация остатка из смеси EtOAc-гексан (1:9) дает неосновной продукт, этиловый эфир (1-хлоркарбонил-5-циклогексил-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил)уксусной кислоты (2,1 г, 7,0%), в виде бледно-желтого твердого вещества.

Основной продукт: этиловый эфир (5-циклогексил-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил)уксусной кислоты.

1H ЯМР (CDCl 3) 7,35 (2H, м), 7,12 (1H, т), 6,85 (2H, м), 4,32 (2H, с), 4,18 (2H, м), 2,68 (1Н, м), 1,81-1,68 (5H, м), 1,49-1,22 (8H, м).

Неосновной продукт: этиловый эфир (1-хлоркарбонил-5-циклогексил-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил)уксусной кислоты.

1H ЯМР (CDCl 3) 7,65-7,49 (4H, м), 4,61-4,35 (2H, м), 4,15 (2H, м), 2,86 (1H, м), 2,00-1,22 (10H, м), 1,18 (3H, т).

Стадия c. Этиловый эфир [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты. К охлаждаемому льдом раствору основного продукта стадии b (3,29 г, 10,0 ммоль) в ДМФА (30 мл) добавляют небольшими порциями гидрид натрия (60% дисперсия в минеральном масле, 480 мг, 12,0 ммоль). Смесь перемешивают при комнатной температуре в течение 30 мин, затем добавляют 1-бром-3,3-диметилбутан-2-он (1,60 мл, 12,0 ммоль). Реакционную смесь перемешивают при комнатной температуре в течение 2 ч, разбавляют H2 O (200 мл) и экстрагируют EtOAc (30 мл × 3). Объединенные органические экстракты промывают насыщенным раствором соли (50 мл), сушат над MgSO4, фильтруют и растворитель выпаривают при пониженном давлении. Остаток очищают колоночной флэш-хроматографией (EtOAc-ДХМ (1:9)), получая продукт в виде желтой пены (3,59 г, 84%).

1H ЯМР (CDCl3) 7,37 (2H, м), 7,17 (1H, дт), 6,93 (1H, д), 4,66 (2H, с), 4,35 (1H, м), 4,13 (3H, м), 2,74 (1Н, м), 1,90-1,70 (6H, м), 1,31-1,16 (16H, м).

Стадия d. [5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]уксусная кислота. Раствор продукта стадии c (3,57 г, 8,20 ммоль) и 1,0М NaOH (8,70 мл, 8,70 ммоль) в EtOH (30 мл) перемешивают при комнатной температуре в течение 16 ч. EtOH выпаривают при пониженном давлении, остаток разбавляют H2 O (30 мл) и подкисляют до pH 3 с помощью 1N HCl. Смесь экстрагируют ДХМ (30 мл × 2), объединенные экстракты сушат над MgSO 4, фильтруют и растворитель выпаривают при пониженном давлении, получая продукт в виде бледно-желтой пены (3,10 г, 95%).

1H ЯМР (CDCl3) 11,00 (1H, шир.с), 7,45 (2H, м), 7,25 (1H, м), 6,97 (1H, дд), 4,68 (2H, м), 4,25 (1H, д), 3,90 (1H, д), 2,80 (1H, м), 2,08-1,61 (6H, м), 1,44-1,18 (13H, м).

Стадия e. К раствору продукта стадии d (1,60 г, 4,00 ммоль) и метилового эфира 3-аминобензойной кислоты (600 мг, 4,00 ммоль) в ДМФА (20 мл) добавляют 1-гидроксибензотриазол (HOBt) (810 мг, 6,00 ммоль), 4-диметиламинопиридин (DMAP) (50 мг, 0,40 ммоль) и гидрохлорид 1-(3-диметиламинопропил)-3-этилкарбодиимида (EDC) (1,15 г, 6,00 ммоль). Раствор выдерживают при комнатной температуре в течение 16 ч, разбавляют Н2O (100 мл) и реакционную смесь экстрагируют EtOAc (50 мл × 2). Объединенные экстракты промывают 5% KHSO4 (60 мл), насыщенным NaHCO3 (60 мл) и насыщенным раствором соли (60 мл). Органическую фазу сушат над MgSO4 , фильтруют и растворитель выпаривают при пониженном давлении. Остаток растирают с Et2O, получая указанное в заголовке соединение в виде не совсем белого твердого вещества (1,51 г, 71%).

1H ЯМР (CDCl 3) 8,49 (1H, с), 7,92 (1H, м), 7,84 (1Н, т), 7,74 (1H, дт), 7,48 (2H, м), 7,39-7,27 (2H, м), 7,03 (1H, д), 4,77 (1Н, д), 4,60 (1Н, д), 4,25 (2H, с), 3,91 (3H, с), 2,80 (1H, м), 2,05-1,73 (6H, м), 1,34-1,17 (13H, м).

Найдено: C 67,56, H 6,83, N 10,36%. C30H36N 4O5. Вычислено: C 67,56, H 6,81, N 10,52%.

Пример 2. 3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

К раствору метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1) (1,33 г, 2,49 ммоль) в смеси ТГФ-H 2O (2:1, 45 мл) добавляют моногидрат гидроксида лития (318 мг, 7,58 ммоль) и смесь перемешивают при комнатной температуре в течение 16 ч. ТГФ выпаривают при пониженном давлении, водный раствор разбавляют H2O (50 мл) и подкисляют до pH 3 при помощи 1N HCl. Реакционную смесь экстрагируют ДХМ (30 мл × 2), объединенные экстракты промывают насыщенным раствором соли (50 мл), сушат над MgSO4 , фильтруют и растворитель выпаривают при пониженном давлении, получая продукт в виде не совсем белого твердого вещества (1,28 г, 99%).

1H ЯМР (ДМСО-d 6) 12,89 (1H, шир.с), 9,99 (1H, с), 8,16 (1H, с), 7,70 (1H, дд), 7,60-7,36 (4H, м), 7,26-7,15 (2H, м), 4,78 (2H, д), 4,30 (1Н, д), 3,98 (1H, д), 2,87 (1Н, м), 1,80-1,50 (6H, м), 1,34-1,13 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 60,39, H 7,31, N, 9,78%. C29H34 N4O5·C 7H17NO5. Вычислено: C 60,57, H 7,20, N 9,81%.

Пример 3. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-(3-метиламинофенил)ацетамид.

Стадия a. трет-Бутиловый эфир (3-нитрофенил)карбаминовой кислоты. Раствор 3-нитрофенилизоцианата (14,44 г, 88,0 ммоль) в трет-бутаноле (80 мл) нагревают при температуре кипения с обратным холодильником в течение 2 ч. После охлаждения растворитель выпаривают и остаток сушат в условиях высокого вакуума, тщательно промывают Et2O, получая продукт в виде желтого твердого вещества (19,96 г, 95%).

1H ЯМР (CDCl3) 8,30 (1H, с), 7,88 (1H, д), 7,71 (1H, д), 7,45 (1H, т), 6,68 (1H, шир.с), 1,55 (9H, с).

Стадия b. трет-Бутиловый эфир метил(3-нитрофенил)карбаминовой кислоты. К охлаждаемому льдом раствору продукта стадии a (3,57 г, 15,0 ммоль) в ДМФА (30 мл) добавляют небольшими порциями гидрид натрия (60% дисперсия в минеральном масле, 720 мг, 18,0 ммоль). После перемешивания при комнатной температуре в течение 1 ч реакционную смесь охлаждают снаружи льдом и добавляют иодметан (1,4 мл, 22,5 ммоль). Реакционную смесь перемешивают при комнатной температуре в течение 2 ч, добавляют H 2O (150 мл) и экстрагируют EtOAc (50 мл × 2). Объединенные экстракты промывают насыщенным раствором соли, сушат (MgSO 4), фильтруют и растворитель выпаривают. Остаток очищают колоночной флэш-хроматографией (EtOAc-ДХМ (1:9)), получая продукт в виде желтой пены (3,34 г, 88%).

1 H ЯМР (CDCl3) 8,16 (1H, т), 8,00 (1H, м), 7,63 (1Н, м), 7,48 (1H, т), 3,34 (3H, с), 1,49 (9H, с).

Стадия с. трет-Бутиловый эфир (3-аминофенил)метилкарбаминовой кислоты. В круглодонной колбе, содержащей продукт стадии b (3,30 г, 13,1 ммоль), 10% палладий на угле (300 мг) и смесь ТГФ-MeOH (1:1,50 мл), создают вакуум и продувают водородом три раза. Смесь энергично перемешивают на протяжении ночи в атмосфере водорода. Катализатор удаляют фильтрованием через подушку целита и фильтрат упаривают, получая продукт в виде белого твердого вещества (2,90 г, 99%).

1H ЯМР (CDCl 3) 7,10 (1H, т), 6,62 (2H, м), 6,50 (1H, м), 3,66 (2H, шир.с), 3,22 (3H, с), 1,46 (9H, с).

Стадия d. трет-Бутиловый эфир (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)метилкарбаминовой кислоты получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что на стадии e трет-бутиловый эфир (3-аминофенил)метилкарбаминовой кислоты (Пример 3, стадия c) используют вместо метилового эфира 3-аминобензойной кислоты.

1H ЯМР (CDCl 3) 8,29 (1H, с), 7,44 (3H, м), 7,29-7,11 (4H, м), 7,03-6,94 (2H, м), 4,67 (2H, м), 4,23 (2H, м), 3,23 (3H, с), 2,79 (1Н, м), 2,05-1,52 (6H, м), 1,45 (9H, с), 1,37-1,23 (13H, м).

Стадия e. Раствор продукта стадии d (270 мг, 0,45 ммоль) в трифторуксусной кислоте (3 мл) перемешивают при комнатной температуре в течение 1 ч. Трифторуксусную кислоту выпаривают при пониженном давлении, остаток распределяют между насыщенным NaHCO3 (20 мл) и EtOAc (20 мл). Органическую фазу отделяют и сушат над MgSO4 . Фильтрование и выпаривание растворителя дает неочищенный продукт, который очищают колоночной флэш-хроматографией (EtOAc-ДХМ (1:9)), получая указанное в заголовке соединение в виде бесцветной пены (154 мг, 68%).

1H ЯМР (CDCl 3) 8,07 (1H, с), 7,48 (2H, м), 7,27 (1Н, дт), 7,04 (2H, м), 6,91 (1H, т), 6,46(1H, дд), 6,31(1H, дд), 4,68 (2H, м), 4,35 (1H, д), 4,13 (1Н, д), 3,72 (1H, шир.с), 2,80 (4H, м), 2,05-1,72 (6H, м), 1,27 (13H, м).

Найдено: C 68,77, H 7,64, N 13,69%. C29H37N 5O3. Вычислено: C 69,16, H 7,40, N 13,91%.

Пример 4. 2-[1-(3,3-Диметил-2-оксобутил)-2-оксо-5-фенил-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]-N-(3-метиламинофенил)ацетамид.

Стадия a. [1-(3,3-Диметил-2-оксобутил)-2-оксо-5-фенил-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]уксусную кислоту получают проведением стадий a-d способа, используемого для получения [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d), за исключением того, что на стадии a используют 2-аминобензофенон вместо (2-аминофенил)циклогексилметанона.

1H ЯМР (CDCl3) 7,61 (2H, дд), 7,49-7,42 (4H, м), 7,17 (2H, м), 7,05 (1Н, д), 4,76 (2H, шир.м), 4,28 (2H, шир.д), 1,25 (9H, с).

Стадия b. Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1, стадия e), за исключением того, что [1-(3,3-диметил-2-оксобутил)-2-оксо-5-фенил-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 4, стадия a) и трет-бутиловый эфир (3-аминофенил)метилкарбаминовой кислоты (Пример 3, стадия c) используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро- 3Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, с последующей реакцией полученного продукта, вместо трет-бутилового эфира (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)метилкарбаминовой кислоты (Пример 3, стадия d), согласно способу Примера 3, стадия e.

1H ЯМР (CDCl 3) 8,01 (1Н, с), 7,63 (2H, м), 7,55 (1H, м), 7,42 (3H, м), 7,25 (2H, м), 7,14 (1Н, д), 7,00 (1H, т), 6,90 (1Н, т), 6,40 (1Н, дд), 6,29 (1Н, дд), 4,76 (2H, м), 4,52 (1Н, д), 4,34 (1H, д), 3,25 (1H, шир.с), 2,77 (3H, с), 1,26 (9H, с).

Найдено: C 68,44, H 6,46, N 13,80%. С29H 31N5O3·0,6H 2O. Вычислено: C 68,41, H 6,39, N 13,76%.

Пример 5. 2-[1-(3,3-Диметил-2-оксобутил)-2-оксо-5-пиридин-2-ил-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-(3-метиламинофенил)ацетамид.

Стадия a. [1-(3,3-Диметил-2-оксобутил)-2-оксо-5-пиридин-2-ил-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]уксусную кислоту получают проведением стадий a-d способа, используемого для получения [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d), за исключением того, что на стадии a используют (2-аминофенил)пиридин-2-илметанон (G. Semple et al., Synth. Commun. (1996), 26, 721) вместо (2-аминофенил)циклогексилметанона.

1H ЯМР (ДМСО-d6 ) 12,50 (1H, шир.с), 8,57 (1H, м), 7,94 (2H, м), 7,50 (2H, м), 7,16 (3H, м), 4,78 (2H, с), 4,25 (2H, шир.с), 1,15 (9H, с).

Стадия b. Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1, стадия e), за исключением того, что [1-(3,3-диметил-2-оксобутил)-2-оксо-5-пиридин-2-ил-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 5, стадия a) и трет-бутиловый эфир (3-аминофенил)метилкарбаминовой кислоты (Пример 3, стадия c) используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, с последующей реакцией полученного продукта, вместо трет -бутилового эфира (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)метилкарбаминовой кислоты (Пример 3, стадия d), согласно способу Примера 3, стадия e.

1H ЯМР (CDCl 3) 8,62 (1Н, д), 8,10 (1Н, д), 8,00 (1Н, шир.с), 7,79 (1Н, дт), 7,55 (1H, м), 7,29 (3H, м), 7,13 (1H, д), 7,01 (1H, т), 6,92 (1Н, т), 6,48 (1H, дд), 6,30 (1H, дд), 4,68 (2H, шир.д), 4,45 (2H, шир.д), 2,80 (1Н, шир.с), 2,78 (3H, с), 1,27 (9H, с).

Найдено: C 67,18, H 6,28, N 16,63%. C28 H30N6O 3. Вычислено: C 67,45, H 6,06, N 16,86%.

Пример 6. N-(3-Метиламинофенил)-2-[2-оксо-1-(2-оксо-2-пирролидин-1-илэтил)-5-пиридин-2-ил-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетамид.

Стадия a. [2-Оксо-1-(2-оксо-2-пирролидин-1-илэтил)-5-пиридин-2-ил-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту получают проведением стадий a-d способа, используемого для получения [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d), за исключением того, что (2-аминофенил)пиридин-2-илметанон используют на стадии a вместо (2-аминофенил)циклогексилметанона и на стадии с используют 2-бром-1-пирролидин-1-илэтанон (полученный из пирролидина и бромацетилбромида) вместо 1-бром-3,3-диметилбутан-2-она.

Стадия b. Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1, стадия e), за исключением того, что [2-оксо-1-(2-оксо-2-пирролидин-1-илэтил)-5-пиридин-2-ил-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 6, стадия a) и трет-бутиловый эфир (3-аминофенил)метилкарбаминовой кислоты (Пример 3, стадия c) используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, с последующим взаимодействием полученного продукта, вместо трет-бутилового эфира (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)метилкарбаминовой кислоты (Пример 3, стадия d), согласно способу Примера 3, стадия e.

1H ЯМР (CDCl 3) 8,61 (1H, д), 8,07 (2H, м), 7,77 (1H, дт), 7,54 (2H, м), 7,36-7,24 (3H, м), 6,98 (1H, т), 6,88 (1H, с), 6,48 (1Н, д), 6,28 (1H, д), 4,53-4,34 (4H, шир.м), 3,52-3,20 (5H, шир.м), 2,75 (3H, с), 1,97 (2H, м), 1,87 (2H, м).

Найдено: C 65,44, H 6,00, N 18,79%. C28H29 N7O3. Вычислено: C 65,74, H 5,71, N 19,17%.

Пример 7. N-(3-Метиламинофенил)-2-[2-оксо-1-(2-оксо-2-o-толилэтил)-5-пиридин-2-ил-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетамид.

Стадия a. [2-Оксо-1-(2-оксо-2-o-толилэтил)-5-пиридин-2-ил-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]уксусную кислоту получают проведением стадий a-d способа, используемого для получения [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d), за исключением того, что (2-аминофенил)пиридин-2-илметанон используют на стадии a вместо (2-аминофенил)циклогексилметанона и на стадии с 1-бром-3,3-диметилбутан-2-он заменяют 2-бром-1- o-толилэтаноном (H. Shinagawa et al., Bioorg. Med. Chem. (1997), 5, 601).

Стадия b. Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1, стадия e), за исключением того, что [2-оксо-1-(2-оксо-2- o-толилэтил)-5-пиридин-2-ил-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 7, стадия a) и трет-бутиловый эфир (3-аминофенил)метилкарбаминовой кислоты (Пример 3, стадия c) используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, с последующим взаимодействием полученного продукта, вместо трет-бутилового эфира (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)метилкарбаминовой кислоты (Пример 3, стадия d), согласно способу Примера 3, стадия e.

1H ЯМР (CDCl 3) 8,64 (1H, д), 8,08 (1Н, д), 8,03 (1H, с), 7,79 (1H, дт), 7,59 (2H, м), 7,39-7,26 (5H, м), 7,19 (2H, м), 7,01 (1H, т), 6,90 (1H, с), 6,47 (1H, дд), 6,30 (1Н, дд), 4,98 (2H, с), 4,45 (2H, шир.м), 3,30 (1H, шир.с), 2,76 (3H, с), 2,47 (3H, с).

Найдено: C 69,63, H 5,45, N 15,59%. C31 H28N6O 3. Вычислено: C 69,91, H 5,30, N 15,78%.

Пример 8. 1-[1-(3,3-Диметил-2-оксобутил)-2-оксо-5-пиридин-2-ил-1,2-дигидро-3H-1,3,4-бензотриазепин-3-илметил]-3-(3-метиламинофенил)мочевина.

Стадия a. трет-Бутиловый эфир (3-{3-[1-(3,3-Диметил-2-оксобутил)-2-оксо-5-пиридин-2-ил-1,2-дигидро-3H-1,3,4-бензотриазепин-3-илметил]уреидо}фенил)метилкарбаминовой кислоты. К охлаждаемому льдом раствору [1-(3,3-диметил-2-оксобутил)-2-оксо-5-пиридин-2-ил-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 5, стадия a) (390 мг, 1,00 ммоль) и триэтиламина (180 мкл, 1,30 ммоль) в ацетоне (3 мл) добавляют этилхлорформиат (120 мкл, 1,30 ммоль). Смесь перемешивают в течение 20 мин и добавляют раствор азида натрия (100 мг, 1,50 ммоль) в H2O (3 мл). Реакционную смесь перемешивают при 0°C в течение 1 ч, затем выливают в PhCH3 2O (1:1,20 мл). Органическую фазу отделяют, сушат над MgSO 4, фильтруют и фильтрат нагревают при температуре кипения с обратным холодильником в течение 1 ч. После охлаждения до комнатной температуры растворитель выпаривают при пониженном давлении. Остаток растворяют в ДХМ (5 мл) и добавляют трет-бутиловый эфир (3-аминофенил)метилкарбоновой кислоты (Пример 3, стадия c) (220 мг, 1,00 ммоль). Раствор перемешивают при комнатной температуре в течение 1 ч, разбавляют ДХМ (15 мл), промывают насыщенным NaHCO3 (20 мл) и сушат над MgSO 4. Фильтрование и выпаривание растворителя дает неочищенный продукт, который очищают колоночной флэш-хроматографией (EtOAc-ДХМ (1:1)), получая продукт в виде бесцветной пены (166 мг, 27%).

1H ЯМР (CDCl3) 8,51 (1H, д), 8,05 (1H, д), 7,85 (1Н, д), 7,67 (1H, т), 7,39 (1Н, м), 7,25 (2H, м), 7,13-7,05 (4H, м), 6,95 (1Н, д), 6,84 (1Н, д), 6,18 (1H, шир.т), 5,04 (1Н, шир.с), 4,86 (1H, шир.с), 4,65 (1Н, шир.с), 4,32 (1Н, шир.с), 3,15 (3H, с), 1,49 (9H, с), 1,18 (9H, с).

Стадия b. Указанное в заголовке соединение получают реакцией трет-бутилового эфира (3-{3-[1-(3,3-диметил-2-оксобутил)-2-оксо-5-пиридин-2-ил-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-илметил]уреидо}фенил)метилкарбаминовой кислоты (Пример 8, стадия a), вместо трет-бутилового эфира (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)метилкарбаминовой кислоты (Пример 3, стадия d), согласно способу Примера 3, стадия e.

1H ЯМР (CDCl 3) 8,56 (1H, д), 8,00 (1Н, д), 7,71 (1H, дт), 7,43 (1H, м), 7,30-7,15 (4H, м), 7,02 (2H, м), 6,72 (1H, т), 6,52 (1H, дд), 6,29 (1Н, дд), 6,09 (1H, шир.т), 4,97 (2H, шир.д), 4,70 (1H, шир.с), 4,44 (1H, шир.с), 3,90 (1H, шир.с), 2,76 (3H, с), 1,23 (9H, с).

Найдено: C 65,55, H 6,27, N 19,00%. C 28H31N7O 3. Вычислено: C 65,48, H 6,08, N 19,09%.

Пример 9. 3-{2-[5-Циклопентил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Стадия а. [5-Циклопентил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]уксусную кислоту получают проведением стадий a-d способа, используемого для получения [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d), за исключением того, что (2-аминофенил)циклопентилметанон используют на стадии a вместо (2-аминофенил)циклогексилметанона.

1H ЯМР (ДМСО-d6 ) 12,30 (1H, шир.с), 7,51-7,10 (4H, м), 4,77 (2H, с), 4,05 (2H, м), 3,39 (1H, м), 1,74-1,56 (8H, м), 1,12 (9H, с).

Стадия b. Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1, стадия e), за исключением того, что [5-циклопентил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 9, стадия a) используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) с последующим взаимодействием полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2 -дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 12,89 (1H, шир.с), 9,98 (1Н, с), 8,16 (1H, с), 7,71-7,14 (7H, м), 4,79 (2H, м), 4,22 (1H, м), 4,00 (1H, м), 3,42 (1H, м), 1,75-1,54 (8H, м), 1,32-1,19 (9H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 57,08, H 7,45, N 9,60%. C28H32 N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,0H2O. Вычислено: C 57,13, H 7,26, N 9,52%.

Пример 10. 2-[5-Циклопентил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-[3-(2Н-тетразол-5-ил)фенил]ацетамид.

Стадия а. 5-(3-{2-[5-Циклопентил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)тетразол-2-илметиловый эфир 2,2-диметилпропионовой кислоты получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [5-циклопентил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро- 3Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 9, стадия a) и 5-(3-аминофенил)тетразол-2-илметиловый сложный эфир используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e.

1H ЯМР (CDCl 3) 8,00 (1H, с), 7,55-7,44 (3H, м), 7,27-7,22 (3H, м), 7,00 (2H, м), 6,29 (2H, с), 4,75 (1H, д), 4,65 (1H, д), 4,25 (1Н, м), 4,11 (1H, м), 3,29 (1Н, м), 2,00-1,30 (8H, м), 1,26-1,19 (18H, м).

Стадия b. 5-(3-{2-[5-Циклопентил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)тетразол-2-илметиловый эфир 2,2-диметилпропионовой кислоты (Пример 10, стадия a ) (120 мг, 0,22 ммоль) перемешивают на протяжении ночи в 10 мл насыщенного раствора аммиака в метаноле при комнатной температуре. После концентрирования в вакууме остаток растворяют в смеси Н2О-MeOH (10:1, 22 мл) и подкисляют до рН 3 добавлением 5% раствора KHSO4. Указанное в заголовке соединение выделяют в виде светло-розового твердого вещества фильтрованием реакционной смеси и сушат в вакууме (81 мг, 68%).

1H ЯМР (CDCl3) 8,61 (1Н, с), 7,50-7,44 (3H, м), 7,31-7,24 (2H, м), 7,14 (1H, м), 6,97 (2H, м), 4,95 (1Н, д), 4,65 (1Н, д), 4,17 (2H, м), 3,30 (1H, м), 1,80-1,58 (8H, м), 1,15 (9H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 54,46, H 7,13, N 16,28%. C28H32N 8O3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,5H2O. Вычислено: C 54,67, H 7,07, N 16,39%.

Пример 11. 2-[5-Циклопентил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-(3-метиламинофенил)ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро -3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [5-циклопентил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 9, стадия a) и трет-бутиловый эфир (3-аминофенил)метилкарбаминовой кислоты (Пример 3, стадия c) используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо трет-бутилового эфира (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)метилкарбаминовой кислоты (Пример 3, стадия d), согласно способу Примера 3, стадия e. Продукт охарактеризовывают как гидрохлоридную соль.

1H ЯМР (ДМСО-d 6) 9,89 (1H, шир.с), 7,84-7,40 (6H, м), 7,20 (1H, м), 6,66 (1H, м), 4,78 (2H, м), 3,98 (1Н, м), 3,68 (1H, м), 3,35 (1H, м), 2,73 (3H, с), 1,85-1,33 (8H, м), 1,13 (9H, с).

Пример 12. 3-{2-[1-(3,3-Диметил-2-оксобутил)-5-изобутил-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Стадия а. [1-(3,3-Диметил-2-оксобутил)-5-изобутил-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту получают проведением стадий a-d способа, используемого для получения [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d), за исключением того, что на стадии а используют 1-(2-аминофенил)-3-метилбутан-1-он вместо (2-аминофенил)циклогексилметанона.

1H ЯМР (CDCl3) 7,47-7,39 (2H, м), 7,24 (1H, м), 6,98 (1H, д), 4,60 (2H, шир.м), 4,10 (2H, шир.м), 2,60 (2H, шир.м), 1,93 (1Н, м), 1,25 (9H, с), 0,95 (6H, шир.м).

Стадия b. Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [1-(3,3-диметил-2-оксобутил)-5-изобутил-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 12, стадия a) используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) на стадии e, с последующим взаимодействием полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 13,0 (1H, шир.), 10,01 (1H, с), 8,17 (1Н, т), 7,70 (1Н, д), 7,60-7,49 (3H, м), 7,38 (1Н, т), 7,24 (1Н, т), 7,13 (1H, д), 4,74 (2H, шир.м), 4,35 (1Н, шир.м), 4,02 (1H, шир.м), 2,85 (1H, шир.м), 2,35 (1H, шир.м), 1,74 (1Н, м), 1,15 (9H, с), 0,85 (6H, шир.м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,58, H 7,55, N 9,54%. C27H 32N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,0H2O. Вычислено: C 56,42, H 7,38, N 9,68%.

Пример 13. 2-[1-(3,3-Диметил-2-оксобутил)-5-изобутил-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-(3-метиламинофенил)ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [1-(3,3-диметил-2-оксобутил)-5-изобутил-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 11, стадия a) и трет-бутиловый эфир (3-аминофенил)метилкарбаминовой кислоты (Пример 3, стадия c) используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо трет-бутилового эфира (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)метилкарбаминовой кислоты (Пример 3, стадия d), согласно способу Примера 3, стадия e. Далее соединение охарактеризовывают в виде гидрохлоридной соли.

1H ЯМР (ДМСО-d 6) 10,03 (1H, шир.с), 7,56-7,46 (3H, м), 7,28-7,20 (3H, м), 7,13 (1H, д), 6,89 (1Н, д), 4,73 (2H, шир.с), 4,10 (2H, шир.), 3,85 (1Н, шир.м), 2,78 (3H, с), 2,30 (1H, шир.м), 1,74 (1Н, м), 1,15 (9H, с), 0,86 (6H, шир.м).

Найдено: C 61,02, H 7,35, N 13,18%. C27H35N 5O3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 H2Oбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 HCl. Вычислено: С 60,95, H 7,20, N 13,16%.

Пример 14. 3-{2-[5-Циклогексил-1-метил-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что на стадии c иодметан используют вместо 1-бром-3,3-диметилбутан-2-она, с последующим взаимодействием полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 12,90 (1Н, шир.с), 10,03 (1H, с), 8,16 (1H, с), 7,69 (1Н, д), 7,60-7,50 (3H, м), 7,38 (1Н, т), 7,31-7,22 (2H, м), 4,20 (2H, шир.д), 3,14 (3H, с), 2,85 (1H, м), 1,64-1,04 (10H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,92, H 7,12, N, 10,58%. C24 H26N4O 4бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,4H2O. Вычислено: C 56,82, H 7,05, N 10,69%.

Пример 15. 3-{2-[5-Циклогексил-2-оксо-1-(2-оксо-2-o-толилэтил)-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 2-бром-1-o-толилэтанон используют на стадии c вместо 1-бром-3,3-диметилбутан-2-она, с последующим взаимодействием полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 13,00 (1Н, шир.с), 9,98 (1Н, с), 8,15 (1H, с), 7,77 (1H, д), 7,70 (1H, дд), 7,60-7,51 (3H, м), 7,39 (2H, м), 7,26 (4H, м), 5,06 (2H, м), 4,32 (1Н, д), 3,98 (1H, д), 2,85 (1H, м), 2,29 (3H, с), 1,65-1,54 (6H, м), 1,36-1,14 (4H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 60,58, H 6,86, N, 8,86%. C32H32 N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,4H2O. Вычислено: C 60,45, H 6,76, N 9,04%.

Пример 16. 3-{2-[5-Циклогексил-1-(3-метилбутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 1-бром-3-метилбутан используют на стадии c вместо 1-бром-3,3-диметилбутан-2-она, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 13,00 (1Н, шир.с), 9,99 (1H, с), 8,14 (1H, с), 7,68 (1H, дд), 7,56 (3H, м), 7,40 (2H, м), 7,27 (1H, д), 4,33 (1H, д), 3,98 (2H, м), 3,60 (1H, м), 2,85 (1H, м), 1,65-1,06 (13H, м), 0,77 (6H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 59,05, H 7,81, N 10,02%. C28 H34N4O 4бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,3H2O. Вычислено: C 59,23, H 7,62, N 9,87%.

Пример 17. 3-{2-[1-(2-Адамантан-1-ил-2-оксоэтил)-5-циклогексил-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 1-адамантан-1-ил-2-бромэтанон используют на стадии c вместо 1-бром-3,3-диметилбутан-2-она, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,51 (1H, с), 8,04 (1Н, д), 7,84 (1H, с), 7,80 (1H, д), 7,52-7,23 (4H, м), 7,03 (1Н, д), 4,75 (1H, д), 4,59 (1H, д), 4,26 (2H, м), 2,80 (1Н, м), 2,07-1,70 (21H, м), 1,27 (4H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 60,07, H 7,58, N 8,37%. C35H 40N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,7H2O. Вычислено: C 60,05, H 7,48, N 8,34%.

Пример 18. 3-{2-[5-Циклогексил-1-(2-этоксиэтил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что бромэтилэтиловый простой эфир используют на стадии c вместо 1-бром-3,3-диметилбутан-2-она, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,45 (1H, с), 7,97 (1H, дд), 7,80 (1Н, д), 7,63 (1Н, т), 7,57 (1Н, дт), 7,48 (1H, д), 7,37 (3H, м), 4,44 (1Н, д), 4,34 (1H, м), 4,16 (1H, д), 3,75 (1H, м), 3,55 (2H, м), 3,38 (2H, м), 2,81 (1Н, м), 2,02-1,67 (6H, м), 1,28 (4H, м), 1,08 (3H, т).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,72, H 7,46, N 9,69%. C27H32 N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,8H2O. Вычислено: C 56,72, H 7,36, N 9,73%.

Пример 19. 3-{2-{5-Циклогексил-2-оксо-1-(тетрагидропиран-2-илметил)-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что на стадии c 2-бромметилтетрагидропиран используют вместо 1-бром-3,3-диметилбутан-2-она, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,45 (1Н, д), 7,98 (1H, д), 7,79 (1H, д), 7,64-7,54 (2H, м), 7,49-7,33 (3H, м), 7,25 (1H, м), 4,47-4,12 (3H, м), 3,80 (1H, м), 3,55-3,30 (2H, м), 3,23 (1H, м), 2,82 (1H, м), 2,05-1,20 (16H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 57,71, H 7,53, N 9,14%. C29 H34N4O 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,1H2O. Вычислено: C 57,54, H 7,40, N 9,32%.

Пример 20. 3-{2-[5-Циклогексил-2-оксо-1-(2-оксо-2-пирролидин-1-илэтил)-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 2-бром-1-пирролидин-1-илэтанон используют на стадии c вместо 1-бром-3,3-диметилбутан-2-она, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,59 (1H, с), 8,02 (1H, д), 7,85 (1H, с), 7,75 (1Н, д), 7,48 (2H, м), 7,33 (3H, м), 4,50 (1H, д), 4,35 (1H, д), 4,80 (2H, с), 3,53 (4H, м), 2,78 (1Н, м), 2,05-1,70 (10Н, м), 1,26 (4H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,43, H 7,30, N 10,86%. C29 H33N5O 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,3H2O. Вычислено: C 56,34, H 7,16, N 10,95%.

Пример 21. 3-{2-[5-Циклогексил-2-оксо-1-(2-оксопропил)-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Стадия а. Этиловый эфир [5-циклогексил-2-оксо-1-(2-оксопропил)-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]уксусной кислоты. К раствору этилового эфира (5-циклогексил-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил)уксусной кислоты (Пример 1, основной продукт стадии b) (300 мг, 1,00 ммоль) в MeCN (5 мл) добавляют K2CO3 (166 мг, 1,20 ммоль), KI (20 мг) и 1-хлорпропан-2-он (90 мкл, 1,10 ммоль). Реакционную смесь нагревают при температуре кипения с обратным холодильником в течение 48 ч, затем добавляют 1-хлорпропан-2-он (180 мкл, 2,20 ммоль) и нагревание продолжают в течение 16 ч. Реакционную смесь фильтруют и фильтрат упаривают. Остаток распределяют между насыщенным NaHCO3 (30 мл) и EtOAc (30 мл). Органическую фазу сушат (MgSO4 ), фильтруют и растворитель выпаривают. Неочищенный продукт очищают колоночной флэш-хроматографией (EtOAc-ДХМ (1:19)), получая продукт в виде бесцветной пены (297 мг, 77%).

1 H ЯМР (CDCl3) 7,40 (2H, м), 7,19 (1Н, т), 6,98 (1H, д), 4,50-4,11 (6H, м), 2,73 (1H, м), 2,19 (3H, с), 1,98-1,60 (6H, м), 1,26 (7H, м).

Стадия b. Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что этиловый эфир [5-циклогексил-2-оксо-1-(2-оксопропил)-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 21, стадия a) используют вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2 -дигидро-3H-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c) на стадии d, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,55 (1Н, с), 7,99 (1Н, д), 7,81 (2H, м), 7,54-7,31 (4H, м), 7,09 (1H, д), 4,66 (1Н, д), 4,43 (1Н, д), 4,27 (2H, м), 2,82 (1H, м), 2,21 (3H, с), 2,07-1,73 (6H, м), 1,24 (4H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 54,51, H 7,23, N 9,88%. C26H28 N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,9H2O. Вычислено: C 54,72, H 7,07, N 9,67%.

Пример 22. 3-{2-[5-Циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Стадия а. [5-Циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту получают проведением стадий a-d способа, используемого для получения [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d), за исключением того, что 2-бромциклопентилэтанон используют на стадии c вместо 1-бром-3,3-диметилбутан-2-она.

1H ЯМР (CDCl3) 11,00 (1Н, шир.с), 7,45 (2H, м), 7,25 (1H, м), 7,01 (1H, д), 4,56 (2H, д), 4,23 и 3,95 (2H, 2xд), 2,97 (1Н, м), 2,81 (1Н, м), 2,03-1,58 (13H, м), 1,30 (5H, м).

Стадия b. Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [5-циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 22, стадия a) используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,52 (1H, с), 8,02 (1Н, дд), 7,85 (1H, с), 7,81 (1H, д), 7,49 (2H, м), 7,41 (1H, т), 7,32 (1Н, т), 7,08 (1H, д), 4,69 (1Н, д), 4,46 (1H, д), 4,27 (2H, м), 2,96 (1Н, м), 2,81 (1H, м), 2,05-1,61 (13H, м), 1,29 (5H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 58,44, H 7,42, N 9,18%. C30H34N 4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,9H2O. Вычислено: C 58,43, H 7,27, N 9,21%.

Пример 23. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-[3-(2H-тетразол-5-ил)фенил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 5-(3-аминофенил)тетразол-2-илметиловый эфир 2,2-диметилпропионовой кислоты используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо 5-(3-{2-[5-циклопентил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)тетразол-2-илметилового эфира 2,2-диметилпропионовой кислоты (Пример 10, стадия a ), согласно способу Примера 10, стадия b.

1H ЯМР (CDCl3) 8,86 (1Н, с), 8,18 (1Н, м), 7,79 (1H, м), 7,46-7,24 (6H, м), 6,97 (1H, м), 4,73 (1H, д), 4,63 (1Н, д), 4,27 (1H, д), 4,22 (1H, д), 2,77 (1H, м), 1,97-1,68 (6H, м), 1,24-1,11 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 55,36, H 7,36, N 16,01%. C29 H34N8O 3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,5Н2O. Вычислено: C 55,23, H 7,21, N 16,10%.

Пример 24. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-м-толилацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что м-толуидин используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,19 (1H, с), 7,48 (2H, м), 7,46 (2H, м), 7,28 (2H, м), 7,15 (1H, д), 6,87 (1H, м), 4,72 (1Н, д), 4,65 (1Н, д), 4,28 (1H, д), 4,20 (1H, д), 2,80 (1H, м), 2,30 (3H, с), 1,76-1,70 (6H, м), 1,29-1,19 (13H, м).

Найдено: C 70,23, H 7,63, N 11,09%. C29H36N 4O3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,5H2O. Вычислено: C 69,99, H 7,49, N 11,26%.

Пример 25. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]-N-фенилацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что на стадии e используют анилин вместо метилового эфира 3-аминобензойной кислоты.

1H ЯМР (CDCl3) 8,20 (1H, с), 7,48-7,41 (5H, м), 7,38-7,27 (2H, м), 7,03 (2H, м), 4,70 (1H, д), 4,64 (1H, д), 4,32 (1Н, д), 4,18 (1H, д), 2,78 (1H, м), 2,00-1,53 (6H, м), 1,32-1,23 (13H, м).

Найдено: C 69,45, H 7,37, N 11,39%. C28H 34N4O3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,5H2O. Вычислено: C 69,54, H 7,29, N 11,58%.

Пример 26. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]-N-(3-метансульфониламинофенил)ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что N-(3-аминофенил)метансульфонамид используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,51 (1Н, с), 7,61 (1Н, с), 7,45 (2H, м), 7,29 (2H, м), 7,06 (4H, м), 4,75 (1Н, д), 4,62 (1Н, д), 4,26 (2H, м), 2,98 (3H, с), 2,79 (1H, м), 2,00-1,50 (6H, м), 1,32-1,23 (13H, м).

Найдено: C 56,14, H 6,86, N 10,97%. C29 H37N5O 5Sбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,0H2O. Вычислено: C 56,02, H 6,97, N 11,26%.

Пример 27. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-(3-пирролидин-1-илфенил)ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 3-пирролидин-1-илфениламин (полученный в две стадии из 3-нитроанилина) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl3) 8,01 (1H, с), 7,49 (2H, м), 7,24 (1H, м), 7,04 (2H, м), 6,72 (1H, с), 6,51 (1Н, д), 6,26 (1H, д), 4,69 (2H, м), 4,42 (1Н, д), 4,12 (1H, д), 3,25 (4H, м), 2,77 (1H, м), 2,00-1,69 (10H, м), 1,28-1,21 (13H, м).

Далее соединение охарактеризовывают в виде гидрохлоридной соли.

Найдено: C 57,06, H 6,38, N 10,59%. C32H41N 5O9бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 HCl. Вычислено: C 56,82, H 6,26, N 10,36%.

Пример 28. Метиловый эфир 4-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что на стадии e используют метиловый эфир 4-аминобензойной кислоты вместо метилового эфира 3-аминобензойной кислоты.

1H ЯМР (CDCl3) 8,57 (1H, с), 7,98 (2H, д), 7,50 (4H, м), 7,24 (1H, м), 7,03 (1H, д), 4,69 (1Н, д), 4,59 (1H, д), 4,22 (2H, м), 3,89 (3H, с), 2,79 (1H, м), 2,00-1,69 (6H, м), 1,28-1,21 (13H, м).

Найдено: C 66,21, H 6,98, N 10,42%. C30H36N 4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 5,0H2O. Вычислено: C 66,52, H 6,88, N 10,34%.

Пример 29. (3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир (3-аминофенил)уксусной кислоты используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,28 (1H, с), 7,48 (2H, м), 7,34-7,22 (4H, м), 7,00 (2H, м), 4,72 (1H, д), 4,64 (1Н, д), 4,28 (1H, д), 4,15 (1H, д), 3,48 (2H, с), 2,70 (1H, м), 1,79-1,36 (6H, м), 1,22-1,05 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 58,04, H 7,73, N 9,14%. C30H 36N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,0H2O. Вычислено: C 58,18, H 7,52, N 9,17%.

Пример 30. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-(3-метоксифенил)ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро -3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что м-анизидин используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,22 (1H, м), 7,45-7,30 (2H, м), 7,27 (1H, м), 7,20-7,12 (2H, м), 7,03 (1Н, д), 6,84 (1H, д), 6,63 (1H, д), 4,73 (1Н, д), 4,64 (1Н, д), 4,28 (1H, д), 4,19 (1H, д), 3,79 (3H, с), 2,80 (1H, м), 1,76-1,55 (6H, м), 1,36-1,24 (13H, м).

Найдено: C 68,01, H 7,48, N 11,01. C29H 36N4O4бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,5H2O. Вычислено: С 67,81, H 7,26, N 10,91%.

Пример 31. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]-N-п-толилацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что п-толуидин используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,11 (1Н, с), 7,47 (2H, м), 7,29-7,25 (2H, м), 7,08-7,00 (4H, м), 4,71 (1H, д), 4,64 (1H, д), 4,32 (1H, д), 4,16 (1H, д), 2,77 (1H, м), 2,29 (3H, с), 1,86-1,53 (6H, м), 1,33-1,21 (13H, м).

Найдено: C 71,49, H 7,54, N 11,25%. C 29H36N4O 3. Вычислено: С 71,28, H 7,43, N 11,47%.

Пример 32. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-(4-метоксифенил)ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что п-анизидин используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,11 (1H, м), 7,47 (2H, м), 7,32-7,24 (3H, м), 7,01 (1H, д), 6,82 (2H, м), 4,74 (1H, д), 4,60 (1Н, д), 4,31 (1Н, д), 4,16 (1Н, д), 3,77 (3Н, с), 2,78 (1Н, м), 2,03-1,71 (6Н, м), 1,36-1,13 (13Н, м).

Найдено: C 67,74, H 7,53, N 10,67%. C29H36N 4O4бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,5H2O. Вычислено: С 67,81, H 7,26, N 10,91%.

Пример 33. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]-N-(3-диметиламинофенил)ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что м-N,N-диметиламиноанилин используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,08 (1Н, с), 7,50 (2H, м), 7,28 (1H, м), 7,10 (2H, м), 6,88 (1H, м), 6,64 (1Н, м), 6,45 (1Н, м), 4,69 (1Н, д), 4,67 (1H, д), 4,36 (1H, д), 4,14 (1H, д), 2,95 (6H, м), 2,74 (1H, м), 2,00-1,71 (6H, м), 1,36-1,17 (13H, м).

Далее соединение охарактеризовывают как гидрохлоридную соль.

Найдено: C 61,26, H 7,58, N 11,82%. C30H 39N5O3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 HClбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,0H2O. Вычислено: С 61,05, H 7,51, N 11,86%.

Пример 34. (6-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}-2,3-дигидроиндол-1-ил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир (6-амино-2,3-дигидроиндол-1-ил)уксусной кислоты (полученный через две стадии из 6-нитро-2,3-дигидро-1 Н-индола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 12,40 (1H, шир.с), 9,38 (1H, с), 7,53 (2H, м), 7,18 (2H, м), 6,86 (1H, д), 6,65 (1H, д), 6,54 (1H, с), 4,78 (2H, м), 4,25 (1Н, д), 3,90 (1H, д), 3,78 (2H, с), 3,46 (2H, м), 2,84 (3H, м), 1,86-1,55 (6H, м), 1,25-1,17 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,11, H 7,64, N 9,87%. C32H39 N5O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,5H2O. Вычислено: С 56,30, H 7,63, N 10,10%.

Пример 35. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]-N-(4-фторфенил)ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметилоксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что на стадии e 4-фторанилин используют вместо метилового эфира 3-аминобензойной кислоты.

1H ЯМР (CDCl3) 8,31 (1H, с), 7,48-7,28 (5H, м), 6,96 (3H, м), 4,75 (1H, д), 4,55 (1H, д), 4,21 (2H, м), 2,74 (1Н, м), 1,90-1,65 (6H, м), 1,34-1,15 (13H, м).

Найдено: C 66,98, H 7,09, N 10,88%. C28H33FN 4O3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,5H2O. Вычислено: С 67,04, H 6,82, N 11,16%.

Пример 36. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-{4-[метил(2H-тетразол-5-ил)амино]фенил}ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 5-[(3-аминофенил)метиламино]тетразол-2-илметиловый эфир 2,2-диметилпропионовой кислоты (J.L. Castro et al., J. Med. Chem. (1996), 39, 842) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо 5-(3-{2-[5-циклопентил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро- 3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)тетразол-2-илметилового эфира 2,2-диметилпропионовой кислоты (Пример 10, стадия a ), согласно способу Примера 10, стадия b.

1H ЯМР (ДМСО-d6) 9,84 (1Н, с), 7,55-7,05 (8H, м), 4,78 (2H, м), 3,96 (1Н, м), 3,55 (1H, м), 3,39 (3H, с), 2,86 (1Н, м), 1,85-1,65 (6H, м), 1,33-1,10 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 57,86, H 7,31, N 18,31%. C30 H37N9O 3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5. Вычислено: С 57,94, H 7,10, N 18,26%.

Пример 37. N-(3-Цианофенил)-2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 3-аминобензонитрил используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,76 (1H, с), 7,83 (2H, м), 7,50-7,29 (5H, м), 7,02 (1H, м), 4,81 (1H, д), 4,48 (1H, д), 4,28 (1H, д), 4,14 (1H, д), 2,79 (1H, м), 1,91-1,65 (6H, м), 1,36-1,17 (13H, м).

Найдено: C 66,32, H 6,89, N 13,39%. C29 H33N5O 3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,5H2O. Вычислено: С 66,14, H 6,89, N 13,29%.

Пример 38. (3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенилсульфанил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что этиловый эфир (3-аминофенилсульфанил)уксусной кислоты (S. Hagishita et al., Bioorg. Med. Chem. (1997), 5, 1433) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), согласно способу Примера 1, стадия d.

1H ЯМР (ДМСО-d6) 12,60 (1H, шир.с), 9,81 (1H, с), 7,50 (3H, м), 7,27-7,21 (4H, м), 6,97 (1H, м), 4,78 (2H, м), 4,27 (1Н, д), 3,96 (1H, д), 3,72 (2H, с), 2,86 (1H, м), 1,83-1,65 (6H, м), 1,29-1,17 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 54,50, H 7,36, N 8,44%. С30 H36N4O 5Sбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,0H2O. Вычислено: С 54,59, H 7,30, N 8,60%.

Пример 39. 5-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазпин-3-ил]ацетиламино}изофталевая кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что диметиловый эфир 5-аминоизофталевой кислоты используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 10,19 (1Н, с), 8,33 (2H, с), 8,13 (1H, с), 7,53 (1H, д), 7,48 (1H, т), 7,23 (1Н, т), 7,16 (1Н, д), 4,80 (2H, шир.), 4,30 (1Н, шир.), 4,00 (1H, шир.), 2,85 (1H, м), 1,90-1,50 (6H, м), 1,45-1,13 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 54,69, H 7,11, N 8,70%. C30 H34N4O 7бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,0H2O. Вычислено: С 54,74, H 7,08, N 8,63%.

Пример 40. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-(3-метансульфониламинокарбонилфенил)ацетамид.

Метансульфонамид (96 мг, 1,00 ммоль) добавляют к раствору 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 2) (409 мг, 0,80 ммоль), EDC (207 мг, 1,08 ммоль) и DMAP (122 мг, 1,00 ммоль) в ДХМ (20 мл) при комнатной температуре. После перемешивания в течение 17 ч смесь промывают 5% KHSO 4 (50 мл), насыщенным раствором соли (50 мл) и сушат (MgSO 4). Фильтрование и выпаривание растворителя дает неочищенный продукт, который очищают колоночной флэш-хроматографией (MeOH-ДХМ (1:10)), получая указанное в заголовке соединение в виде белого кристаллического твердого вещества (392 мг, 83%).

1H ЯМР (ДМСО-d6) 9,99 (1Н, с), 8,02 (1H, с), 7,63-7,36 (5H, м), 7,23 (1H, т), 7,13 (1Н, д), 4,73 (2H, дд), 4,29 и 4,25 (2H, д×2), 3,24 (3H, с), 2,87 (1H, м), 1,80-1,48 (6H, м), 1,30-1,09 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 53,93, H 7,07, N 10,17%. C30 H37N5O 6Sбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,0H2O. Вычислено: C 53,74, H 7,07, N 10,16%.

Пример 41. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-(3-пропиламинофенил)ацетамид.

Стадия а. трет-Бутиловый эфир (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)пропилкарбаминовой кислоты получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что на стадии e трет-бутиловый эфир (3-аминофенил)пропилкарбаминовой кислоты (полученный проведением стадий b и c способа, используемого для получения трет-бутилового эфира (3-аминофенил)метилкарбаминовой кислоты (Пример 3, стадия c), за исключением того, что 1-бромпропан используют на стадии b вместо иодметана), используют вместо метилового эфира 3-аминобензойной кислоты.

Стадия b. 4,0 M HCl в диоксане (5 мл, 20,0 ммоль) добавляют к раствору трет-бутилового эфира (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)пропилкарбаминовой кислоты (Пример 41, стадия a) (524 мг, 0,83 ммоль) в диоксане (15 мл) при комнатной температуре. Смесь перемешивают в течение 2 ч, во время чего образуется белый осадок. Растворитель выпаривают и полученное твердое вещество промывают Et2 O, выделяют фильтрованием и сушат, получая гидрохлоридную соль указанного в заголовке соединения (430 мг, 91%).

1H ЯМР (CDCl3) 8,39 (1Н, с), 7,61-7,27 (7H, м), 7,01 (1H, д), 4,69 (2H, шир.с), 4,60 (1H, д), 4,29 (2H, дд), 3,21 (2H, шир.с), 2,80 (1H, шир.с), 2,01-1,45 (6H, м), 1,43-1,19 (15H, м), 0,95 (3H, т).

Найдено: C 63,68, H 7,65, N 11,98%. C31H41N 5O3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 HClбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 H2O. Вычислено: C 63,52, H 7,57, N 11,95%.

Пример 42. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1, 3,4-бензотриазепин-3-ил]-N-[3-(2-этоксиэтиламино)фенил)ацетамид.

Указанное в заголовке соединение получают в виде гидрохлоридной соли способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что на стадии e трет-бутиловый эфир (3-аминофенил)-2-этоксиэтилкарбаминовой кислоты (получают, используя способ, применяемый для получения трет-бутилового эфира (3-аминофенил)метилкарбаминовой кислоты (Пример 3, стадия c), за исключением того, что 2-бромэтилэтиловый эфир используют на стадии b вместо иодметана) используют вместо метилового эфира 3-аминобензойной кислоты, с последующей реакцией полученного продукта, вместо трет-бутилового эфира (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)пропилкарбаминовой кислоты (Пример 41, стадия a), согласно способу Примера 41, стадия b.

1H ЯМР (CDCl 3) 8,45 (1H, с), 7,61 (1H, с), 7,56-7,47 (2H, м), 7,36 (4H, м), 7,03 (1H, д), 4,70 (2H, дд), 4,26 (2H, дд), 3,73 (2H, шир.с), 3,51 (4H, м), 2,82 (1H, шир.с), 2,05-1,65 (6H, м), 1,30-1,17 (16H, м).

Найдено: C 63,90, H 7,66, N 11,58%. C 32H43N5O 4бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 HClбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,25H2O. Вычислено: C 63,77, H 7,44, N 11,62%.

Пример 43. 5-Циклогексил-1-(3,3-диметил-2-оксобутил)-3-(2-оксо-2-м-толилэтил)-1,3-дигидро-3H-1,3,4-бензотриазепин-2-он.

Стадия а. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-метокси-N-метилацетамид получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотразепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что на стадии e гидрохлорид N,O-диметилгидроксиламина и триэтиламин используют вместо метилового эфира 3-аминобензойной кислоты.

1H ЯМР (CDCl3) 7,86 (2H, м), 7,17 (1H, м), 6,94 (1Н, д), 4,70-4,14 (3H, м), 4,09 (1H, м), 3,68 (3H, с), 3,17 (3H, с), 2,72 (1Н, м), 1,93-1,55 (6H, м), 1,43-1,22 (13H, м).

Стадия b. 1,0M раствор м -толилмагнийхлорида в ТГФ (0,6 мл, 0,6 ммоль) добавляют по каплям к раствору 2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]-N-метокси-N-метилацетамида (Пример 43, стадия a) (220 мг, 0,5 ммоль) в Et 2O (10 мл) при -78°C. Реакционной смеси дают возможность нагреться до комнатной температуры и перемешивают на протяжении ночи. После концентрирования растворителя реакционную смесь экстрагируют Et2O, промывают насыщенным раствором NH 4Cl, насыщенным раствором соли и сушат (MgSO 4). Колоночная флэш-хроматография (EtOAc-гексан (1:4)) дает указанное в заголовке соединение в виде белого твердого вещества (36 мг, 15%).

1H ЯМР (CDCl 3) 7,69 (2H, м), 7,39-7,31 (4H, м), 7,26 (1Н, м), 6,95 (1H, дд), 5,20 (1H, м), 4,68 (3H, м), 2,79 (1H, м), 2,30 (3H, с), 1,80-1,62 (6H, м), 1,31-1,24 (13H, м).

Найдено: C 73,14, H 7,82, N 8,51%. C29H35 N3O3. Вычислено: С 73,54, H 7,45, N 8,87%.

Пример 44. 3-{5-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-илметил]-[1,3,4]оксадиазол-2-ил}бензойная кислота.

Стадия а. Метиловый эфир 3-(N'-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетил}гидразинокарбонил)бензойной кислоты получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что на стадии e метиловый эфир 3-гидразинокарбонилбензойной кислоты (полученный через две стадии из диметилового эфира изофталевой кислоты) используют вместо метилового эфира 3-аминобензойной кислоты.

Стадия b. Метиловый эфир 3-{5-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-илметил]-[1,3,4]оксадиазол-2-ил}бензойной кислоты. Раствор метилового эфира 3-(N'-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетил}гидразинокарбонил)бензойной кислоты (Пример 44, стадия a) (94 мг, 0,16 ммоль), трифенилфосфина (64 мг, 0,24 ммоль) и 1,8-диазабицикло[5.4.0]ундец-7-ена (75 мг, 0,49 ммоль) в CCl4-MeCN (1:1, 2 мл) перемешивают при комнатной температуре в течение 5 ч. Дополнительное количество трифенилфосфина (43 мг, 0,16 ммоль) добавляют спустя 3 ч. Растворитель выпаривают при пониженном давлении и остаток очищают колоночной флэш-хроматографией (EtOAc-гексан (1:1)), получая продукт в виде не совсем белого твердого вещества (52 мг, 57%).

1H ЯМР (CDCl 3) 8,62 (1H, с), 8,19 (2H, м), 7,56 (1H, т), 7,39-7,35 (2H, м), 7,19 (1H, т), 6,97 (1H, д), 5,05 (1H, шир.д), 4,85 (1Н, шир.д), 4,68 (2H, с), 3,96 (3H, с), 2,70 (1Н, м), 1,80-1,60 (6H, шир.), 1,25 (13H, м).

Стадия c. Указанное в заголовке соединение получают способом, используемым для получения 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 2), за исключением того, что метиловый эфир 3-{5-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-илметил]-[1,3,4]оксадиазол-2-ил}бензойной кислоты (Пример 44, стадия b) используют вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1).

1H ЯМР (CDCl 3) 8,69 (1H, с), 8,27 (2H, м), 7,61 (1Н, т), 7,42-7,38 (2H, м), 7,20 (1Н, т), 6,98 (1Н, д), 5,10 (1Н, шир.д), 4,90 (1H, шир.д), 4,70 (2H, с), 2,73 (1H, м), 1,90-1,60 (6H, м), 1,30-1,25 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,75, H 7,08, N 10,61%. C30H33N 5O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,5H2O. Вычислено: C 56,69, H 7,07, N 10,72%.

Пример 45. 3-({2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}метил)бензойная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир 3-аминометилбензойной кислоты используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,02 (1Н, д), 7,94 (1Н, с), 7,51 (1H, д), 7,45-7,35 (2H, м), 7,21 (1H, дд), 7,14 (1H, д), 6,93 (1Н, д), 6,75 (1Н, шир.т), 4,66-4,53 (3H, м), 4,38-4,19 (3H, м), 2,64 (1H, шир.м), 1,88-1,49 (6H, м), 1,31-1,20 (13H, м).

Далее соединение охарактеризовывают как соль N -метил-D-глюкамина.

Найдено: C 58,33, H 7,64, N 8,95%. C30H36N 4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,0H2O. Вычислено: С 58,18, H 7,52, N 9,17%.

Пример 46. N'-м-Толилгидразид [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]уксусной кислоты.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что мета-толилгидразин используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,12 (1Н, д), 7,43-7,41 (2H, м), 7,25 (1H, т), 7,09 (1Н, м), 6,99 (1Н, д), 6,70 (1H, д), 6,65-6,31 (2H, м), 6,01 (1Н, д), 4,71 (1Н, д), 4,63 (1H, д), 4,24 (2H, с), 2,80 (1H, м), 2,29 (3H, с), 2,10-1,60 (6H, м), 1,35-1,24 (13H, м).

Найдено: C 68,00, H 7,69, N 13,66%. C29 H37N5O 3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,5H2O. Вычислено: С 67,94, H 7,47, N 13,66%.

Пример 47. 5-Циклогексил-1-(3,3-диметил-2-оксобутил)-3-(5-оксо-4-м-толил-4,5-дигидро[1,3,4]оксадиазол-2-илметил)-1,3-дигидро-3H-1,3,4-бензотриазепин-2-он.

Раствор N'-м-толилгидразида [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 46) (300 мг, 0,60 ммоль), 1,1'-карбонилдиимидазола (483 мг, 2,98 ммоль) и триэтиламина (181 мг, 1,79 ммоль) в ТГФ (6 мл) перемешивают при комнатной температуре в течение 19 ч, затем нагревают при температуре кипения с обратным холодильником в течение 6 ч. Растворитель выпаривают при пониженном давлении и остаток очищают колоночной флэш-хроматографией (EtOAc-гексан (2:3-7:3)), получая указанное в заголовке соединение в виде не совсем белого твердого вещества (83 мг, 26%).

1H ЯМР (CDCl 3) 7,63-7,60 (2H, м), 7,41-7,37 (2H, м), 7,32 (1Н, м), 7,20 (1Н, т), 7,05 (1H, д), 6,96 (1H, д), 4,75 (1H, шир.д), 4,68 (2H, д), 4,55 (1H, шир.д), 2,75 (1Н, м), 2,38 (3H, с), 1,95-1,60 (6H, м), 1,35-1,20 (13H, м).

Найдено: C 67,93, H 6,78, N 13,23%. C30H35N 5O4. Вычислено: С 68,03, H 6,66, N 13,22%.

Пример 48. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-(3-гидроксиметилфенил)ацетамид.

Стадия а. Метиловый эфир 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензиловый эфир угольной кислоты получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир 3-аминобензиловый эфир угольной кислоты используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl3) 8,30 (1H, с), 7,51-7,39 (4H, м), 7,31-7,24 (2H, м), 5,11 (2H, с), 4,72 (1H, д), 4,64 (1H, д), 4,23 (1H, д), 4,14 (1H, д), 3,80 (3H, с), 2,89 (1H, м), 1,76-1,67 (6H, м), 1,29-1,24 (13H, м).

Стадия b. Метиловый эфир 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензиловый эфир угольной кислоты (Пример 48, стадия a) растворяют в смеси ТГФ-MeOH (1:1, 40 мл) и добавляют 1% раствор K2CO 3 (30 мл). Смесь перемешивают при комнатной температуре в течение 2 ч. После концентрирования органических растворителей образуется осадок, который собирают фильтрованием и сушат в вакууме, получая указанное в заголовке соединение в виде желтого твердого вещества (790 мг, 89%).

1H ЯМР (CDCl3) 8,31 (1Н, с), 7,51-7,45 (3H, м), 7,31-7,28 (3H, м), 7,26-7,10 (2H, м), 4,70 (1H, д), 4,67 (2H, с), 4,64 (1Н, д), 4,26 (1Н, д), 4,22 (1H, д), 2,89 (1H, м), 1,85-1,55 (6H, м), 1,30-1,24 (13H, м).

Найдено: C 67,70, H 7,40, N 10,79%. C29H 36N4O4бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,5H2O. Вычислено: C 67,81, H 7,26, N 10,91%.

Пример 49. N-(3-Карбамимидоилсульфанилметилфенил)-2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетамид.

Стадия а. N-(3-Хлорметилфенил)-2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетамид. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]-N-(3-гидроксиметилфенил)ацетамид (Пример 48) (750 мг, 1,49 ммоль) и полистирол-трифенилфосфиновую смолу (1,20 ммоль/г; 2,50 г, 3,00 ммоль) (P. Hodge, G. Richardson, J. C. S. Chem. Commun. (1983), 622) нагревают при температуре кипения с обратным холодильником в CCl4 (30 мл) в течение 3 ч. После фильтрования и выпаривания растворителя получают продукт в виде бледно-розового твердого вещества (220 мг, 29%).

1H ЯМР (CDCl 3) 8,36 (1Н, с), 7,50-7,28 (4H, м), 7,10-7,01 (4H, м), 4,75 (1H, д), 4,60 (1H, д), 4,54 (2H, с), 4,25 (1H, д), 4,22 (1Н, д), 2,79 (1Н, м), 2,05-1,62 (6H, м), 1,30-1,22 (13H, м).

Стадия b. N-(3-Хлорметилфенил)-2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетамид (Пример 49, стадия a) (52 мг, 0,10 ммоль) подвергают взаимодействию с тиомочевиной (7,6 мг, 0,1 ммоль) и NaI (2 мг) в ацетоне (10 мл) при кипячении с обратным холодильником в течение 3 ч. После охлаждения, растворители концентрируют в вакууме, получая указанное в заголовке соединение в виде желтого твердого вещества после растирания с Et2O (18 мг, 30%).

1H ЯМР (ДМСО-d6) 9,89 (1H, шир.с), 8,99 (3H, шир.с), 7,75-7,46 (3H, м), 7,29-7,04 (5H, м), 4,77 (2H, м), 4,40 (2H, м), 4,38 (1H, м), 3,93 (1H, м), 2,86 (1H, м), 1,73-1,64 (6H, м), 1,21-1,08 (13H, м).

Пример 50. Этиловый эфир (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензолсульфонил)уксусной кислоты.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что этиловый эфир (3-аминобензосульфонил)уксусной кислоты (полученный в одну стадию из этилового эфира (3-аминофенилсульфанил)уксусной кислоты) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), согласно способу Примера 1, стадия d.

1H ЯМР (ДМСО-d6) 13,08 (1H, шир.с), 10,26 (1Н, с), 8,16 (1H, с), 7,77-7,45 (5H, м), 7,26-7,25 (2H, м), 4,80 (2H, м), 4,39 (2H, с), 4,38 (1H, д), 3,98 (1Н, д), 2,86 (1H, м), 1,65-1,34 (6H, м), 1,25-1,13 (13Н, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 53,55, H 6,90, N 8,48%. C30H36N 4O7Sбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,0H2O. Вычислено: C 53,67, H 6,94, N 8,46%.

Пример 51. [трет-Бутоксикарбонил-(3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)амино]уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир [(3-аминофенил)- трет-бутоксикарбониламино]уксусной кислоты (полученный в три стадии из 1-изоцианато-3-нитробензола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 12,60 (1H, шир.с), 9,81 (1H, с), 7,52-7,47 (3H, м), 7,23-7,17 (4H, м), 6,89 (1Н, д), 4,78 (2H, м), 4,25 (1Н, д), 4,14 (2H, с), 3,92 (1H, д), 2,86 (1H, м), 1,86-1,51 (6H, м), 1,36-1,13 (22H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 55,18, H 7,90, N 9,20%. C35H 45N5O7бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 4,0H2O. Вычислено: C 55,12, H 7,71, N 9,18%.

Пример 52. (3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фениламино)уксусная кислота.

[трет-Бутоксикарбонил-(3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)амино]уксусную кислоту (Пример 51) (137 мг, 0,21 ммоль) перемешивают в трифторуксусной кислоте в течение 2 ч при комнатной температуре. После концентрирования полученную смолу растворяют в ДХМ, промывают насыщенным NaHCO 3 и затем 1N HCl. Органическую фазу сушат над MgSO 4, фильтруют и растворитель выпаривают, получая указанное в заголовке соединение в виде желтого твердого вещества (85 мг, 73%).

1H ЯМР (ДМСО-d 6) 9,47 (1H, с), 7,55-7,27 (2H, м), 7,23-7,15 (2H, м), 6,97 (1Н, т), 6,92-6,68 (2H, м), 6,25(1H, м), 5,80 (2H, шир.с), 4,78 (2H, м), 4,25 (1H, д), 3,95 (1H, д), 3,72 (2H, с), 2,80 (1Н, м), 1,86-1,51 (6H, м), 1,26-1,09 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 57,66, H 7,45, N 9,07%. C30H 36N4O6бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,5H2O. Вычислено: C 57,65, H 7,32, N 9,09%.

Пример 53. (3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенокси)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир (3-аминофенокси)уксусной кислоты используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 13,00 (1H, шир.с), 9,75 (1Н, с), 7,50 (2H, м), 7,26-7,13 (4H, м), 7,04 (1H, д), 6,55 (1Н, д), 4,78 (2H, с), 4,58 (2H, с), 4,27 (1H, д), 3,97 (1Н, д), 2,85 (1H, м), 1,90-1,20 (10H, м), 1,13 (9H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 57,66, H 7,45, N 9,07%. C30 H36N4O 6бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,5H2O. Вычислено: C 57,65, H 7,32, N 9,09%.

Пример 54. 3-{2-[5-Адамантан-1-ил-1-(3,3-диметил-2-оксобутил)2-оксо-1,2-дигидро- 3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что адамантан-1-ил-(2-аминофенил)метанон (A. Cappelli et al., J. Med. Chem. (1999), 42, 1556) используют на стадии a вместо (2-аминофенил)циклогексилметанона, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 13,0 (1H, шир.с), 9,89 (1Н, с), 8,14 (1H, с), 7,67 (1H, м), 7,59 (2H, д), 7,42 (2H, м), 7,21 (2H, м), 4,79 (2H, м), 4,29 (1H, д), 3,93 (1H, д), 2,04-1,66 (15H, м), 1,13 (9H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 59,82, H 7,66, N 8,67%. C33H 38N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,0H2O. Вычислено: С 59,91, H 7,41, N 8,73%.

Пример 55. 3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что (2-аминофенил)циклогептилметанон (полученный согласно способу A. Cappelli et al., J. Med. Chem. (1999), 42, 1556) используют на стадии a вместо (2-аминофенил)циклогексилметанона, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,49 (1H, с), 8,04 (1H, м), 7,87 (1H, м), 7,81 (1H, м), 7,50-7,26 (4H, м), 7,04 (1-H, д), 4,78 (1H, д), 4,60 (1H, д), 4,27 (2H, с), 3,00 (1H, м), 2,05-1,44 (12H, м), 1,25 (9H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 57,03, H 7,58, N 8,77%. C30H 36N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,5H2O. Вычислено: C 56,84, H 7,61, N 8,95%.

Пример 56. (3-{2-[5-Циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что на стадии e [5-циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 22, стадия a) и метиловый эфир (3-аминофенил)уксусной кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 9,20 (1H, шир.с), 8,29 (1H, с), 7,46 (2H, м), 7,36-7,19 (4H, м), 7,06 (1H, д), 6,99 (1H, д), 4,66 (1H, д), 4,46 (1H, д), 4,32 (1H, д), 4,17 (1H, д), 3,58 (2H, с), 2,93 (1Н, м), 2,78 (1H, м), 1,99-1,51 (13H, м), 1,27 (5H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 58,65, H 7,44, N 9,06%. C31H36 N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,1H2O. Вычислено: C 58,70, H 7,41, N 9,01%.

Пример 57. 2-[5-Циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-(3-метиламинофенил)ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [5-циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 22, стадия a) и трет-бутиловый эфир (3-аминофенил)метилкарбаминовой кислоты (Пример 3, стадия c) используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо трет-бутилового эфира (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)метилкарбаминовой кислоты (Пример 3, стадия d), согласно способу Примера 3, стадия e.

1H ЯМР (CDCl 3) 8,07 (1H, с), 7,47 (2H, м), 7,27 (1H, м), 7,04 (2H, м), 6,92 (1H, т), 6,44 (1Н, дд), 6,31 (1H, дд), 4,64 (1Н, д), 4,48 (1H, д), 4,36 (1H, д), 4,13 (1Н, д), 3,71 (1H, шир.с), 2,95 (1Н, м), 2,80 (4H, м), 2,05-1,56 (13H, м), 1,27 (5H, м).

Далее соединение охарактеризовывают в виде гидрохлоридной соли.

Найдено: C 64,90, H 7,02, N 12,57%. C30 H37N4O 3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 HCl. Вычислено: C 65,26, H 6,94, N 12,68%.

Пример 58. (3-{2-[5-Циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенилсульфанил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [5-циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 22, стадия a) и этиловый эфир (3-аминофенилсульфанил)уксусной кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), согласно способу Примера 1, стадия d.

1H ЯМР (CDCl3) 8,41 (1H, с), 7,45 (2H, м), 7,31-7,17 (4H, м), 7,08 (2H, м), 6,12 (1H, шир.с), 4,66 (1H, д), 4,21 (1Н, д), 4,23 (1H, д), 4,19 (1H, д), 3,65 (2H, с), 2,96 (1Н, м), 2,79 (1Н, м), 1,82-1,62 (13H, м), 1,29 (5H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 52,82, H 7,43, N 8,12%. C31H36N 4O5Sбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 5,0H2O. Вычислено: C 52,95, H 7,36, N 8,04%.

Пример 59. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]-N-[3-(5-оксо-2,5-дигидро[1,2,4]оксадиазол-3-ил)фенил]ацетамид.

Раствор [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) (200 мг, 0,5 ммоль), EDC (140 мг, 0,74 ммоль), HOBT (100 мг, 0,74 ммоль) и DMAP (20 мг) в ДМФА (10 мл) перемешивают при комнатной температуре в течение 2 ч. После этого добавляют раствор соли трифторуксусной кислоты 3-(3-аминофенил)-2Н -[1,2,4]оксадиазол-5-она (WO 93/19063) (170 мг, 0,58 ммоль) и триэтиламина (120 мкл, 1,00 ммоль) в ДМФА (2 мл) и реакционную смесь перемешивают в течение 16 ч. Смесь разбавляют EtOAc (20 мл) и органический слой промывают 5% водным KHSO 4, насыщенным раствором соли и сушат над MgSO 4. Фильтрование и выпаривание растворителя дает масло, которое очищают колоночной флэш-хроматографией (ацетон-ДХМ (1:6)), получая указанное в заголовке соединение в виде оранжевой пены (62 мг, 22%).

1H ЯМР (CDCl 3) 8,83 (1Н, с), 7,90 (1Н, м), 7,53-7,25 (7H, м), 7,02 (1H, д), 4,76 (1H, д), 4,57 (1H, д), 4,22 (1Н, д), 4,20 (1Н, д), 2,80 (1Н, м), 1,95-1,55 (6H, м), 1,28-1,20 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 55,99, H 7,15, N 12,14%. C30 H34N6O 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,0H2O. Вычислено: C 56,26, H 7,01, N 12,41%.

Пример 60. 3-(3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)акриловая кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир 3-(3-аминофенил)акриловой кислоты используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,43 (1H, с), 7,75-7,45 (5H, м), 7,35-7,23 (3H, м), 7,04 (1H, д), 6,42 (1Н, д), 4,76 (1H, д), 4,61 (1H, д), 4,27 (2H, м), 2,79 (1H, м), 2,01-1,65 (6H, м), 1,28-1,23 (13H, м).

Найдено: C 60,70, H 7,50, N 9,60%. C31H36N 4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,5H2O. Вычислено: C 60,49, H 7,26, N 9,35%.

Пример 61. 3-(3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)пропионовая кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир 3-(3-аминофенил)пропионовой кислоты (D.F. Biggs et al., J. Med. Chem. (1976), 19, 472) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 9,05 (1Н, шир.с), 8,35 (1H, с), 7,45 (2H, м), 7,31-7,18 (4H, м), 7,03 (1H, д), 6,92 (1H, д), 4,73 (1H, д), 4,63 (1H, д), 4,27 (1H, д), 4,20 (1H, д), 2,91 (2H, м), 2,79 (1H, м), 2,63 (2H, м), 1,90-1,35 (6H, м), 1,29-1,21 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 57,25, H 7,81, N 9,02%. C31H38 N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,0H2O. Вычислено: C 57,34, H 7,72, N 8,80%.

Пример 62. N-(3,5-бис-Гидроксиметилфенил)-2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир 3-амино-5-метоксикарбонилоксиметилбензилового эфира угольной кислоты используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензилового эфира угольной кислоты (Пример 48, стадия a), согласно способу Примера 48, стадия b.

1H ЯМР (CDCl3) 8,37 (1Н, с), 7,47 (2H, м), 7,30 (3H, м), 7,09 (1H, с), 7,02 (1H, д), 4,78-4,58 (6H, м), 4,23 (2H, м), 2,79 (1Н, м), 2,04-1,44 (8H, м), 1,26 (13H, м).

Найдено: C 64,88, H 7,45, N 10,15%. C30 H38N4O 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,2H2O. Вычислено: C 64,75, H 7,32, N 10,07%.

Пример 63. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]-N-пиридин-2-илацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 2-аминопиридин используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,83 (1H, с), 8,20-8,14 (2H, м), 7,62 (1H, т), 7,46-7,40 (2H, м), 7,25 (1Н, м), 6,98-6,93 (2H, м), 4,70 (1Н, д), 4,66 (1H, д), 4,30 (1Н, д), 4,20 (1Н, м), 2,78 (1H, м), 2,03-1,60 (6H, м), 1,38-1,22 (13H, м).

Далее соединение охарактеризовывают в виде гидрохлоридной соли.

Найдено: C 61,20, H 6,90, N 13,04%. C27H33N 5O3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 HClбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 H2O. Вычислено: C 61,18, H 6,85, N 13,21%.

Пример 64. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]-N-пиридин-3-илацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 3-аминопиридин используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,52 (1Н, шир.с), 8,36 (1H, д), 8,31-8,24 (2H, м), 7,48-7,44 (2H, м), 7,31-7,22 (2H, м), 7,02 (1H, д), 4,79 (1H, д), 4,56 (1H, д), 4,23 (2H, с), 2,80 (1H, шир.м), 2,01 (1H, шир.м), 1,87-1,62 (5H, м), 1,33-1,23 (13H, м).

Далее соединение охарактеризовывают в виде гидрохлоридной соли.

Найдено: C 60,81, H 7,01, N 12,93%. C27H33N 5O3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 HClбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 H2O. Вычислено: C 61,18, H 6,85, N 13,21%.

Пример 65. [Ацетил(3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)амино]уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир [ацетил(3-аминофенил)амино]уксусной кислоты (полученный в три стадии из 3-нитроанилина) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 13,00 (1H, шир.с), 10,01 (1Н, с), 7,50 (4H, м), 7,33 (1H, т), 7,23 (1H, м), 7,16 (1Н, д), 7,03 (1H, д), 4,79 (2H, с), 4,28 (1H, д), 4,17 (2H, с), 3,96 (1H, д), 2,86 (1H, м), 2,01 (1H, шир.м), 1,90-1,10 (10H, м), 1,76 (3H, с), 1,16 (9H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 55,77, H 7,44, N 9,81%. C32H39 N5O6бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,0H2O. Вычислено: C 55,83, H 7,49, N 10,02%.

Пример 66. N-(3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)сукцинаминовая кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир N-(3-аминофенил)сукцинаминовой кислоты (полученный в три стадии из 3-нитроанилина) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 12,00 (1H, шир.с), 9,91 (1H, с), 9,75 (1H, с), 7,88 (1H, с), 7,50 (2H, м), 7,25-7,13 (5H, м), 4,78 (2H, с), 4,25 (1H, д), 3,96 (1H, д), 2,86 (1Н, м), 2,48 (4H, с), 1,98-1,17 (10H, м), 1,13 (9H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 55,74, H 7,69, N 9,91%. C32 H39N5O 6бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,0H2O. Вычислено: C 55,84, H 7,49, N 10,02%.

Пример 67. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-[3-(1H-тетразол-5-илметил)фенил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 3-(1Н-тетразол-5-илметил)анилин используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,61 (1Н, с), 7,44 (4H, м), 7,27 (4H, м), 6,98 (2H, м), 4,70 (2H, кв.), 4,25 (2H, д), 2,80 (1Н, м), 2,04 (1H, шир.м), 1,84 (1Н, шир.д), 1,67 (6H, м), 1,28 (2H, м), 1,19 (9H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,69, H 7,43, N 16,08%. C30 H36N8O 3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,9H2O. Вычислено: С 56,57, H 7,43, N 16,77%.

Пример 68. 3-{2-[5-Циклогексил-1-(2-морфолин-4-ил-2-оксоэтил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Стадия а. Этиловый эфир (1-трет-бутоксикарбонилметил-5-циклогексил-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил)уксусной кислоты получают способом, используемым для получения этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро -3H-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), за исключением того, что трет-бутилбромацетат используют вместо 1-бром-3,3-диметилбутан-2-она.

1H ЯМР (CDCl3) 7,40 (2H, м), 7,18 (1H, дт), 7,10 (1Н, д), 4,51-4,10 (6H, м), 2,72 (1Н, м), 1,66 (6H, м), 1,45 (9H, с), 1,23 (7H, м).

Стадия b . (5-Циклогексил-3-этоксикарбонилметил-2-оксо-2,3-дигидро-3H-1,3,4-бензотриазепин-1-ил)уксусная кислота. Этиловый эфир (1-трет-бутоксикарбонилметил-5-циклогексил-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил)уксусной кислоты (Пример 68, стадия a) (860 мг, 1,94 ммоль) растворяют в трифторуксусной кислоте (5 мл) и смесь перемешивают при комнатной температуре в течение 2 ч. Трифторуксусную кислоту выпаривают, остаток растворяют в ДХМ (20 мл) и промывают H2O (20 мл×2). Органическую фазу отделяют и сушат над MgSO4 . Фильтрование и выпаривание растворителя дает продукт (630 мг, 84%).

1H ЯМР (CDCl 3) 9,50 (1H, шир.с), 7,43 (2H, м), 7,25 (1Н, м), 7,14 (1H, д), 4,40 (4H, м), 4,15 (2H, м), 2,73 (1H, м), 1,75 (6H, м), 1,24 (7H, м).

Стадия c. Этиловый эфир [5-Циклогексил-1-(2-морфолин-3-ил-2-оксоэтил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]уксусной кислоты получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1, стадия e), за исключением того, что (5-циклогексил-3-этоксикарбонилметил-2-оксо-2,3-дигидро-3 Н-1,3,4-бензотриазепин-1-ил)уксусную кислоту (Пример 68, стадия b) и морфолин используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно.

1H ЯМР (CDCl3) 7,40 (2H, м), 7,18 (2H, м), 4,51 (2H, шир.д), 4,26 (2H, шир.д), 4,14 (2H, м), 3,69-3,50 (8H, м), 2,74 (1H, м), 1,74 (6H, м), 1,24 (7H, м).

Стадия d. Указанное в заголовке соединение получают проведением стадий d и e способа, применяемого для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что этиловый эфир [5-циклогексил-1-(2-морфолин-3-ил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 68, стадия c) используют на стадии d вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,60 (1H, с), 8,09 (1H, дд), 7,90 (1H, т), 7,78 (1H, д), 7,52 (2H, м), 7,42-7,29 (2H, м), 7,20 (1Н, д), 4,64 (1H, д), 4,41 (1H, д), 4,26 (2H, м), 3,70 (6H, шир.с), 3,50 (2H, шир.с), 2,80 (1Н, м), 2,05-1,71 (6Н, м), 1,25 (4Н, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 55,33, H 7,19, N 10,70%. C29H33 N5O6бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,2H2O. Вычислено: C 55,22, H 7,01, N 10,73%.

Пример 69. (3-{2-[5-(4-трет-Бутилциклогексил)-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)уксусная кислота.

Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что (2-аминофенил)-(4-трет -бутилциклогексил)метанон (полученный из 1-бром-4-трет -бутилциклогексана (A.L.J. Beckwith et al., J. Chem. Soc. Perkin Trans. II (1983), 661) и 2-аминобензонитрила) используют на стадии a вместо (2-аминофенил)циклогексилметанона, и на стадии е заменяют метиловый эфир 3-аминобензойной кислоты метиловым эфиром (3-аминофенил)уксусной кислоты, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,28 (1H, с), 7,50-7,44 (2H, м), 7,33-7,21 (4H, м), 7,03-6,98 (2H, м), 4,76 (1H, д), 4,60 (1Н, д), 4,31 (1H, д), 4,17 (1H, д), 3,61 (2H, с), 2,71 (1H, м), 2,11-1,66 (5H, м), 1,34-1,24 (10H, м), 1,21-1,02 (3H, шир.м), 0,86 (9H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 58,81, H 8,24, N 8,49%. C34H44 N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,0H2O. Вычислено: С 58,76, H 8,06, N 8,36%.

Пример 70. (6-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}индол-1-ил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что этиловый эфир (6-аминоиндол-1-ил)уксусной кислоты (полученный в две стадии из 6-нитроиндола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), согласно способу Примера 1, стадия d.

1H ЯМР (CDCl3) 8,33 (1H, с), 7,92 (1H, с), 7,45 (3H, м), 7,28 (1H, м), 7,02 (2H, м), 6,58 (1H, дд), 6,47 (1H, т), 4,84 (2H, с), 4,68 (2H, м), 4,40 (1H, д), 4,18 (1H, д), 2,78 (1Н, м), 2,02-1,15 (19H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 58,25, H 7,41, N 10,61%. C32 H37N5O 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,0H2O. Вычислено: C 58,38, H 7,28, N 10,47%.

Пример 71. (3-{2-[5-Циклогексил-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензилсульфанил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир (3-аминобензилсульфанил)уксусной кислоты (полученный за две стадии из 3-бромметилнитробензола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,37 (1Н, с), 7,51-7,45 (2H, м), 7,31-7,20 (4H, м), 7,01 (1Н, д), 6,80 (1Н, шир.с), 4,79 (1H, д), 4,60 (1H, д), 4,31 (1H, д), 4,17 (1H, д), 3,78 (2H, с), 3,10 (2H, с), 2,79 (1H, м), 1,99-1,71 (6H, м), 1,29-1,19 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 52,84, H 7,53, N 8,10%. C31H38N 4O5Sбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 5,0H2O. Вычислено: C 52,82, H 7,58, N 8,10%.

Пример 72. 2-{5-Циклогексил-1-[2-(4-метилпиперазин-1-ил)-2-оксоэтил]-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил}-N-(3-метиламинофенил)ацетамид.

Стадия а. Этиловый эфир {5-циклогексил-1-[2-(4-метилпиперазин-1-ил)-2-оксоэтил]-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил}уксусной кислоты получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1, стадия e), за исключением того, что (5-циклогексил-3-этоксикарбонилметил-2-оксо-2,3-дигидро-3 Н-1,3,4-бензотриазепин-1-ил)уксусную кислоту (Пример 68, стадия b) и 1-метилпиперазин используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно.

1H ЯМР (CDCl3) 7,40 (2H, м), 7,19 (2H, м), 4,48 (2H, шир.д), 4,25-4,10 (4H, м), 3,59 (4H, шир.м), 2,77 (1Н, м), 2,60 (4H, м), 2,41 (3H, с), 1,72 (6H, м), 1,24 (7H, м).

Стадия b. {5-Циклогексил-1-[2-(4-метилпиперазин-1-ил)-2-оксоэтил]-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил}уксусную кислоту получают способом, используемым для получения [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d), за исключением того, что этиловый эфир {5-циклогексил-1-[2-(4-метилпиперазин-1-ил)-2-оксоэтил]-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил}уксусной кислоты (Пример 72, стадия a) используют вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c).

1H ЯМР (CDCl 3) 9,30 (1H, шир.с), 7,42 (2H, м), 7,21 (2H, м), 4,45 (2H, шир.с), 4,08-3,78 (6H, шир.м), 2,92 (4H, м), 2,76 (1H, м), 2,62 (3H, с), 1,98-1,44 (6H,м), 1,23 (4H, м).

Стадия c . Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1, стадия e), за исключением того, что {5-циклогексил-1-[2-(4-метилпиперазин-1-ил)-2-оксоэтил]-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил}уксусную кислоту (Пример 72, стадия b) и трет-бутиловый эфир (3-аминофенил)метилкарбаминовой кислоты (Пример 3, стадия c) используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, с последующей реакцией полученного продукта, вместо трет -бутилового эфира (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)метилкарбаминовой кислоты (Пример 3, стадия d), согласно способу Примера 3, стадия e.

1H ЯМР (CDCl 3) 8,12 (1Н, с), 7,46 (2H, м), 7,27 (2H, м), 7,03 (1H, т), 6,91 (1H, т), 6,46 (1Н, дд), 6,30 (1H, дд), 4,52 (2H, м), 4,37 (1H, д), 4,14 (1Н, д), 3,62 (2H, м), 3,49 (2H, м), 2,79 (5H, м), 2,40 (4H, м), 2,30 (3H, с), 2,00-1,75 (6H, м), 1,26 (4H, м).

Далее соединение охарактеризовывают как дигидрохлоридную соль.

Найдено: C 53,60, H 7,08, N, 14,50%. C 30H39N7O 3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,0HClбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,0H2O. Вычислено: C 53,54, H 7,05, N 14,57%.

Примеры 73 и 74.

Метиловый эфир 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}-5-метиламинобензойной кислоты получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир 3-амино-5-[метил(2,2,2-трифторацетил)амино]бензойной кислоты (полученный за четыре стадии из 3-амино-5-нитробензойной кислоты) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, и после реакции (полученного) продукта по способу Примера 2, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), два соединения разделяют хроматографически.

Пример 73. 3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}-5-метиламинобензойная кислота.

1H ЯМР (CDCl 3) 8,30 (1H, с), 7,52-7,46 (3H, м), 7,35-7,29 (1H, м), 7,05-6,92 (3H, м), 4,77 (1H, д, 17,7), 4,68 (1Н, д, 17,7), 4,36-4,12 (2H, м), 2,88-2,76 (4H, м), 1,88-1,69 (5H, м), 1,31-1,23 (14H, м).

Далее соединение охарактеризовывают как соль N -метил-D-глюкамина.

Найдено: C 56,60, H 7,65, N 10,44%. C30H37N 5O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,5H2O. Вычислено: C 56,40, H 7,55, N 10,67%.

Пример 74. Метиловый эфир 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}-5-метиламинобензойной кислоты.

1H ЯМР (CDCl 3) 8,31 (1H, с), 7,61-7,41 (3H, м), 7,33-7,27 (1Н, м), 7,04-6,92 (3H, м), 4,77-4,61 (2H, м), 4,33 (1Н, д, 13,2), 4,19 (1Н, д, 13,2), 3,88 (4H, шир.с), 2,86-2,76 (4H, м), 2,05-1,73 (5H, м), 1,31-1,19 (14H, м).

Найдено: C 65,98, H 7,25, N 12,20%. C31H39N 5O5. Вычислено: C 66,29, H 7,00, N 12,47%.

Пример 75. 2-(3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фениламино)пропионовая кислота.

Указанное в заголовке соединение получают в виде гидрохлоридной соли способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир 2-[(3-аминофенил)- трет-бутоксикарбониламино]пропионовой кислоты (полученный в две стадии из 3-нитро-N-трет-бутоксикарбониланилина) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо трет-бутилового эфира (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)пропилкарбаминовой кислоты (Пример 41, стадия a), согласно способу Примера 41, стадия b.

1H ЯМР (ДМСО-d 6) 9,53 (1H, с), 7,50 (2H, м), 7,25 (2H, м), 6,98 (2H, м), 6,73 (1H, д), 6,30 (1Н, д), 5,00 (3H, шир.с), 4,79 (2H, с), 4,25 (1Н, м), 3,91 (2H, м), 2,86 (1Н, м), 2,00-1,00 (10H, м), 1,33 (3H, д), 1,13 (9H, с).

Найдено: C 60,48, H 6,77, N 11,18%. C31H39N 5O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 HClбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 H2O. Вычислено: C 60,43, H 6,87, N 11,37%.

Пример 76. (R)-1-(3-{2-[5-Циклогексил-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)пирролидин-2-карбоновая кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир (R)-1-(3-аминофенил)пирролидин-2-карбоновой кислоты (полученный в три стадии из 3-нитроиодбензола и L-пролина) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 12,40 (1H, шир.с), 9,48 (1H, с), 7,50 (2H, м), 7,24 (2H, м), 7,01 (1H, т), 6,78 (1Н, д), 6,68 (1Н, с), 6,13 (1H, д), 4,78 (2H, с), 4,20 (1Н, д), 4,06 (1Н, д), 3,90 (1Н, д), 3,21 (2H, м), 2,90 (1Н, м), 2,20-1,20 (14H, м), 1,13 (9H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 60,09, H 7,50, N 10,41%. C33H41 N5O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 H2O. Вычислено: C 59,98, H 7,55, N 10,49%.

Пример 77. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]-N-[3-(1H-имидазол-4-ил)фенил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что трет-бутиловый эфир 4-(3-аминофенил)имидазол-1-карбоновой кислоты (полученный в три стадии из 2-бром-3'-нитроацетофенона) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо трет-бутилового эфира (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)метилкарбаминовой кислоты (Пример 3, стадия d), согласно способу Примера 3, стадия e.

1H ЯМР (CDCl 3) 8,35 (1Н, с), 7,82 (1Н, с), 7,68 (1H, с), 7,51-7,46 (3H, м), 7,33-7,19 (5H, м), 7,04 (1Н, д, 8,1), 4,78 (1Н, д, 17,1), 4,66 (1Н, д, 17,1), 4,35 (1H, д, 16,5), 4,22 (1H, д, 16,5), 2,80 (1Н, м), 2,05-1,62 (5H, м), 1,31-1,18 (14H, м).

Найдено: C 62,46, H 7,01, N 14,35%. C31H 36N6O3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,0H2O. Вычислено: С 62,61, H 7,12, N 14,13%.

Пример 78. Метиловый эфир 3-{2-[5-циклогексил-1-(2-гидрокси-3,3-диметилбутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}-5-метиламинобензойной кислоты.

Борогидрид натрия (5 мг, 0,13 ммоль) добавляют к охлаждаемому льдом раствору метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}-5-метиламинобензойной кислоты (Пример 74) (64 мг, 0,11 ммоль) в MeOH (2 мл). Реакционную смесь перемешивают при 0-5°C в течение 40 мин, затем при комнатной температуре в течение 2 ч. Добавляют 10 мл насыщенного раствора NH4Cl и продукт экстрагируют CHCl 3 (15 мл). Органическую фазу сушат (MgSO 4), фильтруют и фильтрат упаривают, получая указанное в заголовке соединение (60 мг, 97%).

1 H ЯМР (CDCl3) 8,10-8,79 (1H, м), 7,55 (2H, м), 7,36 (2H, м), 7,24 (1H, м), 6,95 (1Н, с), 6,70 (1Н, м), 4,46 (1Н, м), 4,29-4,04 (2H, м), 3,89 (4H, м), 3,82-3,60 (1H, м), 3,43-3,23 (1H, м), 2,81 (4H, м), 2,15-1,66 (7H, м), 1,33-1,24 (3H, м), 0,97 и 0,93 (9H, с×2).

Найдено: C 63,17, H 7,59, N 11,85%. C31H41 N5O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,5H2O. Вычислено: С 63,03, H 7,51, N 11,86%.

Пример 79. 3-{2-[5-Циклогексил-1-(2-циклогексил-2-оксоэтил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Стадия а. [5-Циклогексил-1-(2-циклогексил-2-оксоэтил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]уксусную кислоту получают проведением стадий a-d способа, используемого для получения [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d), за исключением того, что 2-бромциклогексилэтанон используют на стадии c вместо 1-бром-3,3-диметилбутан-2-она.

1H ЯМР (CDCl3) 7,45 (2H, м), 7,23 (1H, м), 7,01 (1H, д), 4,56 (2H, д), 4,25 (1H, д), 3,89 (1H, д), 2,82 (1Н, м), 2,47 (1Н, м), 2,08-1,61 (11H, м), 1,46-1,19 (9H, м).

Стадия b. Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [5-циклогексил-1-(2-циклогексил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 79, стадия a) используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,52 (1H, с), 8,03 (1H, д), 7,82 (2H, м), 7,49 (2H, м), 7,41 (1Н, т), 7,32 (1H, т), 7,06 (1H, д), 4,69 (1H, д), 4,47 (1H, д), 4,27 (2H, м), 2,81 (1Н, м), 2,48 (1Н, м), 2,05-1,69 (11Н, м), 1,48-1,23 (9H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 57,41, H 7,60, N 9,02%. C31 H36N4O 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,9H2O. Вычислено: C 57,59, H 7,48, N 8,84%.

Пример 80. (3-{2-[5-Циклогексил-1-(2-циклогексил-2-оксоэтил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [5-циклогексил-1-(2-циклогексил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 79, стадия a) и метиловый эфир (3-аминофенил)уксусной кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро -3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,27 (1H, с), 7,47 (2H, м), 7,27 (4H, м), 7,04 (1Н, д), 6,99 (1H, д), 4,64 (1Н, д), 4,46 (1Н, д), 4,31 (1Н, д), 4,17 (1H, д), 3,60 (2H, с), 2,78 (1H, м), 2,46 (1H, м), 2,04-1,66 (11H, м), 1,44-1,23 (9H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,73, H 7,67, N 8,65%. C32 H38N4O 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,9H2O. Вычислено: C 56,87, H 7,68, N 8,50%.

Пример 81. (3-{2-[1-(2-Циклогексил-2-оксоэтил)-2-оксо-5-пиридин-2-ил-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]фенил)уксусная кислота.

Стадия а. [1-(2-Циклопентил-2-оксоэтил)-2-оксо-5-пиридин-2-ил-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]уксусную кислоту получают проведением стадий a-d способа, используемого для получения [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d), за исключением того, что (2-аминофенил)пиридин-2-илметанон используют на стадии a вместо (2-аминофенил)циклогексилметанона и на стадии с 1-бром-3,3-диметилбутан-2-он заменяют 2-бром-1-циклопентилэтаноном.

Стадия b. Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [1-(2-циклопентил-2-оксоэтил)-2-оксо-5-пиридин-2-ил-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту и метиловый эфир (3-аминофенил)уксусной кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 12,20 (1H, шир.с), 9,99 (1H, с), 8,57 (1H, д), 7,91 (2H, м), 7,43 (4H, м), 7,20 (4H, м), 6,91 (1Н, д), 4,66 (2H, шир.с), 4,40 (2H, шир.м), 3,50 (2H, с), 3,00 (1H, м), 1,75-1,47 (8H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,91, H 6,61, N 10,65%. C30 H29N5O 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,5H2O. Вычислено: C 56,99, H 6,59, N 10,78%.

Пример 82. [3-(2-{5-Циклогексил-1-[2-(1-метилциклопентил)-2-оксоэтил]-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил}ацетиламино)фенил]уксусная кислота.

Стадия а. {5-Циклогексил-1-[2-(1-метилциклопентил)-2-оксоэтил]-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил}уксусную кислоту получают проведением стадий a-d способа, используемого для получения [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d), за исключением того, что 2-бром-1-(1-метилциклопентил)этанон используют на стадии c вместо 1-бром-3,3-диметилбутан-2-она.

1H ЯМР (CDCl3) 11,00 (1Н, шир.с), 7,45 (2H, м), 7,25 (1H, м), 6,99 (1H, д), 4,67 (2H, м), 4,24 (1Н, д), 3,86 (1H, д), 2,83 (1H, м), 2,17-1,22 (21H, м).

Стадия b. Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что {5-циклогексил-1-[2-(1-метилциклопентил)-2-оксоэтил]-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил}уксусную кислоту (Пример 82, стадия a) и метиловый эфир (3-аминофенил)уксусной кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,27 (1Н, с), 7,46 (2H, м), 7,35-7,20 (4H, м), 7,03 (1Н, д), 6,99 (1H, д), 4,75 (1Н, д), 4,58 (1H, д), 4,30 (1H, д), 4,18 (1H, д), 3,61 (2H, с), 2,78 (1Н, м), 2,15-1,23 (21H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,76, H 7,92, N 8,59%. C32H 38N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 4,0H2O. Вычислено: C 56,69, H 7,69, N 8,48%.

Пример 83. 3-({2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетил}метиламино)бензойная кислота.

Стадия а. Метиловый эфир 3-({2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетил}метиламино)бензойной кислоты. Метилтрифторметансульфонат (329 мг, 2,0 ммоль) добавляют по каплям к охлаждаемому льдом раствору 1,1'-карбонилдиимидазола (162 мг, 1,0 ммоль) в нитрометане (2 мл). Раствор перемешивают при этой температуре в течение 5 мин, затем добавляют к суспензии [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) (400 мг, 1,0 ммоль) в нитрометане (2 мл). Полученную суспензию перемешивают в течение 10 мин при комнатной температуре, затем добавляют раствор метилового эфира 3-метиламинобензойной кислоты (165 мг, 1,0 ммоль) в нитрометане (2 мл). Смесь перемешивают при комнатной температуре в течение 19 ч, разбавляют H 2O (30 мл) и экстрагируют EtOAc (15 мл × 3). Объединенные экстракты промывают H2О (15 мл × 2) и сушат (MgSO4). Фильтрование и выпаривание растворителя дает неочищенный продукт, который очищают колоночной флэш-хроматографией (EtOAc-гексан (4:1)), получая продукт в виде не совсем белого твердого вещества (330 мг, 60%).

1H ЯМР (CDCl3) 7,95 (1H, д), 7,85 (1H, с), 7,40-734 (4H, м), 7,14 (1Н, т), 6,88 (1Н, д), 4,65 (2H, шир.д), 4,25 (1H, шир.), 3,98 (1H, шир.), 3,94 (3H, с), 3,25 (3H, с), 2,75 (1H, шир.м), 2,00-1,60 (5H, м), 1,35-1,20 (14H, м).

Стадия b. Указанное в заголовке соединение получают способом, используемым для получения 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 2), за исключением того, что метиловый эфир 3-({2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетил}метиламино)бензойной кислоты (Пример 83, стадия a) используют вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1).

1H ЯМР (ДМСО-d 6) 13,10 (1Н, шир.), 7,85 (1Н, м), 7,79 (1H, с), 7,51-7,41 (4H, м), 7,21 (1H, т), 7,11 (1Н, д), 4,71 (2H, д), 4,15 (1Н, шир.), 3,70 (1Н, шир.), 3,12 (3H, с), 2,83 (1H, м), 1,85-1,00 (19H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 57,48, H 7,61, N 9,25%. C30H36N 4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,5H2O. Вычислено: С 57,50, H 7,56, N 9,06%.

Пример 84. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-(3-гидроксифенил)ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 3-аминофенол используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,31 (1Н, с), 7,68 (1Н, с), 7,30 (2H, м), 7,26 (1Н, м), 7,08 (2H, м), 6,60 (1Н, м), 6,57 (1Н, м), 6,41 (1Н, м), 4,72 (1Н, д), 4,65 (1H, д), 4,32 (1Н, д), 4,22 (1Н, д), 2,77 (1H, м), 1,98-1,69 (6H, м), 1,27-1,24 (13H, м).

Найдено: C 67,78, H 7,28, N 1,27%. C28H34 N4O4бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,4H2O. Вычислено: C 67,56, H 7,04, N 11,25%.

Пример 85. N-(3-Аминофенил)-2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (пример 1), за исключением того, что трет-бутиловый эфир (3-аминофенил)карбаминовой кислоты используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо трет-бутилового эфира (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)метилкарбаминовой кислоты (Пример 3, стадия d), согласно способу Примера 3, стадия e.

1H ЯМР (CDCl 3) 11,28 (1H, шир.с), 8,85 (1H, с), 7,69 (1H, с), 7,57-7,27 (6H, м), 7,04 (1H, м), 4,76 (1H, д), 4,63 (1Н, д), 4,21 (2H, м), 2,80 (1H, м), 2,18-1,35 (6H, м), 1,32-1,22 (13H, м).

Далее продукт охарактеризовывают как гидрохлоридную соль.

Найдено: C 59,71, H 7,33, N 12,48%. C28 H35N5O 3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 HClбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,0H2O. Вычислено: C 59,83, H 7,17, N 12,46%.

Пример 86. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-[3-(1H-тетразол-5-илметилсульфанил)фенил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро -3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 3-(1Н-тетразол-5-илметилсульфанил)анилин используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,82 (1Н, с), 7,72 (1Н, шир.с), 7,40 (3H, м), 7,27 (1H, м), 7,15 (1H, т), 6,96 (3Н, м), 4,70 (2Н, q), 4,41 (2Н, с), 4,24 (2Н, с), 2,82 (1Н, м), 2,1-1,6 (6Н, м), 1,28 (4H, м), 1,22 (9H, с).

Пример 87. 2-{5-Циклогексил-1-[2-(1-метилциклопентил)-2-оксоэтил]-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил}-N-[3-(5-оксо-2,5-дигидро[1,2,4]оксадиазол-3-ил)фенил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения 2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]-N-[3-(5-оксо-2,5-дигидро[1,2,4]оксадиазол-3-ил)фенил]ацетамида (Пример 59), за исключением того, что {5-циклогексил-1-[2-(1-метилциклопентил)-2-оксоэтил]-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил}уксусную кислоту (Пример 82, стадия a) используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d).

1H ЯМР (CDCl 3) 11,00 (1Н, шир.с), 8,84 (1H, с), 7,91 (1Н, с), 7,58 (2H, м), 7,44 (3H, м), 7,28 (1Н, т), 7,04 (1Н, д), 4,81 (1H, д), 4,55 (1H, д), 4,21 (2H, с), 2,80 (1H, м), 2,09-1,24 (21Н, м).

Далее соединение охарактеризовывают как соль N -метил-D-глюкамина.

Найдено: C 56,28, H 6,94, N 11,95%. C32H36N 6O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,8H2O. Вычислено: C 56,45, H 7,11, N 11,82%.

Пример 88. 3-(2-{5-Циклогексил-1-[2-(1-метилциклопентил)-2-оксоэтил]-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил}ацетиламино)бензойная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что {5-циклогексил-1-[2-(1-метилциклопентил)-2-оксоэтил]-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил}уксусную кислоту (Пример 82, стадия a) используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро -3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,51 (1H, с), 8,03 (1H, д), 7,87 (1H, с), 7,81 (1H, д), 7,53-7,27 (4H, м), 7,05 (1Н, д), 4,78 (1H, д), 4,57 (1H, д), 4,26 (2H, м), 2,81 (1Н, м), 2,16-1,23 (21H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 57,94, H 7,53, N 8,71%. C31H36 N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,8H2O. Вычислено: C 57,80, H 7,47, N 8,87%.

Пример 89. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-[3-(1H-имидазол-1-ил)фенил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 3-имидазол-1-илфениламин (полученный в две стадии из 1-фторнитробензола и имидазола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,57 (1H, с), 7,86 (1Н, с), 7,71 (1Н, т, 1,8), 7,52-7,28 (6H, м), 7,19 (1Н, с), 7,11-7,08 (1H, м), 7,04-7,01 (1Н, м), 4,84 (1Н, д, 17,7), 4,58 (1H, д, 17,7), 4,24-4,23 (2H, м), 2,83-2,77 (1H, м), 2,05-1,67 (6H, м), 1,38-1,19 (13H, м).

Найдено: C 68,06, H 6,75, N 15,09%. C31H 36N6O3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,4H2O. Вычислено: C 67,87, H 6,78, N 15,32%.

Пример 90. N-(3H-Бензимидазол-5-ил)-2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что трет-бутиловый эфир 6-аминобензимидазол-1-карбоновой кислоты (полученный в две стадии из 5(6)-нитробензимидазола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо трет-бутилового эфира (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)метилкарбаминовой кислоты (Пример 3, стадия d), согласно способу Примера 3, стадия e.

1H ЯМР (CDCl 3) 8,44 (1H, с), 8,24 (1H, шир.с), 7,98 (1H, с), 7,60-7,47 (3H, м), 7,32-7,27 (1H, м), 7,04 (1Н, д, 8,1), 6,84 (1H, шир.с), 4,77 (1Н, д, 18), 4,67 (1H, д, 18), 4,40 (1Н, д, 16,5), 4,25 (1Н, д, 16,5), 2,84-2,76 (1H, м), 2,05-1,65 (6H, м), 1,45-1,24 (13H, м).

Найдено: C 65,40, H 6,89, N 15,79%. C 29H34N6O 3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 H2O. Вычислено: С 65,39, H 6,81, N 15,78%.

Пример 91. 3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}-5-метилбензойная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир 3-амино-5-метилбензойной кислоты (полученный в три стадии из 4-бром-3-метилбензойной кислоты) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,44 (1H, с), 7,87 (1H, с), 7,62 (2H, м), 7,53-7,47 (2H, м), 7,34-7,28 (1H, м), 7,05 (1H, д, 8,1), 4,81-4,58 (2H, м), 4,26-4,19 (2H, м), 2,84-2,80 (1H, м), 2,39 (3H, с), 2,05-1,73 (6H, м), 1,41-1,19 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 58,77, H 7,70, N 9,33%. C30 H36N4O 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,5H2O. Вычислено: С 58,87, H 7,48, N 9,28%.

Пример 92. N-[3-(Ацетилметиламино)-5-метиламинофенил]-2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что N -(3-амино-5-метиламинофенил)- N-метилацетамид (полученный через четыре стадии из 3,5-дифторнитробензола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,29 (1H, с), 7,51-7,43 (2H, м), 7,30-7,24 (1Н, м), 7,03 (1H, д, 8,4), 6,92 (1H, с), 6,39 (1Н, с), 6,10 (1H, с), 4,79 (1H, д, 18), 4,62 (1Н, д, 18), 4,29 (1H, д, 16,5), 4,21 (1Н, д, 16,5), 3,21 (3H, с), 2,83-2,75 (4H, м), 2,04-1,67 (9H, м), 1,33-1,17 (13H, м).

Пример 93. 3-[2-(1-Карбоксиметил-5-циклогексил-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил)ацетиламино]бензойная кислота.

Стадия а. (1-трет-Бутоксикарбонилметил-5-циклогексил-2-оксо- 1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил)уксусную кислоту получают способом, используемым для получения [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d), за исключением того, что этиловый эфир (1-трет -бутоксикарбонилметил-5-циклогексил-2-оксо-1,2-дигидро-3Н -1,3,4-бензотриазепин-3-ил)уксусной кислоты (Пример 68, стадия a) используют вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c).

1H ЯМР (CDCl 3) 7,45 (2H, м), 7,27 (1Н, м), 7,14 (1H, д), 4,41-3,93 (4H, шир.м), 2,80 (1H, м), 2,02-1,45 (6H, м), 1,46 (9H, м), 1,21 (4H, м).

Стадия b. Метиловый эфир 3-[2-(1- трет-бутоксикарбонилметил-5-циклогексил-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил)ацетиламино]бензойной кислоты получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1, стадия e), за исключением того, что (1-трет -бутоксикарбонилметил-5-циклогексил-2-оксо-1,2-дигидро-3H -1,3,4-бензотриазепин-3-ил)уксусную кислоту используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d).

1H ЯМР (CDCl 3) 8,51 (1H, с), 7,89 (1H, д), 7,80 (1Н, т), 7,74 (1H, д), 7,50 (2H, м), 7,35 (2H, м), 7,18 (1H, д), 4,43-4,09 (4H, м), 3,91 (3H, с), 2,80 (1H, м), 2,05-1,60 (6H, м), 1,43 (9H, с), 1,24 (4H, м).

Стадия с. Указанное в заголовке соединение получают способом, используемым для получения (5-циклогексил-3-этоксикарбонилметил-2-оксо-2,3-дигидро-3 H-1,3,4-бензотриазепин-1-ил)уксусной кислоты (Пример 68, стадия b), за исключением того, что метиловый эфир 3-[2-(1- трет-бутоксикарбонилметил-5-циклогексил-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил)ацетиламино]бензойной кислоты (Пример 93, стадия b) используют вместо этилового эфира (1-трет-бутоксикарбонилметил-5-циклогексил-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил)уксусной кислоты (Пример 68, стадия a), с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 9,15 (2H, шир.с), 8,84 (1H, с), 8,03 (1H, д), 7,73 (1Н, с), 7,67 (1H, д), 7,48 (2H, м), 7,30 (2H, м), 7,14 (1H, д), 4,62 (1H, д), 4,29 (3H, м), 2,81 (1H, м), 2,07-1,74 (6H, м), 1,27 (4H, м).

Далее соединение охарактеризовывают как соль бис(N-метил-D-глюкамина.

Найдено: C 50,94, H 7,29, N 8,05%. C25 H26N4O 6бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 С14H34N 2O10бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,0H2Oбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,2C4H8O 2. Вычислено: C 51,05, H 7,41, N 8,16%.

Пример 94. (6-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензимидазол-1-ил)уксусная кислота.

Указанное в заголовке соединение получают в виде гидрохлоридной соли способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что трет-бутиловый эфир (5-аминобензимидазол-1-ил)уксусной кислоты (полученный в две стадии из 5(6)-нитробензимидазола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо этилового эфира (1-трет -бутоксикарбонилметил-5-циклогексил-2-оксо-1,2-дигидро-3Н -1,3,4-бензотриазепин-3-ил)уксусной кислоты (Пример 68, стадия a), согласно способу Примера 68, стадия b.

1H ЯМР (ДМСО-d6) 10,27-10,23 (1Н, шир.с), 9,23 и 9,10 (1Н, с), 8,19 (1Н, с), 7,77-7,73 (1Н, м), 7,55-7,40 (3H, м), 7,26-7,15 (2H, м), 5,40 и 5,32 (2H, м), 4,79 (2H, с), 4,41 (1Н, шир.д, 15), 3,99 (1H, шир.д, 15), 2,87 (1H, м), 1,83-1,65 (6H, м), 1,30-1,06 (13H, м).

Найдено: C 61,13, H 6,08, N 13,77%. C31H 36N6O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 HCl. Вычислено: C 61,13, H 6,12, N 13,77%.

Пример 95. 3-[2-(1-трет-Бутоксикарбонилметил-5-циклогексил-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил)ацетиламино]бензойная кислота.

Указанное в заголовке соединение получают способом, используемым для получения 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 2), за исключением того, что метиловый эфир 3-[2-(1- трет-бутоксикарбонилметил-5-циклогексил-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил)ацетиламино]бензойной кислоты (Пример 93, стадия b) используют вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1).

1H ЯМР (CDCl 3) 8,53 (1Н, с), 8,02 (1Н, д), 7,81 (2H, м), 7,50 (2H, м), 7,37 (2H, м), 7,18 (1Н, д), 4,45-4,12 (4H, м), 2,81 (1Н, м), 2,05-1,65 (6H, м), 1,44 (9H, с), 1,27 (4H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,81, H 7,01, N 8,72%. C29 H34N4O 6бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,5H2Oбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,3C4H8O 2. Вычислено: С 57,04, H 7,26, N 8,94%.

Пример 96. [(3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)метиламино]уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир [(3-аминофенил)метиламино]уксусной кислоты (полученный через три стадии из саркозина и 3-нитроиодбензола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро -3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 12,40 (1H, шир.с), 9,47 (1H, с), 7,50 (2H, м), 7,20 (2H, м), 7,02 (1H, т), 6,80 (2H, м), 6,33 (1H, м), 4,78 (2H, с), 4,25-3,75 (2H, м), 4,00 (2H, с) 2,91 (3H, с), 2,90 (1H, м), 2,00-1,16 (10H, м), 1,13 (9H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 58,95, H 7,81, N 10,76%. C31H39N 6O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 H2O. Вычислено: 58,90, H 7,55, N 10,85%.

Пример 97. [4-(3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)имидазол-1-ил]уксусная кислота.

Указанное в заголовке соединение получают в виде гидрохлоридной соли способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро -3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что трет-бутиловый эфир [4-(3-аминофенил)имидазол-1-ил]уксусной кислоты (полученный в три стадии из 2-бром-3'-нитроацетофенона) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо этилового эфира (1-трет-бутоксикарбонилметил-5-циклогексил-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил)уксусной кислоты (Пример 68, стадия a) согласно способу Примера 68, стадия b .

1H ЯМР (ДМСО-d6 -D2O) 10,02 (1Н, с), 8,89 и 8,79 (1H, с), 8,04 (1Н, с), 7,95 и 7,91 (1H, с), 7,53-7,34 (5H, м), 7,26-7,12 (2H, м), 5,14 и 5,08 (2H, с), 4,76-4,74 (2H, м), 4,31 (1H, м), 4,01-3,96 (1H, м), 2,87-2,84 (1H, м), 1,82-1,64 (6H, м), 1,32-1,04 (13H, м).

Найдено: C 59,97, H 6,48, N 12,22%. C 33H38N6O 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,6HClбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,5C4H8O 2. Вычислено: C 59,96, H 6,27, N 11,99%.

Пример 98. 3-[2-(Карбамоилметил-5-циклогексил-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил)ацетиламино]бензойная кислота.

Стадия а. Этиловый эфир (1-карбамоилметил-5-циклогексил-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил)уксусной кислоты. К раствору (5-циклогексил-3-этоксикарбонилметил-2-оксо-2,3-дигидро-3 H-1,3,4-бензотриазепин-1-ил)уксусной кислоты (Пример 68, стадия b) (200 мг, 0,52 ммоль) в смеси ДМФА-ТГФ (1:1, 10 мл) добавляют EDC (150 мг, 0,77 ммоль), HOBt (100 мг, 0,77 ммоль) и DMAP (20 мг). Раствор перемешивают при комнатной температуре в течение 1 ч и затем через реакционную смесь барботируют аммиак в течение 5 мин. Реакционную смесь перемешивают при комнатной температуре в течение 16 ч, добавляют Н2 O (30 мл) и смесь экстрагируют EtOAc (20 мл × 2). Экстракты промывают насыщенным раствором соли, сушат (MgSO 4) и растворитель выпаривают. Остаток очищают колоночной флэш-хроматографией (ДХМ-EtOAc (1:1)), получая продукт (141 мг, 71%).

1H ЯМР (300 MГц, CDCl 3) 7,41 (2H, м), 7,22 (2H, м), 6,61 (1H, шир.с), 5,66 (1Н, шир.с), 4,31-4,11 (6H, м), 2,75 (1H, м), 1,75 (6H, м), 1,23 (7H, м).

Стадия b. Указанное в заголовке соединение получают проведением стадий d и e способа, используемого для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1, стадия e), за исключением того, что этиловый эфир (1-карбамоилметил-5-циклогексил-2-оксо-1,2-дигидро-3Н -1,3,4-бензотриазепин-3-ил)уксусной кислоты (Пример 98, стадия a) используют на стадии d вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 12,88 (1H, шир.с), 11,12 (1Н, с), 9,97 (1H, с), 8,19 (1H, с), 7,80 (1Н, д), 7,61 (1Н, д), 7,55 (1Н, м), 7,45 (1H, м), 7,25 (1Н, дд), 5,60 (1H, м), 4,27 (2H, м), 3,80 (2H, м), 2,15 (1H, м), 1,67-0,87 (9H, м).

Далее соединение охарактеризовывают как соль N -метил-D-глюкамина.

Найдено: C 55,13, H 6,93, N 11,11%. C25H27N 5O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,3H2Oбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,7C4H8O 2. Вычислено: C 55,16, H 6,94, N 11,09%.

Пример 99. (6-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-1,2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}индазол-1-ил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир (6-аминоиндазол-1-ил)уксусной кислоты (полученный в две стадии из 6-нитроиндазола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 13,0 (1H, шир.с), 9,97 (1H, с), 7,95-7,94 (2H, м), 7,66-7,46 (3H, м), 7,27-7,03 (3H, м), 5,11 (2H, с), 4,80-4,79 (2H, м), 4,34 (1H, м), 4,03 (1Н, м), 2,88-2,84 (1Н, м), 1,90-1,65 (6H, м), 1,34-1,08 (13H, м).

Пример 100. (3-{2-[5-Циклогексил-1-(2-циклогексил-2-оксоэтил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенилсульфанил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [5-циклогексил-1-(2-циклогексил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 79, стадия a) и этиловый эфир (3-аминофенилсульфанил)уксусной кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии е, с последующей реакцией полученного продукта, вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), согласно способу Примера 1, стадия d.

1H ЯМР (CDCl3) 8,44 (1H, с), 7,45 (3H, м), 7,38 (1H, д), 7,24 (2H, м), 7,11 (1H, д), 7,05 (1H, д), 6,70 (1H, шир.с), 4,70 (1H, д), 4,44 (1H, д), 4,21 (2H, м), 3,66 (2H, с), 2,80 (1H, м), 2,47 (1H, м), 2,18-1,66 (11H, м), 1,44-1,22 (9H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,91, H 6,96, N 8,36%. C32H38 N4O5Sбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,0H2O. Вычислено: C 56,99, H 7,24, N 8,52%.

Пример 101. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]-N-(2-метиламинофенил)ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что N-метилбензол-1,2-диамин (полученный в две стадии из 2-фторнитробензола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl3) 8,26 (1H, с), 7,48-7,41 (2H, м), 7,35-7,32 (1H, м), 7,26-7,20 (1H, м), 7,17-7,11 (1Н, м), 7,00 (1H, д), 6,74-6,68 (2H, м), 4,78 (1H, д), 4,60 (1H, д), 4,20-4,19 (3H, м), 2,84-2,76 (4H, м), 2,07-1,71 (6H, м), 1,44-1,02 (13H, м).

Найдено: C 66,60, H 7,02, N 13,15%. C29H37 N5O3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,3СН2Cl2. Вычислено: C 66,51, H 7,16, N 13,24%.

Пример 102. 3-{2-[1-(3,3-Диметил-2-оксобутил)-5-(4-метилциклогексил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что (2-аминофенил)-(4-метилциклогексил)метанон (полученный из 4-метилциклогексанола путем бромирования, используя пентабромид фосфора (A.L.J. Beckwith et al.: J. Chem. Soc. Perkin Trans. II, 1983, 661), и реакцией соответствующего реактива Гриньяра с 2-аминобензонитрилом (J.A. Robl, Synthesis., 1991, 56-58)) используют на стадии a вместо (2-аминофенил)циклогексилметанона, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,51 (1H, шир.с), 8,02 (1Н, д), 7,85-7,79 (2H, м), 7,53-7,29 (4H, м), 7,03 (1H, д), 4,78 (1H, д), 4,60 (1Н, д), 4,30 (1Н, д), 4,22 (1H, д), 2,75 (1H, м), 2,00 (1Н, шир.м), 1,90-1,65 (4H, шир.м), 1,50-1,20 (11H, м), 1,10-0,85 (5H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 59,10, H 7,20, N 9,07%. C30H36 N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 H2O. Вычислено: C 59,58, H 7,43, N 9,39%.

Пример 103. (3-{2-[1-(3,3-Диметил-2-оксобутил)-5-(4-метилциклогексил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)уксусная кислота.

Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что (2-аминофенил)-(4-метилциклогексил)метанон используют на стадии a вместо (2-аминофенил)циклогексилметанона, и метиловый эфир 3-аминобензойной кислоты заменяют метиловым эфиром (3-аминофенил)уксусной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,27 (1H, шир.), 7,47-7,44 (2H, м), 7,33-7,23 (4H, м), 7,03-6,98 (2H, м), 4,75 (1Н, д), 4,61 (1H, д), 4,31 (1H, д), 4,17 (1H, д), 3,60 (2H, с), 2,70 (1H, м), 2,00 (1Н, шир.), 1,85-1,65 (4H, м), 1,45-1,25 (2H, м), 1,23 (9H, с), 1,05-0,80 (5H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 59,28, H 7,36, N 8,90%. C31H38 N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,5H2O. Вычислено: С 59,36, H 7,60, N 9,11%.

Пример 104. N-(3,5-бис-Метиламинофенил)-2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетамид.

Указанное в заголовке соединение получают в виде тригидрохлоридной соли способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что трет-бутиловый эфир (3-амино-5-метиламинофенил)метилкарбаминовой кислоты (полученный за четыре стадии из 3,5-дифторнитробензола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо трет -бутилового эфира (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)пропилкарбаминовой кислоты (Пример 41, стадия a) согласно способу Примера 41, стадия b.

1H ЯМР (ДМСО-d 6) 9,83 (1H, шир.с), 7,55-7,45 (2Н, м), 7,26-7,14 (2Н, м), 6,79 (2Н, шир.с), 6,26 (1Н, с), 4,77 (2H, с), 4,31-4,26 (1Н, м), 3,96-3,91 (1Н, м), 3,65 (4H, шир.с), 2,86 (1H, м), 2,72 (6H, м), 1,84-1,64 (6H, м), 1,34-1,10 (13H, м).

Найдено: C 55,92, H 6,79, N 12,84%. C30H40 N6O3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,0HCl. Вычислено: C 56,11, H 6,75, N 13,09%.

Пример 105. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-(4-метокси-3-метиламинофенил)ацетамид.

Указанное в заголовке соединение получают в виде гидрохлоридной соли способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что трет-бутиловый эфир (5-амино-2-метоксифенил)метилкарбаминовой кислоты (полученный в две стадии из 2-метокси-5-нитрофенилизоцианата) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо трет-бутилового эфира (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)пропилкарбаминовой кислоты (Пример 41, стадия a), согласно способу Примера 41, стадия b.

1H ЯМР (CDCl 3) 11,00-10,00 (1H, шир.с), 8,16-8,12 (1H, м), 7,61-7,27 (5H, м), 7,02-6,89 (2H, м), 4,74-4,68 (2H, м), 4,37 (1Н, д, 16,8), 4,18 (1H, д), 3,90 (3H, с), 2,99 (3H, с), 2,84 (1H, м), 2,05-1,70 (6H, м), 1,36-1,12 (13H, м).

Найдено: C 61,98, H 7,12, N 11,65%. C30H39N 5O4бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,4HCl. Вычислено: C 61,66, H 6,97, N 11,99%.

Пример 106. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-(6-гидроксиметилпиридин-2-ил)ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-({2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетил}метиламино)бензойной кислоты (Пример 83, стадия a), за исключением того, что (6-аминопиридин-2-ил)метанол (полученный из метилового эфира 6-аминопиридин-2-карбоновой кислоты (T.R. Kelly et al. J. Org. Chem. (1996), 61, 4633) реакцией с литийалюминийгидридом) используют вместо метилового эфира 3-аминобензойной кислоты.

1H ЯМР (CDCl 3) 7,38-7,33 (3H, м), 7,16 (1H, т), 6,93 (1H, д), 6,59 (1H, д), 6,39 (1Н, д), 5,04 (2H, с), 4,67 (2H, с), 4,45 (1H, шир.), 4,40 (2H, шир.), 4,30 (1H, шир.), 2,70 (1Н, м), 1,90-1,55 (7H, м), 1,40-1,15 (12H, м).

Найдено: C 66,28, H 7,03, N 13,60%. C28H35N 5O4. Вычислено: С 66,51, H 6,98, N 13,85%.

Пример 107. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]-N-[3-(2-метилтиазол-4-ил)фенил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 3-(2-метилтиазол-4-ил)фениламин (полученный в две стадии из 2-бром-3'-нитроацетофенона) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,38 (1H, шир.с), 7,85 (1H, д), 7,62-7,59 (1Н, м), 7,50-7,46 (3H, м), 7,35-7,27 (3H, м), 7,04-7,01 (1H, м), 4,77 (1H, д), 4,67 (1H, д), 4,35 (1H, д), 4,22 (1H, д), 2,84-2,78 (4H, м), 2,05-1,71 (6H, м), 1,31-1,22 (13H, м).

Найдено: C 66,74, H 6,49, N 12,05%. C32H37 N5O3Sбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,3H2O. Вычислено: C 66,62, H 6,57, N 12,14%.

Пример 108. 4-(3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)тиазол-2-карбоновая кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что этиловый эфир 4-(3-аминофенил)тиазол-2-карбоновой кислоты (полученный в две стадии из 2-бром-3'-нитроацетофенона) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), согласно способу Примера 1, стадия d.

1H ЯМР (CDCl3) 8,49 (1Н, шир.с), 8,09-8,07 (1H, м), 7,89 (1H, с), 7,63-7,61 (1H, м), 7,56-7,46 (3H, м), 7,40-7,28 (2H, м), 7,05 (1Н, d, 7,8), 4,82 (1Н, д), 4,62 (1H, д), 4,33-4,20 (2H, м), 2,81-2,77 (1Н, м), 2,05-1,69 (6H, м), 1,44-1,16 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,05, H 6,47, N 9,82%. C32H 35N5O5Sбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,0H2O. Вычислено: C 56,24, H 6,78, N 10,09%.

Пример 109. (3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}-2-оксо-2Н-пиридин-1-ил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что этиловый эфир (3-амино-2-оксо-2 Н-пиридин-1-ил)уксусной кислоты (полученный в две стадии из 3-нитро-1Н-пиридин-2-она) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 9,04 (1H, с), 8,50 (1Н, дд), 7,48-7,41 (2H, м), 7,25 (1Н, м), 6,99-6,96 (2H, м), 6,37 (1Н, т), 4,70-4,60 (4H, м), 4,46 (1H, д), 4,15 (1H, д), 2,75 (1H, м), 2,00-1,65 (6H, м), 1,40-1,23 (14H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 55,03, H 6,91, N 10,29%. C29 H35N5O 6бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,5H2O. Вычислено: С 54,74, H 7,27, N 10,64%.

Пример 110. (3-{2-[5-Циклогексил-1-(4-гидрокси-3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)уксусная кислота.

Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 4-бром-2,2-диметил-3-оксобутиловый эфир бензойной кислоты (полученный через четыре стадии из этилового эфира 2,2-диметил-3-оксомасляной кислоты) используют на стадии c вместо 1-бром-3,3-диметилбутан-2-она, и метиловый эфир 3-аминобензойной кислоты заменяют метиловым эфиром (3-аминофенил)уксусной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 12,20 (1H, шир.с), 9,75 (1Н, с), 7,55-7,11 (7H, м), 6,90 (1H, д), 4,90 (1H, шир.с), 4,79 (2H, с), 4,30-3,90 (2H, м), 3,48 (4H, с), 2,82 (1Н, м), 2,00-1,10 (10H, м), 1,05 (6H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,88, H 7,22, N 8,66%. C30H36 N4O6бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,0H2O. Вычислено: C 56,98, H 7,36, N 8,98%.

Пример 111. 2-[5-Циклогексил-1-(2-циклогексил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-[3-(5-оксо-2,5-дигидро[1,2,4]оксадиазол-3-ил)фенил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения 2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]-N-[3-(5-оксо-2,5-дигидро[1,2,4]оксадиазол-3-ил)фенил]ацетамида (Пример 59), за исключением того, что [5-циклогексил-1-(2-циклогексил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 79, стадия a) используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d).

1H ЯМР (CDCl 3) 10,9 (1H, шир.с), 8,82 (1H, с), 7,85 (1H, с), 7,60 (2H, м), 7,45 (3H, м), 7,28 (1H, т), 7,04 (1H, д), 4,73 (1H, д), 4,45 (1Н, д), 4,20 (2H, с), 2,80 (1H, м), 2,47 (1Н, м), 2,01-1,64 (11H, м), 1,47-1,17 (9H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,12, H 6,88, N 11,10%. C32H36 N6O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,8H2Oбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,4C4H8O 2. Вычислено: C 56,34, H 7,20, N 11,33%.

Пример 112. 3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-8-метил-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что (2-амино-4-метилфенил)циклогексилметанон используют на стадии a вместо (2-аминофенил)циклогексилметанона, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,54 (1H, с), 8,05 (1H, д), 7,82 (1Н, с), 7,79 (1H, д), 7,40 (2H, м), 7,11 (1Н, д), 6,82 (1H, с), 4,65 (2H, кв.), 4,25 (2H, кв.), 2,78 (1H, м), 2,41 (3H, с), 2,00 (1H, шир.м), 1,75 (4H, м), 1,31 (5H, м), 1,24 (9H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 58,49, H 7,20, N 8,34%. C30H36N 4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,3H2Oбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,6C4H8O 2. Вычислено: С 58,85, H 7,57, N 8,71%.

Пример 113. 3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-6-фтор-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что (2-амино-6-фторфенил)циклогексилметанон используют на стадии a вместо (2-аминофенил)циклогексилметанона, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,60 (1H, с), 8,07 (1H, д), 7,98 (1Н, с), 7,82 (1H, д), 7,42 (2H, м), 7,02 (1H, т), 6,81 (1H, д), 4,81 (1Н, д), 4,56 (1Н, д), 4,25 (2H, кв.), 2,91 (1Н, м), 2,10 (1H, шир.м), 1,9-1,6 (4H, м), 1,28 (5H, м), 1,29 (9H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,33, H 7,07, N 8,60%. C29H33FN 4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,9H2Oбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,5C4H8O 2. Вычислено: С 56,34, H 7,19, N 8,64%.

Пример 114. 3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-6-метил-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что (2-амино-6-метилфенил)циклогексилметанон используют на стадии a вместо (2-аминофенил)циклогексилметанона, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,41 (1H, с), 8,11 (1H, д), 7,82 (1H, д), 7,75 (1H, с), 7,39 (2H, м), 7,17 (1H, д), 6,86 (1H, д), 4,76 (1H, д), 4,57 (1Н, д), 4,37 (1H, д), 4,21 (1Н, д), 2,66 (1H, м), 2,40 (3H, с), 2,00 (1H, шир.м), 1,75 (5H, м), 1,27 (4H, м), 1,26 (9H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 57,70, H 7,27, N 8,30%. C30H36 N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,5H2Oбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,6C4H8O 2. Вычислено: С 57,85, H 7,62, N 8,65%.

Пример 115. 2-[5-Циклогексил-2-оксо-1-(пирролидин-1-карбонил)-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-м-толилацетамид.

Стадия а. Этиловый эфир [5-циклогексил-2-оксо-1-(пирролидин-1-карбонил)-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]уксусной кислоты. Смесь этилового эфира (1-хлоркарбонил-5-циклогексил-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил)уксусной кислоты (Пример 1, второстепенный продукт стадии b) (391 мг, 1,0 ммоль) и пирролидина (156 мг, 2,2 ммоль) в ДХМ (5 мл) перемешивают при комнатной температуре в течение 30 мин. Раствор промывают разбавленной HCl, сушат (MgSO 4) и растворитель выпаривают при пониженном давлении, получая продукт в виде белого твердого вещества (417 мг, 98%).

1H ЯМР (CDCl3) 8,12 (1H, д), 7,50 (1H, т), 7,39-7,31 (2H, м), 4,31 (2H, с), 4,16 (2H, кв.), 3,45 (4H, м), 2,81 (1H, м), 1,92-1,27 (14H, м), 1,22 (3H, т).

Стадия b. [5-Циклогексил-2-оксо-1-(пирролидин-1-карбонил)-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]уксусную кислоту получают способом, используемым для получения [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d), за исключением того, что этиловый эфир [5-циклогексил-2-оксо-1-(пирролидин-1-карбонил)-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 115, стадия a) используют вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c).

1H ЯМР (CDCl 3) 8,11 (1H, д), 7,50 (1H, т), 7,42-7,33 (2H, м), 4,26 (2H, с), 3,42 (4H, м), 2,85 (1H, м), 1,91-1,19 (10H, м).

Стадия c. Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1, стадия e), за исключением того, что [5-циклогексил-2-оксо-1-(пирролидин-1-карбонил)-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 115, стадия b) и м-толуидин используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно.

1H ЯМР (CDCl3) 8,12 (1H, д), 8,10 (1H, шир.с), 7,59 (1H, т), 7,43 (2H, м), 7,16 (2H, м), 7,07 (1H, д), 6,88 (1H, д), 4,34 (2H, с), 3,45-3,35 (4H, м), 2,88 (1H, м), 2,31 (3H, с), 2,00-1,31 (14Н, м).

Найдено: C 68,00, H 6,73, N 14,07%. C28 H33N5O 3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,5H2O. Вычислено: C 67,72, H 6,90, N 14,10%.

Пример 116. (7-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}-3,4-дигидро-1H-изохинолин-2-ил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что этиловый эфир (7-амино-3,4-дигидро-1 H-изохинолин-2-ил)уксусной кислоты используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), согласно способу Примера 1, стадия d.

1H ЯМР (ДМСО-d6) 9,90 (1H, шир.с), 7,54-7,42 (3H, м), 7,28-7,11 (4H, м), 4,78 (2H, м), 4,33 (2H, м), 4,09 (2H, м), 3,39 (3H, м), 3,00 (3H, м), 1,65-1,21 (6H, м), 1,12-1,04 (13H, м).

Далее продукт охарактеризовывают в виде гидрохлоридной соли.

Найдено: C 47,05, H 5,34, N 7,72%. C33H 41N5O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 HClбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,4CH2Cl2. Вычислено: С 47,14, H 5,48, N 7,55%.

Пример 117. (5-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}индол-1-ил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что этиловый эфир (5-аминоиндол-1-ил)уксусной кислоты (полученный в две стадии из 5-нитроиндола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), согласно способу Примера 1, стадия d.

1H ЯМР (CDCl3) 8,21 (1H, с), 7,70 (1H, с), 7,47 (2H, м), 7,27 (1H, м), 7,05 (4H, м), 6,47 (1H, д), 4,79 (2H, с), 4,68 (2H, м), 4,39 (1Н, д), 4,20 (1H, д), 2,78 (1H, м), 2,18-1,07 (19H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 58,02, H 7,08, N 9,62%. C32H 37N5O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,9H2Oбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,6C4H8O 2. Вычислено: C 58,23, H 7,39, N 9,84%.

Пример 118. (5-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}индазол-1-ил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир (5-аминоиндазол-1-ил)уксусной кислоты (полученный в две стадии из 5-нитроиндазола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,43 (1Н, с), 8,05 (1Н, с), 7,52-7,45 (2H, м), 7,32-7,23 (3H, м), 7,04 (1H, д, 8,1), 5,12 (2H, с), 4,82 (1Н, д, 17,4), 4,61 (1H, д, 17,4), 4,27-4,26 (2H, м), 2,79 (1H, м), 2,05-1,72 (6H, м), 1,48-1,19 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,75, H 6,90, N 11,81%. C31 H36N6O 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,3H2O. Вычислено: C 56,46, H 7,17, N 12,13%.

Пример 119. (3-{2-[5-Циклогексил-1-(2-циклопропил-2-оксоэтил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)уксусная кислота.

Стадия а. [5-Циклогексил-1-(2-циклопропил-2-оксоэтил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]уксусную кислоту получают проведением стадий a-d способа, используемого для получения [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d), за исключением того, что 2-бром-1-циклопропилэтанон используют на стадии c вместо 1-бром-3,3-диметилбутан-2-она.

1H ЯМР (CDCl3) 10,80 (1Н, шир.с), 7,46 (2H, м), 7,27 (1H, м), 7,04 (1H, д), 4,66 (2H, м), 4,28 (1H, д), 3,93 (1Н, д), 2,85 (1H, м), 1,99-0,92 (15H, м).

Стадия b. Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1, стадия e), за исключением того, что [5-циклогексил-1-(2-циклопропил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 119, стадия a) и метиловый эфир (3-аминофенил)уксусной кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 10,80 (1H, шир.с), 8,30 (1H, с), 7,46 (2H, м), 7,26 (4H, м), 7,08 (1Н, д), 6,98 (1Н, д), 4,78 (1H, д), 4,57 (1H, д), 4,32 (1H, д), 4,18 (1H, д), 3,59 (2H, с), 2,78 (1H, м), 2,17-1,68 (7H, м), 1,24 (4H, м), 1,08 (2H, м), 0,93 (2H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 58,57, H 7,22, N 8,57%. C29H32 N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,2H2Oбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,9C4H8O 2. Вычислено: C 58,52, H 7,27, N 8,62%.

Пример 120. (3-{2-[5-Циклогексил-1-(2-циклопропил-2-оксоэтил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенилсульфанил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [5-циклогексил-1-(2-циклопропил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 119, стадия a) и этиловый эфир (3-аминофенилсульфанил)уксусной кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), согласно способу Примера 1, стадия d.

1H ЯМР (CDCl3) 8,90 (1H, шир.с), 8,44 (1H, с), 7,49 (3H, м), 7,29 (2H, м), 7,19 (1H, т), 7,08 (2H, т), 4,81 (1Н, д), 4,56 (1H, д), 4,22 (2H, м), 3,65 (2H, с), 2,79 (1H, м), 2,01-1,68 (7H, м), 1,26 (4H, м), 1,09 (2H, м), 0,93 (2H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 55,42, H 6,74, N 8,42%. C29H32 N4O5Sбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,8H2Oбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,4C4H8О 2. Вычислено: C 55,65, H 6,93, N 8,63%.

Пример 121. 2-[5-Циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-[3-(5-оксо-2,5-дигидро[1,2,4]оксадиазол-3-ил)фенил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения 2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]-N-[3-(5-оксо-2,5-дигидро[1,2,4]оксадиазол-3-ил)фенил]ацетамида (Пример 59), за исключением того, что [5-циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 22, стадия a) используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d).

1H ЯМР (CDCl 3) 10,80 (1H, шир.с), 8,85 (1H, с), 7,85 (1H, с), 7,59 (2H, м), 7,43 (3H, м), 7,28 (1H, т), 7,05 (1H, д), 4,73 (1Н, д), 4,45 (1H, д), 4,22 (2H, с), 2,93 (1H, м), 2,80 (1H, м), 2,18-1,59 (13H, м), 1,28 (5H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 57,52, H 6,80, N 12,01%. C31H34 N6O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,7H2O. Вычислено: C 57,25, H 6,89, N 12,30%.

Пример 122. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-[3-(5-метил[1,3,4]оксадиазол-2-ил)фенил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 3-(5-метил[1,3,4]оксадиазол-2-ил)фениламин (полученный в три стадии из 3-нитробензойной кислоты) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,57 (1H, с), 8,04 (1H, с), 7,78-7,70 (2H, м), 7,50-7,30 (4H, м), 7,02 (1H, м), 4,80-4,56 (2H, м), 4,25 (2H, с), 2,81 (1H, м), 2,61 (3H, с), 2,00-1,27 (10H, м), 1,24 (9H, с).

Найдено: C 66,70, H 6,71, N 14,98%. C31 H36N6O 4. Вычислено: C 66,89, H 6,52, N 15,10%.

Пример 123. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-(3-морфолин-4-илфенил)ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 3-морфолин-4-илфениламин (полученный в две стадии из 3-фтор-1-нитробензола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,22 (1H, шир.с), 7,50-7,44 (2H, м), 7,29-7,12 (3H, м), 7,03 (1H, д, 8,1), 6,75 (1Н, д, 8,1), 6,63-6,60 (1H, м), 4,77 (1H, д, 17,7), 4,65 (1H, д, 17,7), 4,34 (1H, д, 16,8), 4,19 (1H, д, 16,8), 3,84 (4H, т, 4,8), 3,15 (4H, т, 4,8), 2,82-2,75 (1H, м), 2,05-1,74 (6H, м), 1,36-1,24 (13H, м).

Найдено: C 68,18, H 7,42, N 12,29%. C32H 41N5O4бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,3H2O. Вычислено: C 68,10, H 7,42, N 12,41%.

Пример 124. 2-[5-Циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]-N-{3-[метил(2H-тетразол-5-ил)амино]фенил}ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [5-циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 22, стадия a) и 5-[(3-аминофенил)метиламино]тетразол-2-илметиловый эфир 2,2-диметилпропионовой кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо 5-(3-{2-[5-циклопентил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)тетразол-2-илметилового эфира 2,2-диметилпропионовой кислоты (Пример 10, стадия a ), согласно способу Примера 10, стадия b.

1H ЯМР (ДМСО-d6) 9,85 (1H, с), 7,56-7,48 (3H, м), 7,30-7,20 (3H, м), 7,15 (1H, д), 7,06 (1H, д), 7,00 (1H, шир.м), 6,65 (1H, шир.м), 4,65 (2H, шир.м), 4,25 (1Н, шир.д), 3,95 (1Н, шир.д), 3,40 (3H, с), 3,05-2,85 (2H, м), 1,90-1,40 (9H, м), 1,40-0,95 (9H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,42, H 7,05, N 16,27%. C31H37 N9O3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,5CH3CO2H. Вычислено: С 56,67, H 6,96, N 16,12%.

Пример 125. 2-[5-Циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]-N-[3-(2Н-тетразол-5-ил)фенил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [5-циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 22, стадия a) и 5-(3-аминофенил)тетразол-2-илметиловый эфир 2,2-диметилпропионовой кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо 5-(3-{2-[5-циклопентил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)тетразол-2-илметилового эфира 2,2-диметилпропионовой кислоты (Пример 10, стадия a ), согласно способу Примера 10, стадия b.

1H ЯМР (ДМСО-d6) 10,11 (1H, с), 8,36 (1H, с), 7,68-7,46 (5H, м), 7,22 (1H, м), 7,16 (1H, д), 6,95 (1H, шир.), 6,65 (1Н, шир.), 4,64 (2H, м шир.), 4,35 (1H, м шир.), 4,00 (1H, м шир.), 3,00-2,80 (2H, м), 1,95-1,45 (9H, м), 1,40-1,00 (9H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,11, H 7,00, N 14,82%. C30H34N 8O3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,8CH3CO2Hбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,2CH3OH. Вычислено: С 56,43, H 7,31, N 14,52%.

Пример 126. (6-{2-[5-Циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}индол-1-ил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [5-циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 22, стадия a) и этиловый эфир (6-аминоиндол-1-ил)уксусной кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), согласно способу Примера 1, стадия d.

1H ЯМР (ДМСО-d6) 9,65 (1H, с), 7,67 (1Н, с), 7,58-7,47 (2H, м), 7,39 (1H, д), 7,28-7,15 (3H, м), 6,97 (1H, д), 6,31 (1Н, д), 4,75-4,55 (4H, м), 4,30 (1H, шир.д), 3,95 (1H, шир.д), 3,00-2,88 (2H, м), 1,98-1,40 (14H, м), 1,35-1,10 (4H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 58,53, H 6,80, N 10,01%. C33H37 N5O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,0H2O. Вычислено: С 58,95, H 7,17, N 10,31%.

Пример 127. (4-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}индол-1-ил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что этиловый эфир (4-аминоиндол-1-ил)уксусной кислоты (полученный в две стадии из 4-нитроиндола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), согласно способу Примера 1, стадия d.

1H ЯМР (CDCl3) 8,47 (1Н, с), 7,84 (1H, д), 7,47 (2H, м), 7,27 (1Н, м), 7,15 (1H, т), 7,05 (1H, д), 6,96 (1Н, д), 6,87 (1Н, т), 5,69 (1Н, д), 4,75 (4H, м), 4,57 (1H, д), 4,25 (1H, д), 2,79 (1Н, м), 1,99-1,09 (19H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 58,46, H 7,08, N 9,78%. C32H37N 5O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,6H2Oбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,5C4H8O 2. Вычислено: C 58,64, H 7,35, N 10,01%.

Пример 128. 3-(3-{2-[5-Циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)пропионовая кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [5-циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 22, стадия a) и метиловый эфир 3-(3-аминофенил)пропионовой кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,28 (1Н, с), 7,47 (2H, м), 7,32-7,16 (4H, м), 7,07 (1Н, д), 6,92 (1Н, д), 4,67 (1Н, д), 4,45 (1H, д), 4,32 (1Н, д), 4,18 (1Н, д), 2,95 (3H, м), 2,80 (1H, м), 2,66 (2H, м), 1,84-1,57 (14H, м), 1,30 (4H, м).

Далее соединение охарактеризовывают как соль N -метил-D-глюкамина.

Найдено: C 59,30, H 7,18, N 8,70%. C32H38N 4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,8H2O. Вычислено: C 59,63, H 7,51, N 8,91%.

Пример 129. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]-N-[3-(4-метилпиперазин-1-ил)фенил]ацетамил.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 3-(4-метилпиперазин-1-ил)фениламин (полученный в две стадии из 3-фтор-1-нитробензола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,17 (1Н, шир.с), 7,50-7,44 (2H, м), 7,29-7,27 (1H, м), 7,16-7,09 (2H, м), 7,04 (1Н, д, 8,1), 6,78-6,75 (1H, м), 6,64-6,61 (1H, м), 4,76-4,60 (2H, м), 4,36-4,12 (2H, м), 3,21-3,18 (4H, м), 2,82-2,74 (1H, м), 2,57-2,54 (4H, м), 2,35 (3H, с), 2,04-1,60 (6H, м), 1,45-1,23 (13H, м).

Найдено: C 68,32, H 7,55, N 14,16%. C33H44 N6O3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,5H2O. Вычислено: C 68,19, H 7,79, N 14,46%.

Пример 130. (4-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}индазол-1-ил)уксусная кислота.

Стадия а. трет-Бутиловый эфир (4-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}индазол-1-ил)уксусной кислоты получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что трет-бутиловый эфир (4-аминоиндазол-1-ил)уксусной кислоты (полученный в две стадии из 4-нитроиндазола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

Стадия b. трет-Бутиловый эфир (4-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}индазол-1-ил)уксусной кислоты (Пример 130, стадия a) (522 мг, 0,82 ммоль) растворяют в трифторуксусной кислоте (5 мл) и раствор перемешивают при комнатной температуре в течение 2 ч. Растворитель выпаривают и полученное твердое вещество промывают Et2 O, выделяют фильтрованием и сушат, получая трифторацетатную соль указанного в заголовке соединение (430 мг, 91%).

1H ЯМР (CDCl3) 8,98 (1H, с), 8,00-7,86 (3H, шир.м), 7,57-7,29 (5H, м), 7,10-7,05 (2H, м), 5,21 (2H, с), 4,77-4,62 (2H, м), 4,47-4,30 (2H, м), 2,80-2,76 (1Н, м), 2,02-1,61 (6H, м), 1,30-1,16 (13H, м).

Найдено: C 57,90, H 5,54, N 12,51%. C31H36 N6O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 CF3CO2H. Вычислено: C 57,72, H 5,43, N 12,24%.

Пример 131. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-[1-(1H-тетразол-5-илметил)-1Н-индол-6-ил]ацетамид

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 5-(6-аминоиндол-1-илметил)тетразол-1-илметиловый эфир 2,2-диметилпропионовой кислоты (полученный через четыре стадии из 6-нитроиндола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо 5-(3-{2-[5-циклопентил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)тетразол-2-илметилового эфира 2,2-диметилпропионовой кислоты (Пример 10, стадия a ), согласно способу Примера 10, стадия b.

1H ЯМР (CDCl3) 8,66 (1H, с), 7,87 (1H, с), 7,38 (3H, м), 7,24 (1H, м), 7,14 (1Н, д), 6,93 (1Н, д), 6,66 (1H, д), 6,45 (1H, д), 5,39 (2H, с), 4,60 (2H, кв.), 4,13 (2H, кв.), 2,78 (1H, м), 2,00 (1H, м), 1,70 (5H, м), 1,25 (4H, м), 1,15 (9H, с).

Пример 132. (3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-6-метил-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)уксусная кислота.

Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что (2-амино-6-метилфенил)циклогексилметанон используют на стадии a вместо (2-аминофенил)циклогексилметанона, и метиловый эфир 3-аминобензойной кислоты заменяют метиловым эфиром (3-аминофенил)уксусной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,22 (1H, с), 7,31 (4H, м), 7,10 (1H, д), 7,00 (1H, д), 6,84 (1H, д), 4,73 (1Н, д), 4,56 (1H, д), 4,34 (1H, д), 4,16 (1H, д), 3,61 (2H, с), 2,63 (1Н, м), 2,35 (3H, с), 2,00 (1Н, шир.м), 1,75 (5H, м), 1,24 (13H, м).

Пример 133. [3-(2-{5-Циклогексил-1-[2-(1-метилциклогексил)-2-оксоэтил]-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил}ацетиламино)фенил]уксусная кислота.

Стадия а. {5-Циклогексил-1-[2-(1-метилциклогексил)-2-оксоэтил]-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил}уксусную кислоту получают проведением стадий a-d способа, используемого для получения [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d), за исключением того, что 2-бром-1-(1-метилциклогексил)этанон (полученный из 1-метилциклогексанкарбоновой кислоты в две стадии) используют на стадии c вместо 1-бром-3,3-диметилбутан-2-она.

1H ЯМР (CDCl3) 10,80 (1Н, шир.с), 7,45 (2H, м), 7,24 (1H, т), 6,96 (1Н, д), 4,67 (2H, м), 4,22 (1Н, д), 3,90 (1H, д), 2,82 (1Н, м), 2,01-1,17 (23H, м).

Стадия b. Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что {5-циклогексил-1-[2-(1-метилциклогексил)-2-оксоэтил]-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил}уксусную кислоту (Пример 133, стадия a) и метиловый эфир (3-аминофенил)уксусной кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,28 (1H, с), 7,47 (2H, м), 7,37-7,20 (4H, м), 7,00 (2H, т), 4,66 (2H, м), 4,25 (2H, м), 3,60 (2H, с), 2,78 (1Н, м), 2,18-1,23 (20H, м), 1,19 (3H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 60,87, H 7,66, N 8,38%. C33H40N 4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,9H2Oбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,6C4H8O 2. Вычислено: C 60,84, H 7,66, N 8,37%.

Пример 134. [3-(2-{5-Циклогексил-1-[2-(1-метилциклогексил)-2-оксоэтил]-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил}ацетиламино)фенилсульфанил]уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что {5-циклогексил-1-[2-(1-метилциклогексил)-2-оксоэтил]-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил}уксусную кислоту (Пример 133, стадия a) и этиловый эфир (3-аминофенилсульфанил)уксусной кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), согласно способу Примера 1, стадия d.

1H ЯМР (CDCl3) 8,40 (1H, с), 7,48 (3H, м), 7,31 (2H, м), 7,20 (1H, т), 7,10 (1H, д), 7,02 (1Н, д), 4,76 (1H, д), 4,58 (1H, д), 4,23 (2H, м), 3,67 (2H, с), 2,79 (1Н, м), 1,99-1,25 (20H, м), 1,19 (3H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 58,41, H 7,21, N 8,18%. C33 H40N4O 5Sбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,4H2O. Вычислено: C 58,17, H 7,31, N 8,48%.

Пример 135. Этиловый эфир 5-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}-1Н-индол-2-карбоновой кислоты.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (пример 1), за исключением того, что этиловый эфир 5-амино-1 H-индол-2-карбоновой кислоты используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl3) 8,75 (1H, с), 8,24 (1H, с), 7,90 (1Н, с), 7,48-7,19 (6H, м), 7,04 (1H, д), 4,68 (1H, д), 4,45 (1H, д), 4,41-4,25 (4H, м), 2,79 (1H, м), 2,05-1,39 (6H, м), 1,28-1,23 (16H, м).

Найдено: C 67,04, H 6,98, N 11,19%. C33H39N 5O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,4CH3CO2C 2H5. Вычислено: C 66,93, H 6,85, N 11,28%.

Пример 136. 2-[5-Циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]-N-[3-(2-метилтиазол-4-ил)фенил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [5-циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-мл]уксусную кислоту (Пример 22, стадия a) и 3-(2-метилтиазол-4-ил)фениламин используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e.

1H ЯМР (CDCl 3) 8,39 (1H, с), 7,84 (1Н, т), 7,61 (1H, д), 7,47 (3H, т), 7,30 (3H, м), 7,08 (1H, д), 4,57 (2H, м), 4,26 (2H, м), 2,95 (1H, м), 2,82 (1H, м), 2,77 (3H, с), 1,82-1,26 (18H, м).

Найдено: C 67,52, H 6,42, N 11,83%. C33 H37N5O 3Sбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,2H2O. Вычислено: C 67,44, H 6,42, N 11,92%.

Пример 137. 4-(3-{2-[5-Циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)тиазол-2-карбоновая кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [5-циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 22, стадия a) и этиловый эфир 4-(3-аминофенил)тиазол-2-карбоновой кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), согласно способу Примера 1, стадия d.

1H ЯМР (CDCl3) 8,51 (1H, с), 8,05 (1H, с), 7,88 (1Н, с), 7,63 (1H, д), 7,49 (3H, м), 7,40-7,27 (2H, м), 7,07 (1H, д), 4,70 (1H, д), 4,45 (1Н, д), 4,27 (2H, м), 2,95 (1H, м), 2,81 (1Н, м), 2,06-1,56 (14H, м), 1,28 (4H, м).

Далее соединение охарактеризовывают как соль N -метил-D-глюкамина.

Найдено: C 57,65, H 6,41, N 9,83%. C33H35N 5O5Sбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,5H2O. Вычислено: C 57,51, H 6,63, N 10,06%.

Пример 138. (3-{2-[1-(3,3-Диметил-2-оксобутил)-2-оксо-5-пиридин-2-ил-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенилсульфанил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [1-(3,3-диметил-2-оксобутил)-2-оксо-5-пиридин-2-ил-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 5, стадия a) и этиловый эфир (3-аминофенилсульфанил)уксусной кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), согласно способу Примера 1, стадия d.

1H ЯМР (CDCl3) 8,63 (1H, м), 8,36 (1Н, м), 8,02 (1Н, м), 7,81 (1Н, т), 7,36 (2H, м), 7,23 (3H, м), 7,11 (4H, м), 5,05 (1H, шир.с), 4,72 (2H, м), 4,36 (2H, м), 3,61 (2H, с), 1,27 (9H,с).

Пример 139. (3-{2-[1-(3,3-Диметил-2-оксобутил)-2-оксо-5-фенил-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенилсульфанил)уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [1-(3,3-диметил-2-оксобутил)-2-оксо-5-фенил-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (пример 4, стадия a) и этиловый эфир (3-аминофенилсульфанил)уксусной кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), согласно способу Примера 1, стадия d.

1H ЯМР (CDCl3) 8,60 (1H, шир.с), 8,40 (1H, с), 7,63-7,40 (7H, м), 7,25-7,14 (6H, м), 4,76 (2H, м), 4,43 (2H, с), 3,58 (2H, с), 1,25 (9H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 50,02, H 6,04, N 7,59%. C30 H30N5O 5Sбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,8C4H8O 2бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,2CH2Cl2. Вычислено: C 50,06, H 5,96, N 7,55%.

Пример 140. Метиловый эфир 2-(3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)оксазол-4-карбоновой кислоты.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир 2-(3-аминофенил)оксазол-4-карбоновой кислоты (полученный в три стадии из метилового эфира серина и нитробензойной кислоты) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl3) 8,51 (1H, шир.с), 8,28 (1Н, с), 8,00 (1H, т, 1,8), 7,86-7,83 (1H, м), 7,76-7,73 (1Н, м), 7,54-7,34 (4H, м), 7,05 (1Н, д, 1,8), 4,81 (1H, д, 17,7), 4,64 (1H, д, 17,7), 4,26-4,25 (2H, м), 3,96 (3H, с), 2,83-2,77 (1Н, м), 2,05-1,70 (6H, м), 1,38-1,18 (13H, м).

Найдено: C 64,43, H 6,10, N 11,25%. C33H37N 6O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,8H2O. Вычислено: C 64,56, H 6,33, N 11,41%.

Пример 141. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-[3-(1-метил-1H-имидазол-4-ил)фенил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 3-(1-метил-1Н-имидазол-4-ил)фениламин (полученный в три стадии из 2-бром-3'-нитроацетофенона) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,25 (1Н, шир.с), 7,85 (1H, т, 1,8), 7,54-7,44 (4H, м), 7,30-7,24 (2H, м), 7,19 (2H, м), 7,04 (1H, д, 7,8), 4,71-4,68 (2H, м), 4,37 (1Н, д, 16,2), 4,21 (1Н, д, 16,2), 3,72 (3H, с), 2,79 (1H, м), 2,05-1,72 (6H, м), 1,32-1,24 (13H, м).

Найдено: C 68,00, H 6,90, N 14,55%. C32H 38N6O3бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,7H2O. Вычислено: C 67,77, H 7,00, N 14,82%.

Пример 142. (4-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}индазол-2-ил)уксусная кислота.

Указанное в заголовке соединение получают в виде трифторацетатной соли способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что трет-бутиловый эфир (4-аминоиндазол-2-ил)уксусной кислоты (полученный в две стадии из 4-нитроиндазола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо трет-бутилового эфира (4-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}индазол-1-ил)уксусной кислоты (Пример 130, стадия a), согласно способу Примера 130, стадия b.

1H ЯМР (CDCl 3) 10,04-9,95 (2H, шир.с), 9,06 (1Н, с), 8,13 (1H, с), 7,53-7,20 (6H, м), 7,06 (1H, д, 6), 5,26 (2H, с), 4,80 (1H, д, 18), 4,63 (1H, д, 18), 4,29 (2H, с), 2,81-2,78 (1H, м), 2,07-1,67 (6H, м), 1,37-1,19 (13H, м).

Найдено: C 56,82, H 5,42, N 11,88%. C31H36N 6O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 CF3CO2Hбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,7H2O. Вычислено: C 56,72, H 5,53, N 12,03%.

Пример 143. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]-N-{3-[метил(2-метиламиноэтил)амино]фенил}ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что трет-бутиловый эфир {2-[(3-аминофенил)метиламино]этил}метилкарбаминовой кислоты (полученный в три стадии из 3-фтор-1-нитробензола и N-N'-диметилэтилендиамина) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо трет-бутилового эфира (3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бенотриазепин-3-ил]ацетиламино}фенил)метилкарбаминовой кислоты (Пример 3, стадия d), согласно способу Примера 3, стадия e.

1H ЯМР (CDCl 3) 8,09 (1H, с), 7,50-7,45 (2H, м), 7,29-7,24 (1H, м), 7,12-7,01 (3H, м), 6,53-6,46 (2H, м), 4,69-4,67 (2H, м), 4,38 (1Н, д, 13,8), 4,17 (1H, д, 13,8), 3,50-3,44 (2H, м), 2,93 (3H, с), 2,86-2,74 (3H, м), 2,49 (3H, с), 2,04-1,58 (7H, м), 1,31-1,19 (13H, м).

Найдено: C 65,52, H 7,53, N 14,12%. C 32H44N6O 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,4CH2Cl2. Вычислено: C 65,58, H 7,61, N 14,17%.

Пример 144. 2-(3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)оксазол-4-карбоновая кислота.

Указанное в заголовке соединение получают способом, используемым для получения 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 2), за исключением того, что метиловый эфир 2-(3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)оксазол-4-карбоновой кислоты (Пример 140) используют вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бенотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1).

1H ЯМР (CDCl 3) 8,58 (1Н, м), 8,36 (1H, с), 8,08 (1Н, т, 1,2), 7,83-7,81 (1H, м), 7,76-7,73 (1H, м), 7,54-7,32 (4H, м), 7,05 (1Н, д, 8,1), 4,83 (1Н, д, 17,4), 4,63 (1H, д, 17,4), 4,26 (2H, с), 2,84-2,78 (1H, м), 2,06-1,73 (6H, м), 1,36-1,18 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 57,95, H 6,68, N 10,18%. C32 H35N6O 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,6H2O. Вычислено: C 57,85, H 6,87, N 10,38%.

Пример 145. 5-(3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)фуран-2-карбоновая кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир 5-(3-аминофенил)фуран-2-карбоновой кислоты (полученный в две стадии из 5-(3-нитрофенил)-2-фуранкарбоновой кислоты) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,34 (1H, шир.с), 7,63-7,50 (5H, м), 7,40-7,27 (3H, м), 7,05 (1H, д), 6,77 (1H, м), 4,79 (1H, д), 4,65 (1H, д), 4,39 (1H, д), 2,81 (1H, м), 2,05-1,72 (6H, м), 1,36-1,23 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 59,03, H 6,69, N 8,48%. C33H36 N4O6бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,7H2O. Вычислено: C 59,34, H 7,01, N 8,65%.

Пример 146. 3'-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бифенил-4-карбоновая кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир 3'-аминобифенил-4-карбоновой кислоты (полученный каталитическим гидрированием метилового эфира 3'-нитробифенил-4-карбоновой кислоты (Y. Matsushita et al., Syn. Comm. (1994), 24, 3307)) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 12,9 (1H, шир.с), 9,90 (1H, с), 8,02 (2H, д), 7,88 (1H, с), 7,71 (2H, д), 7,57-7,38 (5H, м), 7,26-7,16 (2H, м), 4,80-4,79 (2H, м), 4,37-4,31 (1Н, м), 4,01 (1H, м), 2,87 (1H, м), 1,75-1,65 (6H, м), 1,34-1,13 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 61,82, H 7,05, N 8,19%. C35H38N 4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,7H2O. Вычислено: C 61,51, H 7,17, N 8,54%.

Пример 147. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]-N-[3-(2,4-диоксотиазолидин-5-илиденметил)фенил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 5-(3-аминобензилиден)тиазолидин-2,4-дион (полученный в две стадии из 3-нитробензальдегида) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (ДМСО-d 6) 9,84 (1H, шир.с), 7,62-7,45 (4H, м), 7,33-7,15 (4H, м), 4,80-4,76 (2H, м), 4,32-4,30 (1H, шир.м), 4,03-3,94 (1H, шир.м), 2,87 (1Н, м), 1,86-1,53 (6H, м), 1,34-1,10 (13H, м).

Найдено: C 61,16, H 5,89, N 11,08%. C32 H44N6O 5Sбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,4H2O. Вычислено: C 61,34, H 6,07, N 11,18%.

Пример 148. 2-(3-{2-[5-Циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)оксазол-4-карбоновая кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [5-циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 22, стадия a) и метиловый эфир 2-(3-аминофенил)оксазол-4-карбоновой кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,60 (1H, с), 8,35 (1H, с), 8,08 (1H, с), 7,83-7,81 (1H, м), 7,74-7,72 (1H, м), 7,61-7,32 (4H, м), 7,09 (1H, д), 4,73 (1Н, д), 4,49 (1H, д), 4,26 (2H, с), 3,01-2,91 (1Н, м), 2,81 (1Н, м), 2,13-1,58 (14H, м), 1,31-1,25 (4H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 57,97, H 6,50, N 9,95%. C33H35 N5O6бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,8H2O. Вычислено: C 58,20, H 6,79, N 10,18%.

Пример 149. 5-(3-{2-[5-Циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)фуран-2-карбоновая кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [5-циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро -3H-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 22, стадия a) и метиловый эфир 5-(3-аминофенил)фуран-2-карбоновой кислоты используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,35 (1H, с), 7,63-7,50 (5H, м), 7,41-7,32 (3H, м), 7,11 (1H, д), 6,80 (1H, д), 4,71 (1H, д), 4,51 (1H, д), 4,45 (1Н, д), 4,24 (1H, д), 3,01-2,91 (1Н, м), 2,85-2,79 (1H, м), 2,06-1,60 (14H, м), 1,31-1,30 (4H, м).

Далее соединение охарактеризовывают как соль N -метил-D-глюкамина.

Найдено: C 60,14, H 6,70, N 8,49%. C34H36N 4O6бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,5H2O. Вычислено: C 60,16, H 6,89, N 8,56%.

Пример 150. 2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]-N-[3-(2-метиламинотиазол-4-ил)фенил]ацетамид.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [4-(3-аминофенил)тиазол-2-ил]метиламин (полученный в две стадии из 2-бром-3'-нитроацетофенона) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e.

1H ЯМР (CDCl 3) 8,28 (1H, с), 7,77 (1Н, с), 7,55-7,25 (7H, м), 7,04 (1H, д), 6,71 (1H, с), 5,12 (1H, д), 4,77 (1H, д), 4,67 (1H, д), 4,36 (1Н, д), 4,22 (1Н, д), 3,04 (3H, д), 2,79 (1H, м), 2,05-1,73 (6H, м), 1,45-1,19 (13H, м).

Найдено: C 64,64, H 6,57, N 14,05%. C32H38N 6O3Sбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,5H2O. Вычислено: C 64,57, H 6,59, N 14,12%.

Пример 151. 3'-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бифенил-3-карбоновая кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что этиловый эфир 3'-аминобифенил-3-карбоновой кислоты (полученный в две стадии из 3-нитрофенилбороновой кислоты) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), согласно способу Примера 1, стадия d.

1H ЯМР (CDCl3) 8,40 (1H, с), 8,29 (1H, т), 8,12-8,08 (1H, м), 7,85-7,81 (1H, м), 7,64-7,61 (1H, м), 7,57-7,47 (4H, м), 7,41-7,27 (3H, м), 7,06 (1H, д), 4,80 (1H, д), 4,65 (1Н, д), 4,39 (1Н, д), 4,25 (1Н, д), 2,84-2,77 (1H, м), 2,02-1,70 (6H, м), 1,44-1,16 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 61,19, H 7,07, N 8,48%. C35 H38N4O 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,9H2O. Вычислено: C 61,21, H 7,19, N 8,50%.

Пример 152. (3-{2-[1-(2-трет-Бутилаллил)-5-циклогексил-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)уксусная кислота.

Указанное в заголовке соединение получают, используя способ, применяемый для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 2-бромметил-3,3-диметилбут-1-ен (E. Lee et al., J. Org. Chem. (1994), 59, 1444) используют вместо 1-бром-3,3-диметилбутан-2-она на стадии c, и метиловый эфир 3-аминобензойной кислоты заменяют метиловым эфиром (3-аминофенил)уксусной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 12,10 (1H, шир.с), 9,79 (1H, с), 7,58-7,34 (5H, м), 7,21 (2H, м), 6,90 (1H, д), 4,79 (1H, с), 4,68 (2H, м), 4,32 (2H, шир.т), 3,95 (1H, д), 3,48 (2H, с), 2,80 (1H, м), 2,00-1,10 (10H, м), 1,04 (9H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 58,80, H 7,60, N 8,73%. C31 H38N4O 4бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,0H2O. Вычислено: C 58,52, H 7,88, N 8,97%.

Пример 153. 5-(3-{2-[1-(2-трет-Бутилаллил)-5-циклогексил-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)фуран-2-карбоновая кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что 2-бромметил-3,3-диметилбут-1-ен используют вместо 1-бром-3,3-диметилбутан-2-она на стадии c, и метиловый эфир аминобензойной кислоты заменяют метиловым эфиром 5-(3-аминофенил)фуран-2-карбоновой кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 13,00 (1H, шир.с), 10,01 (1H, с), 7,59-7,34 (7H, м), 725 (2H, м), 7,03 (1H, д), 4,80 (1H, с), 4,68 (1H, с), 4,60-4,04 (2H, шир.м), 4,30 (2H, шир.м), 2,90 (1H, м), 2,00-1,20 (10H, м), 1,04 (9H, с).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 58,88, H 7,03, N 8,13%. C34 H38N4O 6бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,0H2O. Вычислено: C 59,19, H 7,39, N 8,41%.

Пример 154. 3'-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бифенил-2-карбоновая кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир 3'-аминобифенил-2-карбоновой кислоты (полученный в две стадии из 3-нитрофенилбороновой кислоты) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,52 (1Н, с), 7,91 (1Н д), 7,63-7,20 (9H, м), 7,11 (1H, д), 7,03 (1H, д), 4,82 (1H, д), 4,61 (1H, д), 4,30 (1H, д), 4,16 (1H, д), 2,82-2,75 (1H, м), 2,05-1,57 (6H, м), 1,44-1,00 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 61,11, H 6,88, N 8,29%. C35H 38N4O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,8H2O. Вычислено: C 61,40, H 7,18, N 8,53%.

Пример 155. 2-Ацетиламино-3-(3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)акриловая кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир 2-ацетиламино-3-(3-аминофенил)акриловой кислоты (полученный через три стадии из 3-нитробензальдегида и N-ацетилглицина) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,43 (1Н, с), 7,99 (1H, с), 7,61-7,00 (9H, м), 4,80 (1H, д), 4,61 (1H, д), 4,22-4,16 (2H, м), 2,79 (1H, м), 2,19-1,65 (9H, м), 1,44-1,19 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 56,61, H 6,99, N 9,44%. C33 H39N5O 6бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 3,2H2O. Вычислено: C 56,22, H 7,36, N 9,83%.

Пример 156. 3-{2-[1-(трет-Бутилкарбамоилметил)-5-циклогексил-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойная кислота.

Стадия а. Этиловый эфир [1-(трет-бутилкарбамоилметил)-5-циклогексил-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]уксусной кислоты получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1, стадия e), за исключением того, что (5-циклогексил-3-этоксикарбонилметил-2-оксо-2,3-дигидро-3 Н-1,3,4-бензотриазепин-1-ил)уксусную кислоту (Пример 68, стадия b) и трет-бутиламин используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно.

1H ЯМР (CDCl3) 7,40 (2H, м), 7,22 (2H, м), 6,63 (1H, с), 4,27-4,09 (6H, м), 2,75 (1Н, м), 2,00-1,55 (6H, м), 1,30-1,20 (16H, м).

Стадия b. Указанное в заголовке соединение получают проведением стадий d и e способа, применяемого для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что этиловый эфир [1-(трет -бутилкарбамоилметил)-5-циклогексил-2-оксо-1,2-дигидро-3Н -1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 156, стадия a) используют на стадии d вместо этилового эфира [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия c), с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,59 (1H, с), 7,95 (1Н, д), 7,78-7,75 (2H, м), 7,54-7,45 (2H, м), 7,40-7,28 (3H, м), 6,49 (1H, с), 4,35-4,09 (4H, м), 2,81 (1H, м шир.), 2,05 (1H, шир.), 1,88 (1H, шир.), 1,80-1,60 (4H, м), 1,35-1,20 (13H, м).

Далее соединение охарактеризовывают как соль N -метил-D-глюкамина.

Найдено: C 55,95, H 7,01, N 10,29%. C29H35N 5O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 0,7CH2Cl2. Вычислено: С 55,92, H 6,83, N 10,66%.

Пример 157. 5-(3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)тиофен-2-карбоновая кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (пример 1), за исключением того, что метиловый эфир 5-(3-аминофенил)тиофен-2-карбоновой кислоты (полученный в три стадии из 5-бром-2-тиофенкарбоновой кислоты) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,47 (1H, с), 7,85 (1H, д), 7,62-7,47 (4H, м), 7,37-7,27 (4H, м), 7,06 (1H, д), 4,81 (1H, д), 4,64 (1Н, д), 4,36 (1H, д), 4,25 (1H, д), 2,84-2,78 (1Н, м), 2,07-1,70 (6H, м), 1,30-1,19 (13H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 58,29, H 6,63, N 8,22%. C33H 36N4O5Sбензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 1,7H2O. Вычислено: C 58,10, H 6,88, N 8,46%.

Пример 158. [2-(3-{2-[5-Циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3Н-1,3,4-бензотриазепин-3-ил]ацетиламино}фенил)пиррол-1-ил]уксусная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что метиловый эфир [2-(3-аминофенил)пиррол-1-ил]уксусной кислоты (полученный за четыре стадии из 1-(трет-бутоксикарбонил)пиррол-2-бороновой кислоты и 1-бром-3-нитробензола) используют вместо метилового эфира 3-аминобензойной кислоты на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 H-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (CDCl3) 8,46 (1Н, с), 7,47-7,43 (3H, м), 7,32-7,23 (3H, м), 7,09-7,00 (2H, м), 6,77-6,75 (1H, м), 6,27-6,21 (2H, м), 4,79-4,56 (4H, м), 4,31 (1H, д), 4,21 (1H, д), 2,81-2,75 (1H, м), 2,05-1,71 (6H, м), 1,36-1,19 (13H, м).

Далее соединение охарактеризовывают как соль N -метил-D-глюкамина.

Найдено: C 59,36, H 7,02, N 9,65%. C34H39N 5O5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,2H2O. Вычислено: C 59,12, H 7,31, N 10,09%.

Пример 159. 4-(3-{2-[5-Циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил]ацетиламино}фенилмасляная кислота.

Указанное в заголовке соединение получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что [5-циклогексил-1-(2-циклопентил-2-оксоэтил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусную кислоту (Пример 22, стадия a) и метиловый эфир 4-(3-аминофенил)масляной кислоты (J.P. Weichert et al., J. Med. Chem. (1995), 38, 636) используют вместо [5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]уксусной кислоты (Пример 1, стадия d) и метилового эфира 3-аминобензойной кислоты, соответственно, на стадии e, с последующей реакцией полученного продукта, вместо метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), согласно способу Примера 2.

1H ЯМР (ДМСО-d6) 12,00 (1Н, шир.с), 9,67 (1Н, с), 7,50 (2H, м), 7,32-7,15 (5H, м), 6,84 (1H, д), 4,63 (2H, м), 4,25 (1H, шир.д), 3,99 (1Н, шир.д), 3,00 (1Н, м), 2,88 (1H, м), 2,52 (2H, т), 2,19 (2H, т), 2,00-1,00 (20H, м).

Далее соединение охарактеризовывают как соль N-метил-D-глюкамина.

Найдено: C 59,52, H 7,41, N 8,62%. C33 H40N4O 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 C7H17NO 5бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 2,0H2O. Вычислено: С 59,76, H 7,65, N 8,71%.

Пример 160. 2-(5-Циклогексил-1-метил-2-оксо-4-окси-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил)-N-фенилацетамид.

Стадия а. 2-(5-Циклогексил-1-метил-2-оксо-1,2-дигидро-3H-1,3,4-бензотриазепин-3-ил)-N-фенилацетамид получают способом, используемым для получения метилового эфира 3-{2-[5-циклогексил-1-(3,3-диметил-2-оксобутил)-2-оксо-1,2-дигидро-3 Н-1,3,4-бензотриазепин-3-ил]ацетиламино}бензойной кислоты (Пример 1), за исключением того, что на стадии с используют иодметан вместо 1-бром-3,3-диметилбутан-2-она, и анилин используют на стадии e вместо метилового эфира 3-аминобензойной кислоты.

1H ЯМР (CDCl3) 8,25 (1H, с), 7,55 (1H, т), 7,44 (1H, д), 7,32-7,21 (6H, м), 7,06 (1H, т), 4,47 (1H, д), 4,14 (1H, д), 3,29 (3H, с), 2,76 (1H, м), 2,00-1,00 (10H, м).

Стадия b. К раствору продукта стадии а (390 мг, 1,00 ммоль) в ДХМ (DCM) (10 мл) добавляют 3-хлорпероксибензойную кислоту (1,23 г 70%, 5,00 ммоль) и раствор перемешивают при комнатной температуре в течение 16 ч. После разбавления ДХМ (50 мл) раствор промывают 5% Na2CO3 (2×50 мл), затем насыщенным раствором соли. Органическую фазу сушат над MgSO4 и растворитель выпаривают при пониженном давлении. Остаток очищают колоночной флэш-хроматографией (EtOAc-ДХМ) (1:9), получая продукт в виде белого твердого вещества (94 мг, 23%).

1H ЯМР (CDCl 3) 8,17 (1H шир.с), 7,51 (2H, д), 7,39-7,22 (6H, м), 7,06 (1H, м), 4,60 (1H, д), 4,23 (1H, д), 3,39 (3H, с), 3,15 (1H, м), 2,00-1,00 (10H, м).

Найдено: С 67,73, Н 6,46, N 13,71%. С23H26N 4O3. Вычислено: С 67,96, Н 6,45, N 13,78%.

Антагонистическая активность к (CCK 2) гастрина

Соединения примеров были испытаны на антагонистическую активность к (СКК 2) гастрина в испытании на желудке молодых крыс. Методика была следующей.

Пищевод молодых крыс (33-50 г, возраст около 21 дней) лигируют на уровне кардиального сфинктера и дуоденальный сфинктер подвергают катетеризации. Желудок иссекают и промывают приблизительно 1 мл незабуференного физиологического раствора. Дно (желудка) прокалывают и подвергают катетеризации. Дополнительно 4-5 мл незабуференного раствора пропускают через желудок, чтобы удостовериться в отсутствии утечки. Желудок погружают в снабженную рубашкой ванну для органа, содержащую 40 мл забуференного раствора, содержащего 3×10-8 М 5-метилфурметида, поддерживают при 37°С и энергично насыщают газовой смесью 95% О2/5% СО2. Желудок непрерывно подвергают перфузии незабуференным раствором, насыщенным 100% СО2, при скорости 1 мл·мин -1, при этом перфузат пропускают через рН-электрод внутреннего сравнения, установленный на 12 см выше желудка.

После стабилизации в течение 120 мин добавляют лекарственные средства непосредственно в серозный раствор в ванне для органа и по истечении дополнительных 60 мин начинают наносить данные на кумулятивные кривые "доза пентагастрина-ответ". Контролируют изменения в секреции (желудком) кислоты и кривые анализируют согласно Black et al., Br. J. Pharmacol., 1985, 86, 581.

Результаты, полученные на рецепторах (ССК2) гастрина, приводятся в таблице 1.

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

Ряд соединений были испытаны на человеческих рецепторах (ССК2) гастрина, которые были клонированы в клеточную линию NIH3T3, как указано ниже.

Стадия а: субклонирование клона IMAGE, кодирующего человеческий CCK2R в экспрессирующий вектор млекопитающего

Клон IMAGE (Integrated Molecular Analysis of Genomes и their Expression) номер 3504160 (Lennon et al. Genomics 33, 151-152 (1966)) очищали от HGMP (Human Genome Mapping Project, Cambridge). кДНК, кодирующая мРНК для человеческого CCK2R, соответствующая инвентарному номеру ВС000740, присутствовала в векторе рOTB7 в клетке-хозяине DH10B. Клетки, сначала высеянные штрихом на чашки Петри с LB-агаром, содержащие 20 мкг/мл хлорамфеникола, затем выращивали в LB, содержащем 20 мкг/мл хлорамфеникола при встряхивании при 37°С согласно стандартным методикам (Current Protocols in Molecular Biology, Wiley). ДНК получали, используя QIAGEN® EndoFreeTM plasmid Maxi набор (Qiagen Ltd.) в соответствии с инструкциями производителя. Затем ДНК амплифицировали ПЦР (полимеразной цепной реакцией) от инициирующего кодона до терминирующего кодона, используя праймеры, содержащие сайты рестрикции, Eco RI и Xba I, соответственно, чтобы способствовать однонаправленному клонированию. Праймер с инициирующим кодоном также содержал сайт консенсусной последовательности (нуклеотидов) Козака (Kozak M., Nucleic Acids Res. 1984 Ian 25;12(2):857-72) для оптимального инициирования трансляции. Праймеры 1 и 2 (см. таблицу 2) синтезировали до степени чистоты, контролируемой HPLC (ВЭЖХ) согласно Invitrogen. ПЦР осуществляли в 20 мМ Трис-HCl (рН 8,4), 50 мМ KCl, содержащем 2 мМ MgCl2 , 0,2 мМ dNTP (Invitrogen) и 0,1 мкМ каждого праймера. Использовали ПЦР с горячим стартом: образцы денатурировали в течение 2 мин при 95°С, охлаждали до 75°С, затем добавляли 1Ед. Tag полимеразы (Invitrogen) и осуществляли серию циклически 30 раз повторяющихся реакций при 95°С в течение 1 мин, 60°С в течение 30 сек и 72°С в течение 3 мин. Образцы охлаждали до 4°С, после конечного наращивания (вставки) при 72°С в течение 5 мин.

Продукт ПЦР очищали, используя набор для очистки (продукта) ПЦР QIAGEN® MinElute TM, в соответствии с инструкциями производителя. Продукт ПЦР и экспрессирующий вектор млекопитающего расщепляли, используя как Eco RI (Promega Corp.), так и Xba I (Promega Corp.) в 1х Буфере Н (90 мМ Трис-HCl, 10 мМ MgCl 2, 50 мМ NaCl, pH 7,5)(Promega Corp.) и 0,1 мкг/мл BSA. Полосы соответствующего размера расщепленного ДНК, проанализированные на окрашенных бромидом этидия гелях агароза/NBE, вырезали и очищали, используя набор для гель-экстракции QIAGEN® MinEluteTM, в соответствии с инструкциями производителя. Затем продукт ПЦР лигировали в вектор, используя набор для лигирования ДНК LightningTM (Bioline) и трансформировали в Escherichia coli, клетки штамма XL1-Blue (Stratagene) в соответствии с инструкциями производителя.

Колонии отбирали и скринировали, используя рестрикционный гидролизат ДНК, полученный из культур в малом масштабе (5 мл), используя плазмидные Мини-преп колонки QIAGEN ®. Один позитивный клон культивировали в большем масштабе (100 мл), используя стандартные методики (Current Protocols in Molecular Biology, Wiley) и ДНК получали, используя плазмидные Макси-преп колонки QIAGEN®. Затем ДНК подвергали обычному секвенированию согласно MWG Biotech AG, используя праймеры 3, 4 и 5 (таблица 2). Последовательность содержала соответствующую последовательность праймеров 1 и 2 и последовательность кодирующей области, точно соответствующей последовательности с инвентарным номером BC000740.

Стадия b: генерация стабильной клеточной линии

Клетки NIH3T3 от (ECACC) культивировали в модифицированной по способу Дульбекко среде Игла (DMEM) (Invitrogen), содержащей 2 мМ Glutamax I (Invitrogen), 10% инактивированной нагреванием фетальной телячьей сыворотки (Invitrogen). Клетки (4×105) высевали в чашки (Corning) размером 35 мм × 10 мм и трансфицировали, используя реагент TransfastTM (Promega Corp.) в соответствии с инструкциями производителя, используя 10 мкг плазмидной ДНК hCCK2R при соотношении 1:1 (ДНК:реагент TransfastTM). В качестве контролей также получали нетрансфицированные клетки и клетки, трансфицированные только вектором (инфицированные путем переноса в них вектора). Спустя 48 часов клетки обрабатывали трипсином, используя стандартные методики (Culture of Animal Cells, A Manual of Basic Techniques, 4th Ed, R. Ian Freshney) и разведения высевали на чашки размером 35мм×10 мм в среде, содержащей 800 мкг/мл G-418 (Invitrogen). Клетки селекционировали в течение 2 недель до тех пор, пока не появились индивидуальные, отдельные колонии. В нетрансфицированных клетках все клетки погибли по истечении этого времени, что подтверждает адекватный отбор. Используя циклы клонирования и трипсинизацию, согласно стандартным методикам (Culture of Animal Cells, A Manual of Basic Techniques, 4th Ed, R. Ian Freshney), с чашек собрали индивидуальные колонии, содержащие клетки, трансфицированные только вектором, и клетки, трансфицированные плазмидной конструкцией hCCK2R. Клетки выращивали и подвергали анализу радиолигандного связывания (см. таблицу 2).

Таблица 2

Праймеры, используемые в клонировании и секвенировании человеческого CCK 2R
Название праймера Ориентация праймераПоследовательность (5'-3')Ген специфичный или вектор Сайт рестрикции
1Прямой праймерTCT GAATTCGCCGCCATGGAGCTGCTA ГЕНEco RI
2Обратный праймер GTATCTAGACTCAGCCAGGGCCCAGTG ГЕНXba I
3 (Т7)Прямой праймер TAATACGACTCACTATAGGВЕКТОР -
4 (Т3)Обратный праймерATTAACCCTCACTAAAGGG ВЕКТОР-
5 Прямой праймерTGTCCGGACTACTCATGGTG ГЕН-

Сайт рестрикции выделен жирным шрифтом. Инициирующий кодон подчеркнут. Терминирующий кодон выделен курсивным шрифтом и подчеркнут.

Стадия с: клональный отбор

Стабильные клоны, экспрессирующие hCCK2R, скринировали на их способность специфически связывать [125 I]-BH-CCK-8S в исследованиях, представленных кривой в зависимости от концентрации (клеток) в ткани (0,3×10 4 - 1×106 клеток на пробирку), используя условия анализа, описанные ниже. Из тестируемых клонов клон 7 дал наибольшее количество специфически связанной метки и % специфически связанной метки при удовлетворении критериев, что количество суммарно связанной метки не превышало 10% от суммарного количества добавленной радиоактивной метки (например, 4,2%). Кроме того, обнаружена прямая линейная корреляция между количеством специфически связанной метки и концентрацией клеток вплоть до и включая 2,5х105 клеток на 1 мл. Исходя из изложенного выше данный клон выбран для выращивания и проведения полной оценки (определения параметров) связывания.

Стадия d: получение мембран (мембранный препарат)

Клетки культивированного клона 7 хранили в виде замороженных осадков после центрифугирования при -70°С до востребования. Осадки клеток оттаивали в буфере для анализа ССК2 ((мМ): 10 Hepes; 130 NaCl; 5MgCl2; 4,7 KCl; 1 EGTA (рН 7,2 при 21°С) с 0,125 г бацитрацина, добавляемого к каждому литру) и гомогенизировали, используя Polytron (4×1 сек)). Полученный мембранный препарат центрифугировали при 39800g в течение 15 мин при 4°С. Каждый осадок клеток после центрифугирования ресуспендировали в свежем буфере и вновь центрифугировали, как указано выше. Конечный осадок ресуспендировали гомогенизацией (Тефлон-в-стекле), до соответствующей концентрации мембран.

Стадия е: условия инкубации

Для исследований насыщения и конкуренции (конкурентного связывания) клеточные мембраны, полученные на стадии d (3×10 4 клеток на 400 мкл), инкубировали в течение 150 мин при 21°С в конечном объеме 0,05 мл, при этом буфер для анализа CCK2 содержал [125 I]-BH-CCK-8S (50 мкл; 200 пМ). Определяли суммарное и неспецифическое связывание [125I]-BH-CCK-8S, соответственно, используя 50 мкл буфера и 50 мкл 10 мкМ YM022. Испытания обрывали быстрым фильтрованием через предварительно смоченные фильтры Ватмана GF/B, которые промывали (3 х 3 мл) охлажденным льдом 50 мМ Трис HCl (рН 7,4 при 4°С). Фильтры переносили в пластиковые пробирки для гамма-счетчика и определяли связанную радиоактивность считыванием (1 мин) в счетчике Clini гамма-излучения.

Стадия f: анализ насыщения

Связывание [ 125I]-BH-CCK-8S с изоформой рецептора hCCK 2 было насыщаемым. Scatchard графики оказались линейными и средний наклон соответствующих Hill графиков не отличался значимо от единицы (0,97±0,08; n=4). Равновесная константа диссоциации (pKD) и значения Вмакс составляли 10,75±0,08 и 1,1±0,3 фмоль на 1×105 клеток, соответственно (n=4 ±SEM). Данные насыщения анализировали, используя программы аппроксимации кривой по точкам, Radlig and Ligand.

Стадия g: исследования конкуренции (конкурентного связывания)

Ряд соединений изобретения, а также эталонные соединения были испытаны на их способность вытеснять [ 125I]-BH-CCK-8S с рецепторов, полученных, как указано выше. Кратко, разведение и добавление испытываемых соединений, радиолиганда и клеточных мембран осуществляли, используя Beckman Biomek 2000. Способность соединений ингибировать специфическое связывание с рецепторами hCCK2 определяли в трех повторах в диапазоне концентраций с шагом в половину логарифма. Для каждого соединения определяли суммарное и неспецифическое связывание. Каждое соединение испытывали минимум в трех экспериментах. Данные конкурентного связывания аппроксимировали по уравнению Hill'а, используя программное обеспечение Graph-pad Prism, чтобы получить значения IC50 (параметр положения в средней точке) и nH (параметр наклона в средней точке). Константы диссоциации (КI) определяли, используя уравнение Cheng & Prusoff (1973), чтобы ввести поправку на занятость рецептора радиолигандом. Все соединения растворяли в ДМФА, получая исходную концентрацию либо 1, либо 10 мМ, и последующие разведения делали в буфере для анализа. pKI для соединений репрезентативных примеров наряду с рядом эталонных соединений представлены в таблице 3. Все наклоны Hill значимо не отличались от единицы.

Таблица 3
Соединение примера № или эталонное соединение рКi±SEM
Пр. 229,45±0,04
Пр. 569,79±0,03
Пр. 589,48±0,08
Пр. 599,66±0,05
Пр. 1219,96±0,01
Пр. 1289,69±0,03
Пр. 1605,49±0,05
L-365, 2608,45±0,09
YM02210,19±0,03

Кроме того, соединения некоторых примеров испытали в анализе на связывание с ССК1. Все испытанные соединения, как было установлено, имеют pKi для CCK 1, не превышающий 6,5.

Установлено, что композиции и продукты настоящего изобретения, включающие соединение формулы (I) и ингибитор протонного насоса, снижают гиперплазию, ассоциируемую с введением ингибиторов протонного насоса. Вышесказанное было измерено в соответствии со следующим экспериментальным протоколом.

Животные и обработка

40 крыс-самцов линии SPF Wistar (200 г) разделяли на 4 группы животных, подлежащих лечению, и 2 страта. Лечение 20 крыс во втором страте начинали спустя 3 недели после лечения первого страта. Схема исследования представляла собой полностью рандоминизированный двойной слепой метод исследования с индивидуальным вслепую отбором; все крысы размещались в отдельные клетки. Животные имели свободный доступ к воде и пище.

Животных обрабатывали один раз в неделю на протяжении 14 дней:

- Контрольная группа: 1 мл наполнителя гастрин-испытываемого лекарственного средства + 1 мл p.o. (кормление через желудочный зонд) 0,25% Methocel (Dow Copning),

- PPI группа: 1 мл наполнителя гастрин-испытываемого лекарственного средства + 1 мл p.o. (кормление через желудочный зонд) 25 мг/кг Рабепразола в 0,25% Methocel,

- GRA группа: 1 мл гастрин-испытываемого лекарственного средства + 1 мл p.o. (кормление через желудочный зонд) 0,25% Methocel,

- GRA-PPI группа: 1 мл гастрин-испытываемого лекарственного средства + 1 мл p.o. (кормление через желудочный зонд) 25 мг/кг Рабепразола в 0,25% Methocel.

Гастрин-испытываемое лекарственное средство доводили до соответствующей дозы в физиологически совместимом растворителе.

Получение ткани

После удаления дна (желудка) желудок промывают забуференным фосфатом физиологическим раствором перед фиксацией 4% формалином в Millonig буфере. После 4 часов выдерживания ткани в погруженном состоянии в фиксирующих растворах при комнатной температуре указанную ткань промывают в забуференном фосфатом физиологическом растворе (PBS), дегидратируют и погружают в парафин, используя блок для дегидратации и блок для погружения в парафин (Leitz EG 1160; Germany) устройства погружения в парафин Leitz (Leitz TP 1050; Germany).

Были сделаны поперечные срезы (толщиной 3 мкм) кислотопродуцирующей части желудка на 3 уровнях, каждый отдаленный от другого на расстоянии 400 мкм.

Иммунное окрашивание

Использовали следующий непрямой иммунофлуоресцентный метод мечения:

- удаление парафина и регидратация срезов с последующей блокирующей стадией,

- первичные антитела: поликлональные против гистидиндекарбоксилазы антитела морской свинки, 1/2000 (от Euro-Diagnostica) и мышиные моноклональные антитела против PCNA (PCNA - ядерный антиген пролиферирующих клеток) 1/2500 (Клон PС10 от Sigma). Все антитела разводили в 0,2% растворе BSA. Срезы инкубировали на протяжении ночи при 4°С и затем промывают раствором BSA,

- вторичные антитела: козьи антитела против иммуноглобулинов морской свинки, связанные с CY5, 1/500 (от Jackson Laboratories) и козьи антимышиные антитела, связанные с Cy3, 1/250 (от Jackson Laboratories); инкубация в течение 4 часов при 37°С. После промывания растворами BSA и PBS срезы монтировали с помощью slowfade (Molecular Probes Europe BV) и хранили при 4°С.

Воспроизведение изображения

Флуоресцентное мечение наблюдали с помощью эпифлуоресцентного микроскопа или конфокального микроскопа Zeiss LSM510 (Carl Zeiss Jena GmbH).

При использовании CY5- и CY3-связанных антител удается обойти высокие автофлуоресцентные характеристики кислотопродуцирующей слизистой оболочки, когда срезы облучают источником света при 488 нм (FITC канал). Отрицательные контроли, без включения первичных антител, и контроль окрашивания изотипов PCNA демонстрировали полное отсутствие окрашивания. Специфическое мечение PCNA контролировали, используя двойное окрашивание TOPRO-3® (Molecular Probes Europe BV) ядерным красителем. Только в эпителиальных клетках, наиболее близко локализованных к просвету (полости), присутствовало неспецифическое цитоплазматическое мечение. В железистой части слизистой оболочки неспецифическое PCNA-окрашивание отсутствовало.

Для определения индекса мечения клеток ECL, по крайней мере, 80 конфокальных изображений на крысу снимают с 3 предметных стекол (микроскопа) на 3 различных уровнях. Отношение клеток, меченных двумя метками (HDC + PCNA) и всех клеток, меченных HDC, давало индекс мечения клеток ECL.

Пролиферационная активность клеток ECL в PPI группе, как ожидалось, оказалось повышенной по сравнению с фиктивной, GRA и GRA-PPI группами (Eissele, R., Patberg, H., Koop, H., Krack, W., Lorenz, W., McKnight, A.T., and Arnold, R. Effect of gastrin receptor blocade on endrocine cells in rats during achlorhydria. Gastroenterology, 103, 1596-1601, 1992). Повышенная пролиферация PPI может быть полностью блокирована GRA.

ФОРМУЛА ИЗОБРЕТЕНИЯ

1. Применение соединения формулы (I)

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

где W представляет N или N+ -O-;

R1 и R 5 представляют, независимо, Н, C16алкил, тио, гидрокси, галоген, амино или циано;

R2 представляет -(CH 2)s-C(R6R 7)n-(CH2) t-R8, где R6 и R7 независимо выбраны из Н, C 16алкила или ОН; или R 6 и R7 вместе представляют =O группу;

n = 0 или 1;

s = 0, 1, 2 или 3;

t = 0, 1, 2 или 3;

R8 выбран из Н, С 112алкила, (С112алкил) окси,

С 312циклоалкила, адамантила, фенила, пиридила, фуранила, тиенила, пиперазинила, пиперидинила, пирролидинила, тетрагидропиранила, тетрагидрофуранила, морфолинила, тиоморфолинила или тиоксанила (все необязательно замещенные группой, выбранной из C16алкила, (C 16алкил) окси, карбокси, (C 16алкил)оксикарбонила, гидрокси, амино, аминокарбонила, трет-бутиламинокарбонила, галогена);

R3 представляет -(CR 11R12)m-X-(CR 13R14)p-R 9;

m равно 0, 1, 2, 3 или 4;

р равно 0, 1 или 2;

X представляет C(O)NH, NHC(O), C(O)NMe, С(O)O, NHC(O)NH, CO, SO2, C(O)NHNH,

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 или бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

R9 представляет C 16алкил; или фенил, пиридил, бензимидазолил, индазолил, тетрагидроизохинолинил, индолинил, индолил или 2-пиридонил, все необязательно замещенные 1 или 2 группами, независимо выбранными из -L-Q,

где L представляет связь, или группу формулы - (CR17R18) v-Y-(CR17R18 )w, где v и w равны независимо 0, 1, 2 или 3, и Y представляет связь, -CR15=CR 16-, фенил, фуранил, тиофенил, пирролил, тиазолил, имидазолил, оксазолил, пиперазинил, пиперидинил, морфолинил, пирролидинил, оксадиазолил, или пиридил;

Q представляет Н, (C 16алкил) окси, [N-Z](C 16алкил)окси(C16алкил) амино, тио, карбокси(С 16алкил) тио, карбокси, карбокси (C16алкил), карбокси(С 16алкенил), [N-Z]карбокси(C 16алкил)амино, карбокси(С 16алкил)окси, (C 16алкил)оксикарбонил, гидрокси, амино, [N-Z](C16 алкил)амино, галоген, [N-Z](C1 6алкил) сульфониламино, (C1 6алкил)сульфониламинокарбонил, карбокси (C 16алкил) сульфонил, карбокси (C 16алкил) сульфинил, тетразолил, [N-Z]тетразолиламино, циано, амидинотио, SO3 Н, 5-оксо-2,5-дигидро[1,2,4]оксадиазолил, карбокси(C 16алкил)карбониламино, тетразолил(C 16алкил)тио,

[N-Z](C 16алкил)амино(C 16алкил)амино или группу формулы

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

Z представляет Н, C1 6алкил, т-бутоксикарбонил или ацетил;

R 4 представляет -(CH2) q-T-R10

где q равно 0;

Т представляет связь;

R10 представляет C1-C12алкил, С 3-C12циклоалкил, фенил, адамантил, пиридил, фуранил или тиенил (все необязательно замещенные группой, выбранной из C16 алкила, гидрокси, амино или галогена);

R 11, R12, R13 , R14, R15, R 17 и R18 представляют Н;

R 16 представляет Н или ацетиламино;

или его фармацевтически приемлемая соль;

для получения лекарственного средства для лечения нарушений, связанных с гастрином.

2. Применение по п.1, где W представляет N.

3. Применение по п.1 или 2, где оба R1 и R5 представляют Н.

4. Применение по п.1 или 2, где s = 1, n = 1, и R6 и R7 вместе представляют =O группу.

5. Применение по п.4, где t = 0 и R8 представляет С 312циклоалкильную группу (необязательно замещенную метильной группой) или разветвленную С 312алкильную группу.

6. Применение по любому одному из п.4 или 5, где R8 представляет т-бутильную, циклогексильную, 1-метилциклогексильную, 1-метилциклопентильную или циклопентильную группу.

7. Применение по любому одному из пп.1, 2, 4 или 5, где m = 1, R11 представляет Н и R12 представляет Н.

8. Применение по п.7, где р равно 0.

9. Применение по п.8, где Х представляет C(O)NH.

10. Применение по любому одному из пп.1, 2, 4, 5, 8 или 9, где R9 представляет фенил, замещенный карбокси, карбокси (C1 6алкильной), тетразолильной, карбокси (C 16алкил)тио, карбокси (C 16алкил) сульфонильной, (C 16алкил) амино или 5-оксо-2,5-дигидро[1,2,4]оксадиазолильной группой; или R9 представляет N-[карбокси(C 16алкил)индолинильную или N-[карбокси(C 16алкил)]индолильную группу.

11. Применение по п.10, где фенильная группа замещена в положении 3.

12. Применение по любому из пп.1, 2, 4, 5, 8, 9 или 11, где R10 представляет С 112алкил, С312циклоалкил, пиридил или фенил (все необязательно замещенные галогеном).

13. Применение по п.12, где R10 представляет циклогексил.

14. Способ лечения расстройства, связанного с гастрином, включающий введение терапевтически эффективного количества соединения формулы (I), определенного в любом одном из предшествующих пунктов, пациенту, нуждающемуся в таком лечении.

15. Способ по п.14, где расстройство, ассоциируемое с гастрином, представляет собой желудочно-кишечное расстройство.

16. Фармацевтическая композиция для лечения нарушений, связанных с гастрином, содержащая ингибитор протонного насоса и соединение формулы (I), определенное в любом одном из пп.1-13, вместе с фармацевтически приемлемым разбавителем или носителем.

17. Композиция по п.16, где ингибитор протонного насоса выбран из (RS)-рабепразола, (RS)-омепразола, ланзопразола, пантопразола, (R)-омепразола, (S)-омепразола, перпразола, (R)-рабепразола, (S)-рабепразола или их щелочных солей.

18. Композиция по п.16, где ингибитор протонного насоса и соединение формулы (I) представлены каждый в количестве, обеспечивающем терапевтически благоприятное воздействие на пациентов, страдающих желудочно-кишечными расстройствами.

19. Композиция по п.18, где указанное терапевтически благоприятное воздействие представляет собой действие, направленное на снижение секреции кислоты у пациентов, страдающих желудочно-кишечными расстройствами, или профилактику желудочно-кишечных расстройств у указанных пациентов, или снижение нежелательных воздействий, ассоциируемых с одним из активных компонентов, другими активными компонентами.

20. Набор, содержащий в качестве первого активного компонента соединение формулы (I), определенное по любому одному из пп.1-13, и в качестве второго активного компонента ингибитор протонного насоса, для одновременного, раздельного или последовательного применения при лечении пациентов, страдающих желудочно-кишечными расстройствами.

21. Применение композиции по любому одному из пп.16-19 для получения лекарственного средства для лечения желудочно-кишечных расстройств.

22. Применение набора по п.20 для получения лекарственного средства для лечения желудочно-кишечных расстройств.

23. Применение ингибитора протонного насоса для лечения желудочно-кишечных расстройств, причем указанное лечение включает одновременное или последовательное введение указанного ингибитора протонного насоса и соединения формулы (I), определенного по любому одному из пп.1-13, где указанный ингибитор протонного насоса усиливает действие соединения формулы (I) на связанные с гастрином нарушения у пациентов, страдающих желудочно-кишечными расстройствами.

24. Применение соединения формулы (I), определенного в любом одном из пп.1-13, для лечения желудочно-кишечных расстройств, при этом указанное лечение включает одновременное или последовательное введение указанного ингибитора протонного насоса и соединения формулы (I), где указанное соединение формулы (I) усиливает действие ингибитора протонного насоса, направленное на снижение секреции кислоты у пациентов, страдающих желудочно-кишечными расстройствами.

25. Применение соединения формулы (I), определенного по любому одному из пп.1-13, для снижения нежелательных воздействий, ассоциируемых с введением ингибиторов протонного насоса, у пациентов, страдающих желудочно-кишечными расстройствами.

26. Применение по п.23, где нежелательным воздействием является гиперплазия.

27. Применение ингибитора протонного насоса для снижения нежелательных воздействий, ассоциируемых с введением соединения формулы (I), определенного по любому одному из пп.1-13, у пациентов, страдающих желудочно-кишечными расстройствами.

28. Способ получения фармацевтической композиции по любому одному из пп.16-19, включающий смешивание соединения формулы (I), определенного по любому одному из пп.1-13, и ингибитора протонного насоса с фармацевтически приемлемым разбавителем или носителем.

29. Соединений формулы (IIa)

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

где W представляет N или N+ -O-;

R1 и R 5 представляют, независимо, Н, C16алкил, тио, гидрокси, галоген, амино или циано;

R2 представляет -(СН 2)s-С(О)-(CH2 )t-R8;

s = 0, 1, 2 или 3;

t = 0, 1, 2 или 3;

R 8 выбран из Н, С1 12алкила, (С112 алкил)окси, С312 циклоалкила, адамантила, фенила, пиридила, фуранила, тиенила, пиперазинила, пиперидинила, пирролидинила, тетрагидропиранила, тетрагидрофуранила, морфолинила, тиоморфолинила или тиоксанила (все необязательно замещенные группой, выбранной из С 16алкила, (C16алкил)окси, карбокси, (C 16алкил)оксикарбонила, гидрокси, амино, аминокарбонила, трет-бутиламинокарбонила, галогена);

R3 представляет -(CR 11R12)m-X-(CR 13R14)p-R 9;

m = 0, 1, 2, 3 или 4;

р = 0, 1 или 2;

Х представляет C(O)NH, NHC(О), C(O)NMe, С(О)О, NHC(O)NH, СО, SO2, C(O)NHNH,

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 или бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

или

R9 представляет C16алкил; или фенил, пиридил, бензимидазолил, индазолил, тетрагидроизохинолинил, индолинил, индолил или 2-пиридонил, все необязательно замещенные 1 или 2 группами, независимо выбранными из -L-Q,

где L представляет связь или группу формулы -(CR17R 18)v-Y-(CR17 R18)w, где v и w равны, независимо, 0, 1, 2 или 3, и Y представляет связь, -CR 15=CR16-, фенил, фуранил, тиофенил, пирролил, тиазолил, имидазолил, оксазолил, пиперазинил, пиперидинил, морфолинил, пирролидинил, оксадиазолил или пиридил;

Q представляет Н, (C16алкил)окси,

[N-Z](С16алкил)окси(C 16алкил)амино, тио, карбокси(C 16алкил)тио, карбокси, карбокси(C 16алкил), карбокси(C 16алкенил), [N-Z]карбокси(C 16алкил)амино, карбокси(С 16алкил)окси, (C 16алкил)оксикарбонил, гидрокси, амино, [N-Z](C16 алкил)амино, галоген, [N-Z](C1 6алкил)сульфониламино, (C1 6алкил)сульфониламинокарбонил, карбокси (C 16алкил)сульфонил, карбокси (C 16алкил) сульфинил, тетразолил, [N-Z]тетразолиламино, циано, амидинотио, SO3 Н, 5-оксо-2,5-дигидро[1,2,4]оксадиазолил, карбокси(C 16алкил)карбониламино, тетразолил(C 16алкил)тио, [N-Z](C 16алкил)амино(C 16алкил)амино или группу формулы

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

Z представляет Н, C1 6алкил, т-бутоксикарбонил или ацетил;

R 4 представляет -(CH2) q-T-R10, где q = 0;

Т представляет связь;

R10 представляет С 112алкил, С3 -C12циклоалкил, фенил, адамантил, пиридил, фуранил или тиенил (все необязательно замещенные группой, выбранной из C16алкила, гидрокси, амино или галогена);

R11, R 12, R13, R14 , R15, R17 и R 18 представляют Н;

R16 представляет Н или ацетиламино;

или его фармацевтически приемлемая соль;

при условии, что R2 не является CH 2CO2H или С(O)СН2 , когда R10 представляет фенил.

30. Соединение формулы (IIb)

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

где W представляет N или N+ -O-;

R1 и R 5 представляют, независимо, Н, C16алкил, тио, гидрокси, галоген, амино или циано;

R2 представляет

-(CH2)s-C(R 6R7)n-(CH 2)t-R8

где R6 и R7 независимо выбраны из Н, C16 алкила или ОН; или R6 и R 7 вместе представляют =O группу;

n = 0 или 1;

s = 0, 1, 2 или 3;

t = 0, 1, 2 или 3; и

R 8 выбран из Н, С1 12алкила, (С112 алкил) окси,

С3 12циклоалкила, адамантила, фенила, пиридила, фуранила, тиенила, пиперазинила, пиперидинила, пирролидинила, тетрагидропиранила, тетрагидрофуранила, морфолинила, тиоморфолинила или тиоксанила (все необязательно замещенные группой, выбранной из C 16алкила, (C16алкил)окси, карбокси, (C 16алкил)оксикарбонила, гидрокси, амино, аминокарбонила, трет-бутиламинокарбонила, галогена); при условии, что R8 не является Н, когда n, s и t равны 0;

R3 представляет - (CR11R12) m-X-(CR13R14 )p-R9;

m = 0, 1, 2, 3 или 4;

р = 0, 1 или 2;

Х представляет C(O)NH, NHC(О), C(O)NMe, С(О)О, NHC(O)NH, СО, SO 2, C(O)NHNH,

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438 или бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

R9 представляет C 16алкил; или фенил, пиридил, бензимидазолил, индазолил, тетрагидроизохинолинил, индолинил, индолил или 2-пиридонил, все необязательно замещенные 1 или 2 группами, независимо выбранными из -L-Q,

где

L представляет связь или группу формулы

-(CR17R18) v-Y-(CR17R18 )w, где v и w равны, независимо, 0, 1, 2 или 3, и Y представляет связь, -CR15=R 16-, фенил, фуранил, тиофенил, пирролил, тиазолил, имидазолил, оксазолил, пиперазинил, пиперидинил, морфолинил, пирролидинил, оксадиазолил или пиридил;

и

Q представляет Н, (C 16алкил)окси,

[N-Z](C 16алкил)окси(C16алкил)амино, тио, карбокси(C 16алкил)тио, карбокси, карбокси(C 16алкил), карбокси(C 1-C6алкенил), (N-Z]карбокси(C 16алкил)амино, карбокси(С 16алкил)окси, (C 16алкил)оксикарбонил, гидрокси, амино, [N-Z](С16 алкил)амино, галоген, [N-Z](C1 6алкил)сульфониламино, (C1 6алкил)сульфониламинокарбонил,

карбокси (C 16алкил) сульфонил, карбокси (C 16алкил) сульфинил, тетразолил, [N-Z]тетразолиламино, циано, амидинотио, SO3 Н, 5-оксо-2,5-дигидро[1,2,4]оксадиазолил,

карбокси(C 16алкил)карбониламино, тетразолил(C 16алкил)тио, [N-Z](C 16алкил)амино(C 16алкил)амино или группу формулы

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

Z представляет Н, C1 6алкил, т-бутоксикарбонил или ацетил;

R 4 имеет формулу -(CH2) q-T-R10, где q = 0; Т представляет связь;

R10 представляет C 112алкил, С312циклоалкил, адамантил, пиридил, фуранил или тиенил, (все необязательно замещенные группой, выбранной из C16алкила, гидрокси, амино, или галогена);

R11, R 12, R13, R14 , R15, R17 и R 18 представляют Н;

R16 представляет Н или ацетиламино;

или их фармацевтически приемлемая соль.

31. Соединение формулы (IIa) или (IIb) по п.29 или 30, где W представляет N.

32. Соединение формулы (IIa) или (IIb) по п.29 или 30, где оба R1 и R 5 представляют Н.

33. Соединение формулы (IIb) по п.30, где s = 1, n = 1 и R6 и R 7 вместе представляют =O группу.

34. Соединение формулы (IIb) по п.33, где t = 0 и R8 представляет С312циклоалкильную группу или разветвленную С3 12алкильную группу.

35. Соединение формулы (IIa) по п.29, где s = 1, t = 0 и R8 представляет С312циклоалкильную группу или разветвленную С3 12алкильную группу.

36. Соединение формулы (IIa) или (IIb) по п.34 или 35, где R8 представляет т-бутильную или циклопентильную группу.

37. Соединение формулы (IIa) или (IIb) по любому одному из пп.29, 33, 34 или 35, где m = 1, R11 представляет Н и R 12 представляет Н.

38. Соединение формулы (IIa) или (IIb) по п.37, где р = 0.

39. Соединение формулы (IIa) или (IIb) по п.38, где Х означает C(O)NH.

40. Соединение формулы (IIa) или (IIb) по любому одному из пп.29, 30, 33, 34, 35, 38 или 39, где R9 представляет фенил, замещенный карбокси, карбокси(C1 6алкильной), тетразолильной, карбокси(C 16алкил)тио, карбокси(C 16алкил)сульфонильной, (C 16алкил)амино или 5-оксо-2,5-дигидро[1,2,4]оксадиазолильной группой; или R9 представляет N-[карбокси(C 16алкил)]-индолинильную или N-[карбокси(C 16алкил)]индолильную группу.

41. Соединение формулы (IIa) или (IIb) по п.40, где фенильная группа замещена в 3-положении.

42. Соединение формулы (IIa) по п.29, где R10 представляет С 112алкил, С312циклоалкил, пиридил или фенил (все необязательно замещенные галогеном).

43. Соединение формулы (IIb) по пп.30, 33, 34, 38, 39 или 41, где R10 представляет С112 алкил, С312циклоалкил или пиридил (все необязательно замещенные галогеном).

44. Соединение формулы (IIa) по п.42, где R10 представляет С312 циклоалкил.

45. Соединение формулы (IIb) по п.43, где R 10 представляет С3 12циклоалкил.

46. Соединение формулы (IIa) или (IIb) по любому одному из пп.42, 44 или 45, где R10 представляет циклогексил.

47. Фармацевтическая композиция для лечения нарушений, связанных с гастрином, содержащая соединение формулы (IIa) или (IIb) по любому из пп.29-46 вместе с фармацевтически приемлемым разбавителем или носителем.

48. Соединение формулы (IIa) или (IIb) по любому одному из пп.29-46, применяемое для лечения нарушений, связанных с гастрином.

49. Способ получения фармацевтической композиции по п.47, включающий смешение соединения (IIa) или (IIb) с фармацевтически приемлемым разбавителем или носителем.

50. Способ получения соединения согласно формуле (I), (IIa) или (IIb), включающий взаимодействие соединения формулы (III)

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

с NH2NHR3' и циклизацию полученного соединения гидразона бифункциональным карбонилсодержащим реагентом; где R3' представляет R3 или его подходящий предшественник,

R1, R4 и R 5 такие, как

пределены в п.1.

Приоритет по пунктам и признакам:

В отношении всех признаков всех пунктов формулы изобретения, кроме W=:

N +-O-; R9= тетрагидроизохинолинил или 2-пиридонил; Y= фенил, фуранил, тиофенил, пирролил, оксадиазолил, или пиридил; Q= карбокси(С1 6алкил), 5-оксо-2,5-дигидро[1,2,4]оксадиазолил, карбокси(С 16алкил)карбониламино, тетразолил(C 16алкил)тио,

[N-Z](C 16алкил)амино(C 16алкил)амино или группа формулы

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

R16=Н или ацетиламино;

установлен конвенционный приоритет от 13.11.2001 согласно первой заявке 0127262.4, поданной в Патентное Ведомство Великобритании.

В отношении признаков W=

N+-O -; R9= тетрагидроизохинолинил или 2-пиридонил; Y= фенил, фуранил, тиофенил, пирролил, оксадиазолил, или пиридил; Q= карбокси(С1 6алкил), 5-оксо-2,5-дигидро[1,2,4]оксадиазолил, карбокси(С 16алкил)карбониламино, тетразолил(C 16алкил)тио,

[N-Z](C 16алкил)амино(C 16алкил)амино или группа формулы

бензотриазепины в качестве лигандов рецепторов гастрина и холецистокинина, патент № 2304438

R16=H или ацетиламино;

по всем пунктам формулы изобретения установлен конвенционный приоритет от 12.11.2002 согласно заявке PCT/GB 02/05121.


Скачать патент РФ Официальная публикация
патента РФ № 2304438

patent-2304438.pdf
Патентный поиск по классам МПК-8:

Класс A61K31/55  содержащие семичленные кольца, например азеластин, пентиленететразол

Патенты РФ в классе A61K31/55:
производные 1, 2-дигидроциклобутендиона в качестве ингибиторов фосфорибозилтрансферазы никотинамида -  патент 2529468 (27.09.2014)
фармацевтическая композиция на основе 6-[(4-метил-i-1-пиперазинил)метил]-индоло[1',7':1,2,3]пирроло[3',4':6,7]азепино[4,5-b]индол-1,3(2н,10 н)-диона в качестве противоопухолевого средства -  патент 2523387 (20.07.2014)
замещенные аминоинданы и их аналоги, и их применение в фармацевтике -  патент 2522586 (20.07.2014)
инъекционная лекарственная форма для лечения болезни паркинсона, способ ее приготовления и применение -  патент 2520758 (27.06.2014)
способ получения биоадгезивных компактированных матриц, которые могут быть использованы как таковые или для замедленного высвобождения активных веществ, и компактированные матрицы, полученные таким способом -  патент 2519224 (10.06.2014)
производные изохинолина, ингибирующие р38 киназу -  патент 2512318 (10.04.2014)
новые терапевтические комбинации миртазапина для применения при болевых расстройствах -  патент 2509560 (20.03.2014)
феноксипиридиниламидные производные и их применение в лечении pde4-опосредованных болезненных состояний -  патент 2509077 (10.03.2014)
производное ацилтиомочевины или его соль, и его применение -  патент 2503664 (10.01.2014)
композиция парентерального введения, содержащая карбамазепин в виде субмикронной эмульсии, обладающей противосудорожной активностью -  патент 2490016 (20.08.2013)

Класс C07D255/04 конденсированные с карбоциклическими кольцами или циклическими системами

Класс A61P1/00 Лекарственные средства для лечения расстройства пищеварительного тракта или пищеварительной системы

Патенты РФ в классе A61P1/00:
гепатопротекторное средство из морских водорослей -  патент 2528898 (20.09.2014)
способ получения препарата для профилактики инфекций пищеварительного тракта у сельскохозяйственной птицы и препарат, полученный способом -  патент 2528747 (20.09.2014)
применение пептида актг (4-7)-пгп гепатопротекторного воздействия -  патент 2528741 (20.09.2014)
способ лечения больных с синдромом диспепсии в сочетании с избыточной массой тела -  патент 2528641 (20.09.2014)
новое производное пиразол-3-карбоксамида, обладающее антагонистической активностью в отношении рецептора 5-нт2в -  патент 2528406 (20.09.2014)
фармацевтические и/или пищевые композиции на основе короткоцепочечных жирных кислот -  патент 2528106 (10.09.2014)
новый агонист бета рецептора тиреоидного гормона -  патент 2527948 (10.09.2014)
способ ведения беременности у женщин с избыточной массой тела -  патент 2527910 (10.09.2014)
способ лечения жирового гепатоза кошек -  патент 2527700 (10.09.2014)
зубная паста, содержащая буферную смесь -  патент 2527691 (10.09.2014)


Наверх