ПАТЕНТНЫЙ ПОИСК В РФ
НОВЫЕ ПАТЕНТЫ, ЗАЯВКИ НА ПАТЕНТ
БИБЛИОТЕКА ПАТЕНТОВ НА ИЗОБРЕТЕНИЯ

производные фумаровой кислоты в качестве ингибитора nf-kappab

Классы МПК:A61K31/194  имеющие две или более карбоксильных группы, например янтарная, малеиновая или фталевая кислота
A61K31/225  поликарбоновые кислоты
A61P43/00 Лекарственные средства для специфических целей, не указанные в группах  1/00
Автор(ы):, ,
Патентообладатель(и):ФУМАФАРМ АГ (CH)
Приоритеты:
подача заявки:
2002-01-08
публикация патента:

Предложено применение одного или нескольких незамещенных или замещенных диалкиловых эфиров фумаровой кислоты и моноалкиловых эфиров фумаровой в качестве специфического ингибитора транскрипции NF-kappaB-зависимого гена в фармацевтической композиции для лечения опосредованных NF-kappaB заболеваний, выбранных из группы, состоящей из прогрессирующей системной склеродермии, сифилитического остеохондрита (болезнь Вегера), Cutis marmorata, (Livedo Reticularis), болезни Бехчета, панартериита, неспецифического язвенного колита, васкулита, остеоартрита, подагры, артериосклероза, синдрома Рейтера, бронхолегочного грануломатоза, типов энцефалита, эндотоксического шока (септически-токсический шок), сепсиса, пневмонии, энцефаломиелита, нервно-психической анорексии, Т-лимфоматоза Реннерта, мезангиального нефрита, постангиопластического рестеноза, цитомегаловирусной ретинопатии, аденовирусных заболеваний, таких как аденовирусные простудные заболевания, аденовирусная фарингоконъюнктивальная лихорадка и аденовирусная офтальмия, СПИДа, синдрома Гийена-Барре, постгерпетической невралгии или невралгии после опоясывающего лишая, воспалительной демиелинизирующей полиневропатии, множественных мононевропатий, муковисцидоза, болезни Бехтерева, язвы пищевода Бэррета, инфекции вирусом Эпстайна-Барра (EBV), кардиального ремоделирования, интерстициального цистита, сахарного диабета типа II, радиосенсибилизируемых злокачественных опухолей, частой резистентности злокачественных клеток к химиотерапевтическим средствам (резистентность ко многим лекарственным средствам в химиотерапии), кольцевидных гранулем и онкологических заболеваний, таких как рак молочной железы, рак ободочной кишки, меланома, первичная карцинома печеночных клеток, аденокарцинома, саркома Капоши, рак предстательной железы, лейкозы, такие как острый миелоидный лейкоз, множественная миелома (плазмоцитома), лимфома Беркитта и опухоль Кастлемана. Селективное ингибирование указанных рецепторов позволяет подавлять воспаление при лечении перечисленных заболеваний. 9 з.п. ф-лы, 2 табл.

(56) (продолжение):

CLASS="b560m"Ethnopharmacol.1998 Apr; 60(3): 208-13). реферат из АБД Medline: Nagaki M et al. Tumor necrosis factor alpha prevents tumor necrosis factor receptor-mediated mouse hepatocyte apoptosis, but not fas-mediated apoptosis: role of nuclear factor-kappaB. Hepatology. 2000 Dec; 32(6): 1272-9. WO 98/27070 A1, 02.07.1998. реферат из АБД Medline: Ross SD et al. Attenuation of lung reperfusion injury after transplantation using an inhibitor of nuclear factor-kappaB. Am J Physiol Lung Cell Mol Physiol. 2000 Sep; 279(3): L528-36. реферат из АБД Medline: Feeley ВТ et al. Nuclear factor-kappaB transcription factor decoy treatment inhibits graft coronary artery disease after cardiac transplantation in rodents. Transplantation. 2000 Dec 15; 70(11): 1560-8. WO 98/52549 A1, 26.11.1998. RU 2160589 C1, 20.12.2000. WO 99/09015 A1, 25.01.1999.

Настоящее изобретение относится к применению одного или нескольких производных фумаровой кислоты в качестве ингибитора NF-kappaB. Настоящее изобретение одновременно относится к применению производных фумаровой кислоты для приготовления фармацевтической композиции для лечения заболеваний, опосредованных NF-kappaB.

Известно, что фармацевтические композиции, которые после введения при их биологическом разложении попадают в цикл лимонной кислоты или входят в его состав, как фумаровая кислота, чаще всего в высокой дозировке все больше получают терапевтическое значение, так как с их помощью можно облегчать или лечить криптогенетически обусловленные заболевания. Далее, фумаровая кислота ингибирует рост асцитной опухоли Эрлиха у мышей, уменьшает токсические эффекты митомицина С и афлатоксина и обладает антипсориатическим, а также антимикробным действием.

Самым важным практическим применением является лечение псориаза с помощью различных производных фумаровой кислоты. Это уже описано в ряде патентов, см., например, Европейский патент ЕР 188749, патент DE 2530372, патент DE 2621214 или EP 312697.

Другое применение определенных производных фумаровой кислоты, а именно алкилгидрофумаратов, раскрывается в заявках DE 19721099.6, а также DE 19853487.6, согласно которым описываются определенные производные фумаровой кислоты для лечения аутоиммунных заболеваний, таких как, в особенности, полиартрит, рассеянный склероз и реакции "трансплантат против хозяина". Далее, в заявках DE 19853487.6, а также DE 19839566.3 описывается применение алкилгидрофумаратов и диалкилфумаратов в трансплантационной медицине. Хотя имеются отдельные исследования в отношении механизма действия производных фумаровой кислоты при лечении псориаза, более конкретно об этом до сих пор неизвестно.

NF-kappaB (нуклеарный фактор kappaB) представляет собой фактор транскрипции эукариотических клеток. NF-kappaB относится к семейству Rel-протеинов, классу факторов транскрипции, которые отличаются так называемым Rel-доменом. Rel-Домен назван по первому члену, который обнаружен в качестве онкогена в птичьем вирусе. Специфические сайты в этом гомологичном Rel-домене (RHD), состоящие из 300 аминокислот, ответственны за ДНК-связь с сайтами kappaB, димеризацию с другими протеинами Rel-семейства и взаимодействие с I-kappaB.

До сих пор у млекопитающих известны пять членов Rel-семейства. Это c-Rel, NF-kappaB1 (p105/p50), NF-kappaB2 (p100/p52), RelA (p65) и RelB. Теоретически эти пять членов семейства Rel-протеинов можно комбинировать в любой форме до гомо- и гетеродимеров, хотя in vivo были обнаружены только некоторые определенные комбинации. В случае классической и лучше всего охарактеризованной молекулы NF-kappaB речь идет о гетеродимере субъединиц р50/р65 NF-kappaB1/RelA. Этот гетеродимер представляет собой чаще всего встречающийся комплекс и находится практически во всех типах клеток.

После клеточной активации и диссоциации I-kappaB, гетеродимер р50/р65 NF-kappaB мигрирует в клеточное ядро и связывается там с консенсусной последовательностью 5'-GGGRNNYYCC-3'. При этом субъединица р50 служит преимущественно в качестве ДНК-связывающей субъединицы, в то время как субъединица р65 выполняет функцию трансактивации.

Каждый из гетеродимеров за счет различных комбинаций проявляет единственные в своем роде свойства, касающихся специфичности типа клеток, предпочтений в отношении ДНК-связи, дифференциальных взаимодействий с изоформами I-kappaB, дифференциальных потребностей активации и кинетики активации.

Быструю индуцируемость NF-kappaB объясняют тем, что фактор в цитоплазме клетки находится в неактивной форме, а именно связанным I-kappaB в комплекс с ингибитором NF-kappaB. Для активации поэтому не нужен новый синтез протеина, а необходимым является лишь разрушение комплекса с I-kappaB, соответственно, ликвидация этого ингибитора и последующая транслокация активных после этого димеров NF-kappaB в ядро.

NF-kappaB можно активировать за счет обширного множества физиологических и нефизиологических стимуляторов. Они включают цитокины, митогены, вирусы, вырабатываемые вирусами продукты, сшивку рецепторов антигенов с Т- и В-лимфоцитами, кальциевые ионофоры, форболовые сложные эфиры, ультрафиолетовые лучи, окислительный стресс, ингибиторы фосфатазы и другие. Равным образом, обширным является множество регулируемых или активируемых NF-kappaB генов, транскрипция которых активируется, индуцируется или усиливается за счет связи гетеродимера с консенсусной последовательностью, как описано выше. В качестве важных стимуляторов можно в особенности назвать альфа-фактор некроза опухоли, интерлейкин-1, интерлейкин-2 и липополисахариды.

Ген-регуляторы охватывают, в общем, гены, которые принимают участие в иммунной функции, ответной реакции на воспаление, клеточной адгезии, росте клетки, однако также гибели клетки. В настоящем описании в особенности можно назвать гены клеточных адгезионных молекул, цитокины, рецепторы цитокинов, протеины острых фаз, факторы роста, а также вирусные гены. К генам, которые индуцируются с помощью NF-kappaB, относятся в особенности гены бета-интерферона, легкой цепи иммуноглобулина, Т-клеточного рецептора, альфа-фактора некроза опухоли и бета-фактора некроза опухоли, а также тканевого фактора (CD142), ранее обозначаемого как тканевый тромбопластин или фактор III.

Из-за своего, явствующего из вышеуказанного, центрального места в регуляции иммунных реакций и ответных реакций на воспаление, а также из-за участия в регуляции тканевых факторов, цитокинов и т.д., предполагают, что от создания селективных ингибиторов фактора транскрипции NF-kappaB можно ожидать подобных преимуществ, которые уже известны для ингибирующих воспаление биологически активных веществ. В данном случае можно назвать, например, стероидальные ингибиторы воспаления, интерфероны или циклоспорин.

Неожиданно было обнаружено, что отдельные производные фумаровой кислоты или их смеси обладают ингибирующим действием в отношении NF-kappaB. Это действие предпочтительно можно использовать для приготовления фармацевтической композиции, содержащей эти производные фумаровой кислоты индивидуально или в смеси, для лечения опосредованных, а также поддающихся влиянию NF-kappaB заболеваний. В случае опосредованных NF-kappaB заболеваний речь идет в особенности о прогрессирующей системной склеродермии, сифилитическом остеохондрите (болезнь Вегера), Cutis marmorata, (Livedo Reticularis), болезни Бехчета, панартериите, неспецифическом язвенном колите, васкулите, остеоартрите, подагре, артериосклерозе, синдроме Рейтера, бронхолегочном грануломатозе, типах энцефалита, эндотоксическом шоке (септически-токсический шок), сепсисе, пневмонии, энцефаломиелите, нервно-психической анорексии, гепатите (как острый гепатит, хронический гепатит, токсический гепатит, вызванный алкоголем гепатит, вирусный гепатит, желтуха, печеночная недостаточность и цитомегаловирусный гепатит), Т-лимфоматозе Реннерта, мезангиальном нефрите, постангиопластическом рестенозе, реперфузионном синдроме, цитомегаловирусной ретинопатии, аденовирусных заболеваниях, как аденовирусные простудные заболевания, аденовирусная фарингоконъюнктивальная лихорадка и аденовирусная офтальмия, СПИДе, синдроме Гийена-Барре, постгерпетической невралгии или невралгии после опоясывающего лишая, воспалительной демиелинизирующей полиневропатии, множественных мононевропатиях, муковисцидозе, болезни Бехтерева, язве пищевода Бэррета, инфекции вирусом Эпстайна-Барра (EBV), кардиальном ремоделировании, интерстициальном цистите, сахарном диабете типа II, радиосенсибилизируемых злокачественных опухолях, частой резистентности злокачественных клеток к химиотерапевтическим средствам (резистентность ко многим лекарственным средствам в химиотерапии), кольцевидных гранулемах и онкологических заболеваниях, таких как рак молочной железы, рак ободочной кишки, меланома, первичная карцинома печеночных клеток, аденокарцинома, саркома Капоши, рак предстательной железы, лейкозы, такие как острый миелоидный лейкоз, множественная миелома (плазмоцитома), лимфома Беркитта и опухоль Кастлемана.

Согласно изобретению для ингибирования NF-kappaB, а также для приготовления фармацевтической композиции предпочтительно используют одно или несколько производных фумаровой кислоты, выбираемых из группы, состоящей из диалкиловых эфиров фумаровой кислоты и моноалкиловых эфиров фумаровой кислоты, в форме свободной кислоты или в солевой форме, и их смесей.

Диалкиловые эфиры фумаровой кислоты предпочтительно соответствуют формуле

производные фумаровой кислоты в качестве ингибитора nf-kappab, патент № 2282440

в которой R1 и R2, которые соответственно могут быть одинаковыми или разными, означают, независимо друг от друга, линейную, разветвленную, насыщенную или ненасыщенную (С124)-алкильную группу или (С550)-арильную группу, и эти группы незамещены или замещены атомом галогена (F, Cl, Br, I), гидроксилом, (С14)-алкоксилом, нитрогруппой или цианогруппой.

В случае остатков R1 и R2 речь идет предпочтительно о метиле, этиле, н-пропиле, изопропиле, н-бутиле, втор-бутиле, трет-бутиле, пентиле, циклопентиле, 2-этилгексиле, гексиле, циклогексиле, гептиле, циклогептиле, октиле, виниле, аллиле, 2-гидроксиэтиле, 2- или 3-гидроксипропиле, 2,3-дигидроксипропиле, метоксиметиле, 2-метоксиэтиле или 2- или 3-метоксипропиле.

Моноалкиловые эфиры фумаровой кислоты предпочтительно соответствуют формуле

производные фумаровой кислоты в качестве ингибитора nf-kappab, патент № 2282440

в которой R1 означает вышеуказанную группу; А означает атом водорода, катион щелочного или щелочноземельного металла или физиологически приемлемый катион переходного металла, предпочтительно выбираемый среди Li+, Na+ , K+, Mg2+, Ca2+, Zn2+ , Fe2+ и Mn2+, и n равно 1 или 2 и соответствует валентности А.

Согласно изобретению предпочтительно применяют одно или несколько производных фумаровой кислоты, выбираемых из группы, состоящей из диметилового эфира фумаровой кислоты, диэтилового эфира фумаровой кислоты, метилэтилового эфира фумаровой кислоты, метилгидрофумарата, этилгидрофумарата, метилфумарата магния, этилфумарата магния, метилфумарата цинка, этилфумарата цинка, метилфумарата железа, этилфумарата железа, метилфумарата кальция и этилфумарата кальция.

Для приготовления фармацевтической композиции согласно изобретению используют производные фумаровой кислоты предпочтительно в таком количестве, что эта фармацевтическая композиция содержит на разовую дозу количество одного или нескольких производных фумаровой кислоты, соответствующее или эквивалентное количеству 1-500 мг, предпочтительно 10-300 мг и чаще всего предпочтительно 10-200 мг фумаровой кислоты.

Предпочтительны применения, в случае которых фармацевтическую композицию вводят перорально, парентерально, ректально, трансдермально, назально, пульмонально (ингаляция) или офтальмологическим путем (в форме глазных капель), причем предпочтительно пероральное введение. Композиция тогда находится в пригодной для соответствующего введения форме.

Если вводят перорально, то фармацевтическая композиция согласно изобретению предпочтительно находится в форме таблеток с одной разовой дозой, микротаблеток (таблетки с составной разовой дозой) или минитаблеток, микропилюль, или гранулята, капсул или растворов для питья, причем микротаблетки, пилюли или гранулят в случае необходимости инкапсулированы или расфасованы в пакетики. Если речь идет о твердых лекарственных формах или соответственно формах введения, то согласно предпочтительной форме выполнения их снабжают резистентным к кислоте желудочного сока покрытием. Покрытие может быть предусмотрено также для инкапсулированных, соответственно, расфасованных лекарственных форм.

При парентеральном введении путем инъекции (внутривенно, внутримышечно, подкожно, интраперитонеально) композиция находится в пригодной для этого форме. Можно использовать все обычные жидкие пригодные для инъекций носители.

Предлагаемая согласно изобретению композиция может содержать, индивидуально или в смеси, предпочтительно 10-500 мг диалкилфумарата, в особенности диметилфумарата и/или диэтилфумарата, 10-500 мг алкилфумарата кальция, в особенности метилфумарата кальция и/или этилфумарата кальция, 0-250 мг алкилфумарата цинка, в особенности метилфумарата цинка и/или этилфумарата цинка, 0-250 мг алкилгидрофумарата, в особенности метилгидрофумарата и/или этилгидрофумарата, и 0-250 мг алкилфумарата магния, в особенности метилфумарата магния и/или этилфумарата магния, причем сумма указанных количеств соответствует эквиваленту 10-500 мг, предпочтительно 10-300 мг и чаще всего предпочтительно 100 мг фумаровой кислоты.

Предпочтительные композиции согласно изобретению содержат исключительно диметилфумарат в количестве 10-300 мг.

Согласно особенно предпочтительной форме выполнения изобретения фармацевтическая композиция находится в форме микротаблеток или микропилюль. Они предпочтительно имеют размер, соответственно средний диаметр, производные фумаровой кислоты в качестве ингибитора nf-kappab, патент № 2282440 5000 мкм, предпочтительно 300-2500 мкм, в особенности 300-1000 мкм для пилюль и 1000-2500 мкм для микротаблеток. Путем введения производных фумаровой кислоты в виде микротаблеток, которое является предпочтительным согласно изобретению, можно далее уменьшать не исключаемые при приеме обычных таблеток с одной разовой дозой желудочно-кишечные раздражения, а также побочные действия. Это основано, вероятно, на том, что микротаблетки, предпочтительно резистентные к желудочному соку микротаблетки, распределяются уже в желудке и таким образом порциями попадают в кишечник, где биологически активные вещества высвобождаются в одинаковой, в целом, дозировке в виде локально более маленьких доз. Благодаря этому можно избегать локального раздражения эпителиальных клеток кишечника, откуда следует лучшая совместимость с желудочно-кишечным трактом микротаблеток по сравнению с обычными таблетками.

Содержащиеся в предлагаемых согласно изобретению композициях производные фумаровой кислоты получают, например, согласно описанному в Европейском патенте ЕР 0312679 способу.

Примеры приготовления

Предлагаемые согласно изобретению пероральные композиции в форме таблеток или микротаблеток в принципе можно получать согласно классическим способам таблетирования. Вместо этих классических способов таблетирования для получения таблеток можно также использовать другие способы получения таблеток, такие как прямое таблетирование, а также способы приготовления твердых дисперсий путем плавления и распылительной сушки.

Таблетки могут быть снабжены резистентными к кислоте желудочного сока покрытиями. Резистентное к желудочному соку покрытие можно наносить или напылять в классическом дражировочном аппарате. Нанесение покрытия, однако, можно осуществлять также в электродуговом аппарате для нанесения покрытия. Далее, таблетку можно снабжать пленочным покрытием.

Для пояснения предлагаемого согласно изобретению применения ниже приводятся различные примеры приготовления предпочтительных лекарственных средств. Примеры должны лишь пояснять настоящее изобретение, не ограничивая, однако, его объема охраны.

Пример 1

Получение таблеток с резистентным к кислоте желудочного сока покрытием, содержащих 100,0 мг монометилфумарата кальция, соответствующих 78 мг фумаровой кислоты.

10 кг Монометилфумарата кальция размельчают, интенсивно перемешивают и при соответствующих мерах предосторожности (дыхательная маска, перчатки, защитная одежда и т.д.) гомогенизируют посредством сита 800. Затем готовят смесь вспомогательных веществ следующего состава: 21 кг производного крахмала (STA-RX 1500® ), 2 кг микрокристаллической целлюлозы (Avicel PH 101® ), 0,6 кг поливинилпирролидона (PVP, Kollidon® 25), 4 кг Primogel®, 0,3 кг коллоидальной кремневой кислоты (Aerosil®).

Всю порошковую смесь смешивают с биологически активным веществом, перемешивают, гомогенизируют посредством сита 200 и с помощью 2%-ного водного раствора поливинилпирролидона (PVP, Kollidon®25) обычным образом перерабатывают в гранулят связующего и сухом состоянии смешивают с внешней фазой. Она состоит из 2 кг так называемого FST-комплекса, содержащего 80% талька, 10% кремневой кислоты и 10% стеарата магния.

Затем обычным образом прессуют с получением выпуклых таблеток массой 400 мг и диаметром 10,0 мм. Вместо этих классических способов таблетирования можно также использовать другие способы для получения таблеток, такие как прямое таблетирование, а также приготовление твердых дисперсий путем плавления и распылительной сушки.

Резистентность к желудочному соку

Готовят раствор 2,250 кг гидроксипропилметилцеллюлозофталата (НРМСР, Pharmacoat HP ®50) в смеси растворителей из 2,50 л деминерализованной воды, 13 л ацетона (Ph. Helv. VII) и 13 л этанола (94 масс.%-ного) и раствор смешивают с 0,240 кг касторового масла (Ph. Eur. II). Раствор в дражировочном аппарате обычным образом порциями наносят или напыляют на ядра таблеток, соответственно, наносят в аппарате с псевдоожиженным слоем соответствующей конструкции.

После соответствующего высушивания затем наносят пленочное покрытие. Оно состоит из раствора 4,8 кг 12,5%-ного Eudragit E® , 0,34 кг талька (Ph. Eur. II), 0,52 кг оксида титана-(VI) (Cronus RN 56®), 0,21 кг синего фарблака ZLT-2 (Siegle) и 0,12 кг полиэтиленгликоля 6000 (Ph. Helv. VII) в смеси растворителей из 8,2 кг пропан-2-ола (Ph. Helv. VII), 0,06 кг глицеринтриацетата (Triacetin®) и 0,2 кг деминерализованной воды. После гомогенного распределения в дражировочном аппарате или псевдоожиженном слое высушивают и обычным образом полируют.

Пример 2

Получение резистентных к желудочному соку капсул, содержащих 86,5 мг моноэтилфумарата кальция и 110,0 мг диметилфумарата, соответственно, в целом 150 мг фумаровой кислоты

8,65 кг Моноэтилфумарата кальция и 11 кг диметилфумарата интенсивно перемешивают со смесью, состоящей из 15 кг крахмала, 6 кг лактозы (Ph. Helv. VII), 2 кг микрокристаллической целлюлозы (Avicel® ), 1 кг поливинилпирролидона (Kollidon®25) и 4 кг Primogel®, и при соответствующих мерах предосторожности (дыхательная маска, перчатки, защитная одежда и т.д.) гомогенизируют посредством сита 800.

Всю порошковую смесь обычным образом с помощью 2%-ного водного раствора поливинилпирролидона (Kollidon ®25) перерабатывают в гранулят связующего и в высушенном состоянии смешивают с внешней фазой. Она состоит из 0,35 кг коллоидальной кремневой кислоты (Aerosil®), 0,5 кг стеарата магния и 1,5 кг талька (Ph. Helv. VII). Гомогенную смесью затем расфасовывают в соответствующие капсулы порциями по 500,0 мг, которые затем обычным образом снабжают резистентным к желудочному соку покрытием, состоящим из гидроксипропилэтилцеллюлозофталата и касторового масла в качестве мягчителя. Расфасовку можно также осуществлять вместо твердых желатиновых капсул в соответствующие резистентные к желудочному соку капсулы, состоящие из смеси ацетатфталата целлюлозы (САР) и гидроксипропилэтилцеллюлозофталата (НРМСР).

Пример 3

Получение резистентных к желудочному соку микротаблеток в капсулах, содержащих 87,0 мг моноэтилфумарата кальция, 120 мг диметилфумарата, 5,0 мг моноэтилфумарата магния и 3,0 мг моноэтилфумарата цинка, соответственно, в целом 164 мг фумаровой кислоты (таблетки "форте").

8,7 кг Моноэтилфумарата кальция, 12 кг диметилфумарата, 0,5 кг моноэтилфумарата магния, 0,3 кг моноэтилфумарата цинка размельчают, интенсивно перемешивают и гомогенизируют посредством сита 800 при соответствующих мерах предосторожности (дыхательная маска, перчатки, защитная одежда и т.д.). Готовят смесь вспомогательных веществ следующего состава: 18 кг производного крахмала (STA-RX 1500), 0,3 кг микрокристаллической целлюлозы (Avicel PH 101), 0,75 кг поливинилпирролидона (Kollidon 120), 4 кг примогеля, 0,25 кг коллоидальной кремневой кислоты (Aerosil). Всю порошковую смесь смешивают со смесью биологически активных веществ и гомогенизируют посредством сита 200 и с помощью 2%-ного водного раствора поливинилпирролидона (Kollidon K25) обычным образом перерабатывают в гранулят связующего и в сухом состоянии смешивают с внешней фазой. Она состоит из 0,5 кг стеарата магния и 1,5 кг талька. Порошковую смесь затем обычным образом прессуют с получением выпуклых микротаблеток брутто-массой 10,0 мг и диаметром 2,0 мм. Вместо этого классического способа таблетирования для получения таблеток можно также использовать другие способы, как прямое таблетирование, а также приготовление твердых дисперсий путем плавления и распылительной сушки.

Резистентное к желудочному соку покрытие можно наносить или напылять в классическом дражировочном аппарате, а также наносить в аппарате с псевдоожиженным слоем. Для достижения резистентности к желудочному соку порциями напыляют раствор 2,250 кг гидроксипропилметилцеллюлозофталата (НРМСР, Pharmacoat HP 50) в смеси следующих растворителей: 13 л ацетона, 13,5 л 94 масс.%-ного этанола, денатурированного с помощью 2% кетона, и 2,5 л деминерализованной воды. К готовому раствору добавляют 0,240 кг касторового масла в качестве мягчителя и обычным образом порциями наносят на ядра таблеток.

Пленочное покрытие: по окончании высушивания затем в том же самом аппарате в качестве пленочного покрытия наносят суспензию следующего состава: 0,340 кг талька, 0,4 кг оксида титана-(VI) (Cronus RN 56), 0,324 кг фарблака L-красный лак 86837, 4,8 кг 12,5%-ного Eudragit Е ® и 0,12 кг полиэтиленгликоля 6000, рН 11, XI, в смеси растворителей следующего состава: 8,17 кг пропан-2-ола, 0,2 кг деминерализованной воды и 0,6 кг глицеринтриацетата (триацетин).

Резистентные к желудочному соку микротаблетки затем расфасовывают в разъемные твердые желатиновые капсулы нетто-массой по 500,0 мг и капсулы закрывают.

Пример 4

Получение резистентных к желудочному соку микротаблеток в капсулах,содержащих 120,0 мг диметилфумарата, соответственно, 96 мг фумаровой кислоты.

12 кг Диметилфумарата размельчают и гомогенизируют посредством сита 800 при соответствующих мерах предосторожности (дыхательная маска, перчатки, защитная одежда и т.д.). Готовят смесь вспомогательных веществ следующего состава: 17,5 кг производного крахмала (STA-RX ® 1500), 0,30 кг микрокристаллической целлюлозы (Avicel ® PH 101), 0,75 кг поливинилпирролидона (Kollidon ® 120), 4 кг Primogel®, 0,25 кг коллоидальной кремневой кислоты (Aerosil®). Всю порошковую смесь смешивают с биологически активным веществом, гомогенизируют посредством сита 200 и с помощью 2%-ного водного раствора поливинилпирролидона (Kollidon® K25) обычным образом перерабатывают в гранулят связующего и в сухом состоянии смешивают с внешней фазой. Она состоит из 0,5 кг стеарата магния и 1,5 кг талька.

Порошковую смесь затем обычным образом прессуют с получением выпуклых микротаблеток брутто-массой 10,0 мг и диаметром 2,0 мм.

Для достижения резистентности к кислоте желудочного сока в данном случае, например, порциями напыляют раствор 2,25 кг гидроксипропилметилцеллюлозофталата (НРМСР, Pharmacoat ® HP 50) в смеси следующих растворителей: 13 л ацетона, 13,5 л 94 мас.%-ного, денатурированного с помощью 2% кетона, этанола, и 1,5 л деминерализованной воды. К готовому раствору добавляют 0,24 кг касторового масла в качестве мягчителя и обычным образом порциями наносят на ядра таблеток.

По окончании высушивания затем в том же самом аппарате в качестве пленочного покрытия наносят суспензию следующего состава: 0,34 кг талька, 0,4 кг оксида титана-(VI) (Cronus RN 56), 0,324 кг фарблака L-красный лак 86837, 4,8 кг 12,5%-ного Eudragit Е® и 0,12 кг полиэтиленгликоля 6000, рН 11, XI, в смеси растворителей следующего состава: 8,17 кг пропан-2-ола, 0,2 кг деминерализованной воды и 0,6 кг глицеринтриацетата (триацетин).

Резистентные к кислоте желудочного сока микротаблетки затем расфасовывают в разъемные твердые желатиновые капсулы нетто-массой по 400 мг и капсулы закрывают.

Пример 5

Получение резистентных к желудочному соку микротаблеток в капсулах, содержащих 120,0 мг диметилфумарата, соответственно, 96 мг фумаровой кислоты.12 кг Диметилфумарата размельчают и гомогенизируют как описано выше. Готовят смесь вспомогательных веществ следующего состава: 23,2 кг микрокристаллической целлюлозы (Avicel® PH 200), 3 кг натрийкроскармелозы (AC-Di-SOL-SD-711), 2,5 кг талька, 0,1 кг безводного диоксида кремния (Aerosil® 200) и 1 кг стеарата магния. Всю порошковую смесь смешивают с биологически активным веществом и перемешивают до гомогенности.

Порошковую смесь затем прессуют посредством прямого таблетирования с получением выпуклых таблеток брутто-массой 10,0 мг и диаметром 2,0 мм.

Затем готовят раствор 0,94 кг Eudragit® L в изопропаноле, который содержит дополнительно 0,07 кг дибутилфталата. Этот раствор наносят путем опрыскивания на ядра таблеток. После этого готовят дисперсию из 17,32 кг Eudragit® L D-55 и смеси из 2,8 кг микроталька, 2 кг макрогола 6000 и 0,07 кг диметикона в воде и наносят путем опрыскивания на ядра.

Резистентные к кислоте желудочного сока микротаблетки затем расфасовывают в разъемные твердые желатиновые капсулы нетто-массой по 650 мг и капсулы закрывают.

Пример 6

Транслокация NF-kappaB в клетки

NF-kappaB (p65) встраивали в вектор pEGFP-C1, который содержал EGFP (флуоресцирующий зеленым протеин), связанный с промотором цитомегаловируса (Clontech). Это приводит к экспрессии флуоресцирующего NF-kappaB. Между третьим и пятым пассажем производили посев клеток HUVEC в покрытые желатиной двенадцатилуночные культуральные планшеты (Costar) и оставляли расти до 80%-ной, соответственно, 90%-ной конфлюенции. Клетки затем трансфицировали по способу преципитации фосфатом кальция. Более конкретно, для этого клетки кондиционировали с помощью модифицированной по способу Дульбекко среды Игла (DMEM), спустя 2 часа добавляли содержащий 1 мкг ДНК на лунку преципитат и клетки инкубировали в течение следующих 4 часов. После промывки с помощью сбалансированного солевого раствора Хенкса (HBSS) добавляли культуральную среду и клетки, до их стимуляции, оставляли расти в течение следующих 18 часов.

Для опытов, клетки кондиционировали с помощью 40 мкмоль/л диметилфумарата (DMF), причем параллельные смеси без ДНК служили в качестве контроля. Спустя 2 часа после начала кондиционирования клетки стимулировали с помощью 10 нг/мл альфа-фактора некроза опухоли в указанные в таблице 1 периоды времени.

Клетки затем лизировали, супернатант отбрасывали и клеточные ядра аккумулировали в буфере Dounce с ингибиторами протеазы (10 ммоль трис-HCl, рН 7,6; 0,5 ммоль, MgCl2; 10 мкг/мл лейпептина, 10 мкг/мл апротинина, 1 ммоль фенилметилсульфонилфторида, 1,8 мг/мл иодацетамида). После центрифугирования в течение 10 минут при ускорении 1200 g и температуре 4°С клеточные ядра анализировали на сканирующем проточном клеточном цитометре с возбуждением флуоресценции (Becton Dickinson).

Таблица 1
Количество NF-kappaB(p65)-положительных ядер (данные в процентах относятся ко всем, трансфицированным с помощью NF-kappaB клеткам)
Продолжительность стимуляции КонтрольDMF(40 мкМ/л, n=3)
0 мин30+/-3 29+/-5
10 мин 61+/-520+/-4
30 мин50+/-625+/-6
60 мин55+/-10 24+/-9

Из таблицы видно, что диметилфумарат в концентрации 40 мкМ/л ингибирует индуцированную фактором некроза опухоли транслокацию NF-kappaB в клеточное ядро.

Пример 7

Ингибирование стимулированной NF-kappaB транскрипции

Трехкратный повтор консенсусного сайта АР-1 (место связывания) (48 пар оснований, 3 х TGTGATGACTCAGGTT) и трехкратный повтор консенсусного сайта NF-kappaB (60 пар оснований, 3 х AATCGTGGAATTTCCTCTGA), фланкированного местами связывания SpeI (не показано), встраивали в сайт SpeI вектора pTK-UBT-luc (Martin, Gene, 124, 137-138 (1993)). Конструкцию длиной 1,3 тысяч пар нуклеотидов Е-селектинового промотора протяженностью от -1285 пар оснований до +482 пар оснований встраивали в сайт NdeI вектора pMAM Neo-luc (Clontech).

Клетки HUVEC трансфицировали, как описано в примере 6, с помощью таким образом полученных конструкций. Для трансфекции на лунку добавляли 2,5 мкг соответствующей промоторной конструкции. Для проверки эффективности трансфекции в каждом эксперименте в качестве контроля осуществляли котрансфекции с помощью 500 нг контрольного вектора pSV-бета галактозидаза (Promega Corp., Madison, WI, США). Спустя 2 дня после трансфекции клетки стимулировали в течение 2 часов с помощью 10 нг/мл альфа-фактора некроза опухоли с добавкой и без добавки 6 мкг/мл диметилфумарата (DMF). Клетки затем собирали путем трипсинизации, центрифугировали, промывали и ресуспендировали в 200 мкл "репортерлизирующего буфера" (Promega) в течение 15 минут согласно инструкциям изготовителя.

Люциферазную активность определяли с помощью люминометра Berthold AutoLumat LB 9507 при использовании люциферазной тест-системы (Promega). Активность бета-галактозидазы определяли при использовании бета-галактозидазной ферментной системы фирмы Promega. Полученные с соответствующими промоторными конструкциями люциферазные активности стандартизировали до бета-галактозидазной активности. Ширина отклонений бета-галактозидазной активности в отдельных экспериментах составляла менее 10%. В таблице 2 представлены соответствующие результаты в виде х-кратных по отношению к базисной линии.

Таблица 2
Повышение транскрипции
(Относительное повышение люциферазной активности (определенное в виде х-кратного увеличения по отношению к базисной линии) после стимуляции фактором некроза опухоли (TNF) (10 нг/мл) с помощью 40 мкМ/л диметилфумарата (DMF) или без него, n=6)
УсловияNF-kappaB AP-1
TNF6+/-3 2,2+/-0,5
TNF+DMF 2+/-12+/-0,1

Из таблицы 2 видно, что диметилфумарат ингибирует индуцированную TNF транскрипцию NF-kappaB-зависимого гена, но не транскрипцию AP-1-зависимого гена. Ингибирование диметилфумаратом поэтому является NF-kappaB-специфическим.

ФОРМУЛА ИЗОБРЕТЕНИЯ

1. Применение одного или нескольких диалкиловых эфиров фумаровой кислоты и моноалкиловых эфиров фумаровой кислоты в качестве специфического ингибитора транскрипции NF-kappaB-зависимого гена в фармацевтической композиции для лечения заболеваний, опосредованных NF-kappaB, выбранных из группы, включающей лечение прогрессирующей системной склеродермии, сифилитического остеохондрита (болезнь Вегера), Cutis marmorata (Livedo Reticularis), болезни Бехчета, панартериита, неспецифического язвенного колита, васкулита, остеоартрита, подагры, артериосклероза, синдрома Рейтера, бронхолегочного грануломатоза, типов энцефалита, эндотоксического шока (септически-токсический шок), сепсиса, пневмонии, энцефаломиелита, нервно-психической анорексии, Т-лимфоматоза Реннерта, мезангиального нефрита, постангиопластического рестеноза, цитомегаловирусной ретинопатии, аденовирусных заболеваний, как аденовирусные простудные заболевания, аденовирусная фарингоконъюнктивальная лихорадка и аденовирусная офтальмия, СПИДа, синдрома Гийена-Барре, постгерпетической невралгии или невралгии после опоясывающего лишая, воспалительной демиелинизирующей полиневропатии, множественных мононевропатий, муковисцидоза, болезни Бехтерева, язвы пищевода Бэррета, инфекции вирусом Эпстайна-Барра (EBV), кардиального ремоделирования, интерстициального цистита, сахарного диабета типа II, радиосенсибилизируемых злокачественных опухолей, частой резистентности злокачественных клеток к химиотерапевтическим средствам (резистентность ко многим лекарственным средствам в химиотерапии), кольцевидных гранулем и онкологических заболеваний, как рак молочной железы, рак ободочной кишки, меланома, первичная карцинома печеночных клеток, аденокарцинома, саркома Капоши, рак предстательной железы, лейкозы, как острый миелоидный лейкоз, множественная миелома (плазмоцитома), лимфома Беркитта и опухоль Кастлемана.

2. Применение по п.1, в котором диалкиловый эфир фумаровой кислоты соответствует формуле

производные фумаровой кислоты в качестве ингибитора nf-kappab, патент № 2282440

где R1 и R2 могут быть одинаковыми или разными и означают независимо друг от друга линейную, разветвленную, циклическую насыщенную или ненасыщенную (С 124)-алкильную группу или (С5 20)-арильную группу и эти группы незамещены или замещены атомом галогена (F, Cl, Br, I), гидроксилом, (С1 4)-алкоксилом, нитрогруппой или цианогруппой.

3. Применение по п.1 или 2, отличающееся тем, что в случае остатков R1 и R2 речь идет о метиле, этиле, н-пропиле, изопропиле, н-бутиле, втор-бутиле, трет-бутиле, пентиле, циклопентиле, 2-этилгексиле, гексиле, циклогексиле, гептиле, циклогептиле, октиле, виниле, аллиле, 2-гидроксиэтиле, 2- или 3-гидроксипропиле, 2,3-дигидроксипропиле, 2-метоксиэтиле, метоксиметиле или 2- или 3-метоксипропиле.

4. Применение по п.1, в котором моноалкиловый эфир фумаровой кислоты соответствует формуле

производные фумаровой кислоты в качестве ингибитора nf-kappab, патент № 2282440

где R1 имеет указанное в п.2 или 4 значение;

А означает атом водорода, катион щелочного или щелочноземельного металла или физиологически приемлемый катион переходного металла, предпочтительно выбранный из Li+ , Na+, K+, Mg2+, Са2+ , Zn2+, Fe2+ и Mn2+, и n равно 1 или 2 и соответствует валентности А.

5. Применение по любому из пп.1-4, отличающееся тем, что разовая доза фармацевтической композиции содержит производное (производные) фумаровой кислоты в количестве, соответствующем 1-500 мг, предпочтительно 10-300 мг и наиболее предпочтительно 10-200 мг фумаровой кислоты.

6. Применение по любому из пп.1-5 для приготовления фармацевтической композиции для орального, парентерального, ректального, трансдермального, назального, пульмонального (ингаляция) или офтальмологического введения, предпочтительно для перорального введения.

7. Применение по п.6, в котором фармацевтическая композиция для перорального введения находится в форме таблеток с разовой дозой, микротаблеток, микропилюль и, соответственно, гранулята, капсул или растворов для питья, причем микротаблетки, микропилюли или гранулят, в случае необходимости, инкапсулированы или расфасованы в пакетики.

8. Применение по п.7, отличающееся тем, что твердые лекарственные формы снабжены резистентным к желудочному соку покрытием.

9. Применение по п.1, отличающееся тем, что полученные разовые дозы фармацевтической композиции, индивидуально или в смеси, предпочтительно содержат

10-500 мг диалкилфумарата, в особенности диметилфумарата и/или диэтилфумарата,

10-500 мг алкилфумарата кальция, в особенности метилфумарата кальция и/или этилфумарата кальция,

0-250 мг алкилфумарата цинка, в особенности метилфумарата цинка и/или этилфумарата цинка,

0-250 мг алкилгидрофумарата, в особенности метилгидрофумарата и/или этилгидрофумарата, и

0-250 мг алкилфумарата магния, в особенности метилфумарата магния и/или этилфумарата магния,

причем сумма указанных количеств соответствует эквиваленту 10-500 мг, предпочтительно 10-300 мг и наиболее предпочтительно 100 мг фумаровой кислоты.

10. Применение по п.7 или 8, отличающееся тем, что композиция находится в форме микротаблеток или микопилюль размером производные фумаровой кислоты в качестве ингибитора nf-kappab, патент № 2282440 5000 мкм и предпочтительно размером 300-1000 мкм для пилюль и 1000-2500 мкм для микротаблеток.


Скачать патент РФ Официальная публикация
патента РФ № 2282440

patent-2282440.pdf
Патентный поиск по классам МПК-8:

Класс A61K31/194  имеющие две или более карбоксильных группы, например янтарная, малеиновая или фталевая кислота

Патенты РФ в классе A61K31/194:
тиолсодержащие соединения для удаления элементов из загрязненной окружающей среды и способы их применения -  патент 2528396 (20.09.2014)
способ получения комплексного иммунометаболического препарата с антиинфекционной активностью -  патент 2527329 (27.08.2014)
способ предоперационной коррекции дыхательных расстройств у больных колоректальным раком -  патент 2526828 (27.08.2014)
способ получения комплексного антибактериального иммуномодулирующего препарата -  патент 2526184 (20.08.2014)
травяной состав местного применения для лечения акне и кожных расстройств -  патент 2526138 (20.08.2014)
способ лечения больных облитерирующими заболеваниям и артерий нижних конечностей -  патент 2523412 (20.07.2014)
препарат для стимуляции обменных процессов, профилактики и лечения желудочно-кишечных заболеваний телят в ранний постнатальный период -  патент 2521369 (27.06.2014)
раствор для бикарбонатного гемодиализа -  патент 2521361 (27.06.2014)
способ лечения гриппа и гриппоподобных заболеваний, осложненных пневмонией -  патент 2518277 (10.06.2014)
способ определения степени тяжести течения мочекислого уролитиаза -  патент 2517221 (27.05.2014)

Класс A61K31/225  поликарбоновые кислоты

Патенты РФ в классе A61K31/225:
соединение сальвианоловой кислоты л, способ его приготовления и применения -  патент 2529491 (27.09.2014)
соединения для применения в визуализации, диагностике и/или лечении заболеваний центральной нервной системы или опухолей -  патент 2505528 (27.01.2014)
фармацевтическая композиция для чистки кишечника -  патент 2472527 (20.01.2013)
эксплантодренаж для антиглаукоматозных вмешательств -  патент 2434614 (27.11.2011)
производные ретиналя и способы их применения для лечения нарушений зрения -  патент 2408578 (10.01.2011)
двойные сложные эфиры -  патент 2350599 (27.03.2009)
композиция на основе этиллинолеата и триэтилцитрата для лечения себореи и угрей -  патент 2313338 (27.12.2007)
способ лечения наркотических зависимостей -  патент 2288717 (10.12.2006)
гемостатический клей -  патент 2270016 (20.02.2006)
фармацевтическая композиция (варианты), не содержащая белков и пептидов, для нейтрализации и/или удаления эндотоксинов из организма -  патент 2248796 (27.03.2005)

Класс A61P43/00 Лекарственные средства для специфических целей, не указанные в группах  1/00

Патенты РФ в классе A61P43/00:
улучшение памяти у пациентов с оценкой 24-26 баллов по краткой шкале оценки психического статуса -  патент 2529815 (27.09.2014)
способ лечения больных с синдромом внутрипеченочной портальной гипертензии -  патент 2529414 (27.09.2014)
способ лечения ран мягких тканей различной этиологии -  патент 2528905 (20.09.2014)
хиназолиноны как ингибиторы пролилгидроксилазы -  патент 2528412 (20.09.2014)
новый агонист бета рецептора тиреоидного гормона -  патент 2527948 (10.09.2014)
стабильная жидкая фармацевтическая композиция комплекса 3-(2,2,2-триметилгидразиний) пропионат-2-этил-6-метил-3-гидроксипиридина дисукцината, обладающая антигипоксическим, антиоксидантным и адаптогенным действием -  патент 2527347 (27.08.2014)
четырехзамещенные бензолы -  патент 2527177 (27.08.2014)
способ коррекции негативных эффектов низких температур на предстательную железу крыс -  патент 2527172 (27.08.2014)
способ модулирования биологических функций, ассоциированных с процессом старения пожилого или старого животного-компаньона. -  патент 2525617 (20.08.2014)
гомографт сердечно-сосудистой системы (варианты), способ получения гомографта, среда для воздействия на ткани гомографта (варианты) -  патент 2525197 (10.08.2014)


Наверх