Поиск патентов
ПАТЕНТНЫЙ ПОИСК В РФ

глюкопиранозилоксибензилбензольные производные, лекарственные композиции, содержащие эти производные, и промежуточные соединения для получения указанных производных

Классы МПК:C07H15/203 моноциклические карбоциклические кольца, кроме циклогексановых; бициклические карбоциклические системы
C07C69/78 эфиры бензойной кислоты 
C07C69/16 диоксисоединений 
C07C69/18 триоксисоединений 
C07C323/18 с атомом серы по меньшей мере одной из тиогрупп, присоединенным к атому углерода шестичленного ароматического кольца углеродного скелета
C07C39/04 фенол 
A61K31/7034  присоединенные к карбоциклическому соединению, например флоридзин
A61P3/04 анорексанты; средства против ожирения
A61P3/10 для лечения гипергликемии, например антидиабетические средства
A61P43/00 Лекарственные средства для специфических целей, не указанные в группах  1/00
Автор(ы):, , , , , , ,
Патентообладатель(и):КИССЕИ ФАРМАСЬЮТИКАЛ КО., ЛТД. (JP)
Приоритеты:
подача заявки:
2001-03-15
публикация патента:

Настоящее изобретение относится к новым производным глюкопиранозилоксибензилбензола, представленным общей формулой:

глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340

где R1 представляет атом водорода или гидрокси(низший)алкил; а R2 представляет низшую алкильную группу, низшую алкоксигруппу и низшую алкилтиогруппу, каждая из которых необязательно замещена гидрокси или (низшей)алкокси группой, или его фармацевтически приемлемым солям. Изобретение также относится к фармацевтической композиции, обладающей гипогликемической активностью, а также к способу лечения и предупреждения заболеваний, связанных с гипергликемией, таких как диабет, ожирения и т.п., а также к их промежуточным соединениям. Цель - получение новых производных глюкопиранозилоксибензилбензола, которые обладают превосходной ингибирующей активностью по отношению к SGLT2 человека. 4 н. и 9 з.п. ф-лы, 2 табл.

Область, к которой относится изобретение

Настоящее изобретение относится к глюкопиранозилоксибензилбензольным производным и к фармацевтически приемлемым солям, которые могут быть использованы в качестве лекарственных средств, к фармацевтическим композициям, содержащим указанные производные, и к их промежуточным соединениям.

Предшествующий уровень техники

Диабет является одним из заболеваний, связанных с образом жизни и развивающихся на фоне изменения пищевых привычек и отсутствия физической нагрузки. Поэтому пациентам с диабетом показана диетотерапия и лечебная гимнастика. Кроме того, если достаточный контроль и продолжительность такой терапии представляет определенные трудности, то одновременно проводят лекарственную терапию. В настоящее время в качестве антидиабетических средств используются бигуаниды, сульфонилмочевины и агенты, снижающие инсулинорезистентность. Однако, иногда, бигуаниды и сульфонилмочевины дают побочные эффекты, такие как молочнокислый ацидоз и гипогликемия, соответственно. В случае использования агентов, понижающих резистентность к инсулину, иногда наблюдаются такие побочные эффекты, как отеки, а также прогрессирующее ожирение. Следовательно, для решения этих проблем необходимо разработать антидиабетические средства, обладающие новым механизмом действия.

За последние годы наблюдается большой прогресс в разработке антидиабетических средств нового типа, которые стимулируют выделение глюкозы с мочой и снижение уровней глюкозы в крови путем предупреждения реабсорбции избыточной глюкозы в почках (J.Clin. Invest., Vol.79, pp.1510-1515 (1987)). Кроме того, сообщалось, что SGLT2 (Na +/антипорт глюкозы 2) присутствует в сегменте S1 проксимальных почечных канальцев и участвует, главным образом, в реабсорбции глюкозы, фильтруемой через клубочки (J.Clin. Invest., Vol.93, pp.397-404 (1994)). В соответствии с этим ингибирование активности человеческого SGLT2 приводит к предупреждению реабсорбции избыточной глюкозы в почках, а следовательно, и к стимуляции выделения избыточной глюкозы через мочу, и, тем самым, к нормализации уровня глюкозы в крови. Поэтому необходима скорейшая разработка антидиабетических средств, которые обладали бы ингибирующей активностью по отношению к SGLT2 человека, и которые обладали бы новым механизмом действия. Кроме того, поскольку указанные агенты стимулируют выделение избыточной глюкозы через мочу, а следовательно, и снижение накопления глюкозы в организме, то также предполагается, что они будут оказывать действие, направленное на предупреждение ожирения.

Описание изобретения

Авторами настоящего изобретения были проведены серьезные исследования, направленные на получение соединений, обладающих ингибирующей активностью по отношению к SGLT2 человека. В результате этих исследований было обнаружено, что глюкопиранозилоксибензилбензольные производные, представленные нижеследующей общей формулой (I), обладают превосходной ингибирующей активностью в отношении SGLT2 человека, как будет показано ниже, и этот факт был положен в основу настоящего изобретения.

Настоящее изобретение относится к нижеследующим глюкопиранозилоксибензилбензольным производным и к их фармацевтически приемлемым солям, которые обладают ингибирующей активностью по отношению к SGLT2 человека In vivo и обнаруживают гипогликемическое действие посредством выделения избытка глюкозы с мочой, предупреждая, тем самым, реабсорбцию указанной глюкозы в почках, а также к фармацевтическим композициям, содержащим указанные производные и их промежуточные соединения.

Таким образом, настоящее изобретение относится к глюкопиранозилоксибензилбензольному производному, представленному общей формулой:

глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340

где R1 представляет атом водорода или гидрокси(низший)алкил; а R2 представляет низшую алкильную группу, низшую алкоксигруппу, низшую алкилтиогруппу, гидрокси(низший)алкил или группу:гидрокси(низший)алкокси, гидрокси(низший)алкилтио, низший алкокси-замещенный низший алкил, низший алкокси-замещенный низший алкокси или низший алкокси-замещенный низший алкилтио, или к его фармацевтически приемлемой соли.

Настоящее изобретение относится к фармацевтической композиции, содержащей в качестве активного ингредиента глюкопиранозилоксибензилбензольное производное, представленное вышеуказанной общей формулой (I), или к его фармацевтически приемлемой соли.

Настоящее изобретение относится к способу предупреждения или лечения заболевания, связанного (ассоциированного) с гипергликемией, предусматривающему введение глюкопиранозилоксибензилбензольного производного, представленного вышеуказанной общей формулой (I) или его фармацевтически приемлемой соли.

Настоящее изобретение относится к использованию глюкопиранозилоксибензилбензольного производного, представленного вышеуказанной общей формулой (I) или его фармацевтически приемлемой соли в целях изготовления фармацевтической композиции для предупреждения или лечения заболевания, ассоциированного с гипергликемией.

Настоящее изобретение также относится к бензилфенольному производному, представленному общей формулой:

глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340

где R11 представляет атом водорода или защищенную гидрокси(низший)алкил; а R12 представляет низшую алкильную группу, низшую алкоксигруппу, низшую алкилтиогруппу, защищенный гидрокси(низший)алкил, защищенный гидрокси(низший)алкокси, защищенный гидрокси(низший)алкилтио, низший алкокси-замещенный низший алкил, низший алкокси-замещенный низший алкокси или низший алкокси-замещенный (низший)алкилтио; при условии, что R12 не является метильной группой, этильной группой, изопропильной группой, трет-бутильной группой или метоксигруппой, когда R11 представляет атом водорода; или к его соли.

В настоящем изобретении термин "низшая алкильная группа" означает прямую или разветвленную алкильную группу, имеющую от 1 до 6 атомов углерода, такую как метильная группа, этильная группа, пропильная группа, изопропильная группа, бутильная группа, изобутильная группа, втор-бутильная группа, трет-бутильная группа, пентильная группа, изопентильная группа, неопентильная группа, трет-пентильная группа, гексильная группа или т.п.; термин "низшая алкоксигруппа" означает прямую или разветвленную алкоксигруппу, имеющую от 1 до 6 атомов углерода, такую как метоксигруппа, этоксигруппа, пропоксигруппа, изопропоксигруппа, бутоксигруппа, изобутоксигруппа, втор-бутоксигруппа, трет-бутоксигруппа, пентилоксигруппа, изопентилоксигруппа, неопентилоксигруппа, трет-пентилоксигруппа, гексилоксигруппа или т.п.; а термин "низшая алкилтиогруппа" означает прямую или разветвленную алкилтиогруппу, имеющую от 1 до 6 атомов углерода, такую как метилтиогруппа, этилтиогруппа, пропилтиогруппа,, изопропилтиогруппа, бутилтиогруппа, изобутилтиогруппа, втор-бутилтиогруппа, трет-бутилтиогруппа, пентилтиогруппа, изопентилтиогруппа, неопентилтиогруппа, трет-пентилтиогруппа, гексилтиогруппа или т.п. Термин "гидрокси(низший)алкил" означает прямую или разветвленную гидроксиалкильную группу, имеющую от 1 до 6 атомов углерода, такую как гидроксиметильная группа, 2-гидроксиэтильная группа, 1-гидроксиэтильная группа, 3-гидроксипропильная группа, 2-гидроксипропильная группа, 1-гидроксипропильная группа, 2-гидрокси-1-метилэтильная группа, 4-гидроксибутильная группа, 3-гидроксибутильная группа, 2-гидроксибутильная группа, 1-гидроксибутильная группа, 5-гидроксипентильная группа, 4-гидроксипентильная группа, 3-гидроксипентильная группа, 2-гидроксипентильная группа, 1-гидроксипентильная группа, 6-гидроксигексильная группа, 5-гидроксигексильная группа, 4-гидроксигексильная группа, 3-гидроксигексильная группа, 2-гидроксигексильная группа, 1-гидроксигексильная группа или т.п.; термин "гидрокси(низший)алкилокси" означает прямую или разветвленную гидроксиалкоксигруппу, имеющую от 1 до 6 атомов углерода, такую как 2-гидроксиэтоксигруппа, 3-гидроксипропоксигруппа, 2-гидроксипропоксигруппа, 2-гидрокси-1-метилэтоксигруппа, 4-гидроксибутоксигруппа, 3-гидроксибутоксигруппа, 2-гидроксибутоксигруппа, 5-гидроксипентилоксигруппа, 4-гидроксипентилоксигруппа, 3-гидроксипентилоксигруппа, 2-гидроксипентилоксигруппа, 6-гидроксигексилоксигруппа, 5-гидроксигексилоксигруппа, 4-гидроксигексилоксигруппа, 3-гидроксигексилоксигруппа, 2-гидроксигексилоксигруппа или т.п.; термин "гидрокси(низший)алкилтио" означает прямую или разветвленную гидроксиалкилтиогруппу, имеющую от 1 до 6 атомов углерода, такую как гидроксиметилтиогруппа, 2-гидроксиэтилтиогруппа, 1-гидроксиэтилтиогруппа, 3-гидроксипропилтиогруппа, 2-гидроксипропилтиогруппа, 1-гидроксипропилтиогруппа, 2-гидрокси-1-метилэтилтиогруппа, 4-гидроксибутилтиогруппа, 3-гидроксибутилтиогруппа, 2-гидроксибутилтиогруппа, 1-гидроксибутилтиогруппа, 5-гидроксипентилтиогруппа, 4-гидроксипентилтиогруппа, 3-гидроксипентилтиогруппа, 2-гидроксипентилтиогруппа, 1-гидроксипентилтиогруппа, 6-гидроксигексилтиогруппа, 5-гидроксигексилтиогруппа, 4-гидроксигексилтиогруппа, 3-гидроксигексилтиогруппа, 2-гидроксигексилтиогруппа, 1-гидроксигексилтиогруппа или т.п. Термин "низший алкил-замещенный низший алкил группа" означает вышеуказанную гидрокси(низший)алкил группу, O-алкилированную вышеуказанной низшей алкильной группой; термин "низший алкокси-замещенный низший алкокси" означает вышеуказанную гидрокси(низший)алкилокси, O-алкилированную вышеуказанной низшей алкильной группой; а термин "низший алкокси-замещенный низший алктилтио" означает гидрокси(низший)алкилтиогруппу, O-алкилированную вышеуказанной низшей алкильнои группой.

Термин "гидроксизащитная группа" означает гидроксизащитную группу, используемую в общих органических реакциях, такую как бензильная группа, метоксиметильная группа, ацетильная группа или т.п.

В качестве заместителя R1 предпочтительными являются атом водорода и гидроксиалкильная группа, имеющая от 1 до 3 атомов углерода. В качестве заместителя R2 предпочтительными являются низшая алкильная группа, низшая алкоксигруппа и гидрокси(низший)алкил, а более предпочтительными являются алкильная группа, имеющая от 1 до 4 атомов углерода, алкоксигруппа, имеющая от 1 до 3 атомов углерода и гидроксиалкильная группа, имеющая от 1 до 3 атомов углерода.

Так, например, соединения, представленные вышеуказанной общей формулой (I) настоящего изобретения, могут быть получены с использованием бензилфенольного производного настоящего изобретения, представленного общей формулой (II) в соответствии с нижеследующей процедурой:

глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340

где R11 представляет атом водорода или защищенный гидрокси(низший)алкил; R12 представляет низшую алкильную группу, низшую алкоксигруппу, низшую алкилтиогруппу, защищенный гидрокси(низший)алкил, защищенный гидрокси(низший)алкокси, защищенный гидрокси(низший)алкилтио, низший алкокси-замещенный низший алкил, низший алкокси-замещенный низший алкокси или низший алкокси-замещенный (низший)алкилтио; Х представляет уходящую группу, такую как трихлорацетоимидоилоксигруппу, ацетоксигруппу, атом брома или атом фтора; а R1 и R2 имеют значения, определенные выше.

Способ 1

Глюкозид, представленный вышеуказанной общей формулой (IV), может быть получен глюкозидированием бензилфенольного производного, представленного вышеуказанной общей формулой (II), или его соли, с использованием донора гликозил, представленного вышеуказанной общей формулой (III), такого как 2,3,4,6-тетра-О-ацетил-1-О-трихлорацетоимидоил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопираноза, 1,2,3,4,6-пента-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопираноза, 2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозилбромид и 2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозилфторид в присутствии активирующего реагента, такого как комплекс трифторид бора - диэтиловый эфир, трифторметансульфонат серебра, хлорид олова (IV) или триметилсилилтрифторметансульфонат в инертном растворителе. Примерами используемого растворителя могут служить дихлорметан, толуол, ацетонитрил, нитрометан, этилацетат, диэтиловый эфир, хлороформ, смесь указанных растворителей и т.п. Температура реакции обычно составляет в пределах от -30°С до температуры кипения с обратным холодильником (дефлегмации), а время реакции обычно составляет от 10 минут до 1 дня, в зависимости от используемых исходного материала, растворителя и температуры реакции.

Способ 2

Соединение (I) настоящего изобретения может быть получено щелочным гидролизом глюкозида, представленного вышеуказанной общей формулой (IV), с удалением гидроксизащитных групп. Примерами используемого растворителя могут служить вода, метанол, этанол, тетрагидрофуран, смесь указанных растворителей и т.п., а в качестве щелочных материалов могут быть использованы гидроксид натрия, метоксид натрия, этоксид натрия или т.п. Температура обработки обычно составляет в пределах от 0°С до температуры дефлегмации, а время обработки обычно составляет от 30 минут до 6 часов, в зависимости от исходного материала, растворителя и температуры обработки. Такая обработка может быть осуществлена путем соответствующей модификации данной процедуры или путем проведения дополнительной процедуры стандартным способом в зависимости от используемой гидроксизащитной группы.

Так, например, соединения настоящего изобретения, представленные вышеуказанной общей формулой (II), и их соли, которые используются в качестве исходных материалов в вышеупомянутом способе получения, могут быть получены в соответствии с нижеследующей процедурой.

глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 где М представляет атом водорода или гидроксизащитную группу; R4 представляет атом водорода, защищенную гидрокси(низший)алкил или низшую алкоксикарбонильную группу; один из У и Z представляет МgВr, МgСl, Мgl или атом лития, а другой представляет формильную группу; и R11 и R12 имеют значения, определенные выше.

Способ А

Соединения, представленные вышеуказанной общей формулой (VII), могут быть получены конденсацией бензальдегидного производного, представленного вышеуказанной общей формулой (V), с реактивом Гриньяра или литиевым реагентом, представленным вышеуказанной общей формулой (VI), или конденсацией реактива Гриньяра или литиевого реагента, представленного вышеуказанной общей формулой (V), с бензальдегидным производным, представленным вышеуказанной общей формулой (VI), в инертном растворителе. Примерами используемого растворителя могут служить тетрагидрофуран, диэтиловый эфир, смесь этих растворителей и т.п. Температура реакции обычно составляет в пределах от -78°С до температуры дефлегмации, а время реакции обычно составляет от 10 минут до 1 дня в зависимости от используемых исходного материала, растворителя и температуры реакции.

Способ В

Соединение, представленное вышеуказанной общей формулой (VIII) может быть получено окислением соединения, представленного вышеуказанной общей формулой (VII), с использованием реагента Десс-Мартина в инертном растворителе. Примерами используемого растворителя могут служить дихлорметан, хлороформ, ацетонитрил, смесь этих растворителей и т.п. Температура реакции обычно составляет в пределах от 0°С до температуры дефлегмации, а время реакции обычно составляет от 1 часа до 1 дня в зависимости от используемого исходного материала, растворителя и температуры реакции.

Способ С

Соединение, представленное вышеуказанной общей формулой (II), может быть получено удалением защитной группы М у соединения, представленного вышеуказанной общей формулой (VIII), (1) конденсации полученного соединения с метилхлорформиатом в присутствии основания, такого как триэтиламин, диизопропилэтиламин или N,N-диметиламинопиридин, в инертном растворителе, и (2) восстановления полученного карбонатного производного с использованием восстановителя, такого как борогидрид натрия. В качестве растворителя, используемого в реакции (1), могут служить тетрагидрофуран, дихлорметан, ацетонитрил, этилацетат, диэтиловый эфир, смесь указанных растворителей и т.п. Температура реакции обычно составляет в пределах от 0°С до температуры дефлегмации, а время реакции обычно составляет от 30 минут до 1 дня, в зависимости от используемого исходного материала, растворителя и температуры реакции. В качестве растворителя, используемого в реакции (2), может служить смешанный растворитель из тетрагидрофурана и воды и т.п. Температура реакции обычно составляет в пределах от 0°С до температуры дефлегмации, а время реакции обычно составляет от 1 часа до 1 дня, в зависимости от используемого исходного материала, растворителя и температуры реакции. В случае, когда R4 представляет низшую алкоксикарбонильную группу, соединения настоящего изобретения, представленные вышеуказанной общей формулой (II), могут быть получены восстановлением указанной группы до гидроксиметильной группы с использованием восстановителя, такого как алюмогидрид лития, в инертном растворителе и защиты гидроксигруппы стандартным способом. Примерами используемого растворителя могут служить диэтиловый эфир, тетрагидрофуран, смесь этих растворителей и т.п. Температура реакции обычно составляем в пределах от 0°С до температуры дефлегмации, а время реакции обычно составляет от 10 минут до 1 дня, в зависимости от используемого исходного материала, растворителя и температуры реакции. Соединения настоящего изобретения, представленные вышеуказанной общей формулой (II), могут быть превращены в их соль, такую как натриевая или калиевая соль, стандартным способом.

Способ D

Соединение настоящего изобретения, представленное вышеуказанной общей формулой (II), может быть получено каталитическим гидрированием соединения, представленного вышеуказанной общей формулой (VII), с использованием палладиевого катализатора, такого как порошкообразный палладий на угле, в отсутствие или в присутствии кислоты, такой как соляная кислота в инертном растворителе, и удаления или введения защитной группы стандартным способом, если это необходимо. В качестве растворителя, используемого в реакции каталитического гидрирования, могут служить метанол, этанол, тетрагидрофуран, этилацетат, уксусная кислота, изопропанол, смесь указанных растворителей и т.п. Температура реакции обычно составляет в пределах от комнатной температуры до температуры дефлегмации, а время реакции обычно составляет от 30 минут до 1 дня, в зависимости от используемых исходного материала, растворителя и температуры реакции. В случае, если R4 представляет низшую алкоксикарбонильную группу, то соединения настоящего изобретения, представленные вышеуказанной общей формулой (II), могут быть получены восстановлением указанной группы до гидроксиметильной группы с использованием восстановителя, такого как алюмогидрид лития, в инертном растворителе, и защиты указанной гидроксигруппы стандартным способом. В качестве растворителя, используемого в указанной реакции восстановления, могут служить диэтиловый эфир, тетрагидрофуран, смесь этих растворителей и т.п. Температура реакции обычно составляет в пределах от 0°С до температуры дефлегмации, а время реакции обычно составляет от 10 минут до 1 дня, в зависимости от используемых исходного материала, растворителя и температуры реакции. Соединение настоящего изобретения, представленное вышеуказанной общей формулой (II), может быть превращено в его соль, такую как натриевая или калиевая соль, стандартным способом.

Соединения настоящего изобретения, полученные вышеуказанными способами, могут быть выделены и очищены стандартными способами разделения, такими как фракционированная перекристаллизация, очистка с использованием хроматографии, экстракция растворителем и твердофазная экстракция.

Глюкопиранозилоксибензилбензольные производные настоящего изобретения, представленные вышеуказанной общей формулой (I), могут быть превращены в их фармацевтически приемлемые соли стандартным способом. Примерами таких солей являются соли неорганических оснований, такие как натриевая соль или калиевая соль.

Соединениями настоящего изобретения, представленными вышеуказанной общей формулой (I), являются их гидраты и их сольваты с фармацевтически приемлемыми растворителями, такими как этанол.

Соединения настоящего изобретения, представленные вышеуказанной общей формулой (I), и их фармацевтически приемлемые соли обладают превосходной ингибирующей активностью по отношению к SGLT2 человека и представляют собой в высокой степени ценные агенты для предупреждения или лечения диабета, осложнений диабета, ожирения или т.п. Так, например, в нижеописанном анализе на ингибирующее действие активности SGLT2 человека соединения настоящего изобретения обнаруживали сильную ингибирующую активность по отношению к SGLT2 человека.

При применении фармацевтических композиций настоящего изобретения для практического лечения могут быть использованы различные лекарственные формы в зависимости от целей их использования. Примерами таких лекарственных форм являются порошки, гранулы, тонкодисперсные гранулы, сухие сиропы, таблетки, капсулы, инъекции, растворы, мази, суппозитории, припарки и т.п., которые вводят перорально или парентерально.

Указанные фармацевтические композиции могут быть получены смешиванием с соответствующими фармацевтическими добавками или разбавлением указанными добавками или растворения в указанных добавках, таких как наполнители; дезинтегрирующие агенты; связующие агенты; смазывающие агенты; разбавители; буферы; агенты, придающие изотоничность; антисептики; увлажнители; эмульгаторы; диспергирующие агенты; стабилизаторы; вещества, способствующие растворению, и т.п., и получения смеси стандартным способом.

При применении фармацевтических композиций настоящего изобретения для практического лечения дозу соединения настоящего изобретения, представленного вышеуказанной общей формулой (I), или его фармацевтически приемлемой соли, используемых в качестве активного ингредиента, назначают в зависимости от возраста, пола, массы тела, тяжести симптомов и фазы лечения каждого отдельного пациента, и эта доза приблизительно составляет от 0,1 до 1,000 мг в день для взрослого человека в случае перорального введения, и приблизительно в пределах от 0,01 до 300 мг в день для взрослого человека в случае парентерального введения, при этом суточная доза может быть соответствующим образом введена в виде одной разовой дозы или нескольких доз в день.

Наилучшие варианты осуществления изобретения

Настоящее изобретение более подробно проиллюстрировано в нижеследующих Сравнительных примерах, в Примерах и в Примерах испытаний. Однако настоящее изобретение не ограничивается приведенными примерами.

Сравнительный пример 1

4-(3-бензилоксипропил)бромбензол

Суспензию гидрида натрия (60%, 0,97 г), 3-(4-бромфенил)-1-пропанола (1,0 г) и бензилбромида (0,69 мл) в бензоле (24 мл) перемешивают в течение 7 часов при кипячении с обратным холодильником. После охлаждения до комнатной температуры к реакционной смеси добавляют насыщенный водный раствор хлорида аммония (50 мл) и смесь экстрагируют этилацетатом (100 мл). Органический слой промывают водой (40 мл) и насыщенным раствором соли (40 мл) и сушат над безводным сульфатом натрия. Растворитель удаляют при пониженном давлении и остаток очищают колоночной хроматографией на силикагеле (элюент: гексан/этилацетат = 20/1) с получением 4-(3-бензилоксипропил)бромбензола (1,4 г).

1Н-ЯМР (СDСl3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,85-2,00 (2Н, м), 2,60-2,75 (2Н, м), 3,47 (2Н, т, J=6,2 Гц), 4,50 (2Н, с), 7,00-7,10 (2Н, м), 7,20-7,45 (7Н, m).

Сравнительный пример 2

Метил-4-(4-этилбензил)-3-гидроксибензоат

К раствору 1-бром-4-этилбензола (0,41 мл) в тетрагидрофуране (15 мл) добавляют 1,45 моль/л раствора трет-бутиллития в н-пентане (2,3 мл) в атмосфере аргона при -78°С. После перемешивания смеси при -78°С в течение 10 минут к реакционной смеси добавляют раствор метил-4-формил-3-гидроксибенэоата (0,18 г) в тетрагидрофуране (5 мл). После перемешивания смеси при охлаждении льдом в течение 45 минут к реакционной смеси добавляют насыщенный водный раствор хлорида аммония и воду и смесь экстрагируют этилацетатом. Экстракт промывают водой и сушат над безводным сульфатом магния и растворитель удаляют при пониженном давлении. Остаток очищают колоночной хроматографией на силикагеле (элюент: гексан/этилацетат = 3/1) с получением дефенилметанольного соединения (0,27 г). Полученное дифенилметанольное соединение (0,27 г) растворяют в метаноле (5 мл) и к раствору добавляют концентрированную соляную кислоту (0,08 мл) и 10% порошкообразный палладий на угле (54 мг). После перемешивания смеси в атмосфере водорода при комнатной температуре в течение 18 часов катализатор удаляют фильтрацией и фильтрат концентрируют при пониженном давлении. Остаток очищают колоночной хроматографией на силикагеле (элюент: гексан/этилацетат=3/1) с получением метил-4-(4-этилбензил)-3-гидроксибензоата (0,20 г).

1H-ЯМР (СDСl3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,22 (3Н, т, J=7,6 Гц), 2,62 (2Н, kb, J=7,6 Гц), 3,89 (3Н, с), 4,00 (2Н, с), 5,01 (1Н, с), 7,05-7,25 (5Н, м), 7,47 (1Н, д, J=1,6 Гц), 7,56 (1Н, дд, J=1,6, 7,8 Гц).

Сравнительный пример 3

Метил-3-гидрокси-4-(4-пропоксибензил)бензоат

К раствору 1-аллилокси-4-бромбензола (3,1 г) в тетрагидрофуране (70 мл) добавляют 1,45 моль/л раствора трет-бутиллития в н-пентане (11 мл) в атмосфере аргона при -78°С. После перемешивания смеси при -78°С в течение 5 минут к реакционной смеси добавляют раствор метил-4-формил-3-гидроксибензоата (0,89 г) в тетрагидрофуране (15 мл). После перемешивания смеси при охлаждении льдом в течение 30 минут к реакционной смеси добавляют насыщенный водный раствор хлорида аммония и воду и смесь экстрагируют этилацетатом. Экстракт промывают водой и сушат над безводным сульфатом магния и растворитель удаляют при пониженном давлении. Остаток очищают колоночной хроматографией на силикагеле (элюент: гексан/этилацетат=3/1) с получением дифенилметанольного соединения (0,99 г). Полученное дифенилметанольное соединение (0,99 г) растворяют в метаноле (10 мл) и к раствору добавляют 10% порошкообразный палладий на угле (0,30 г). После перемешивания смеси в атмосфере водорода при комнатной температуре в течение 24 часов катализатор удаляют фильтрацией и фильтрат концентрируют при пониженном давлении. Остаток очищают колоночной хроматографией на силикагеле (элюент: гексан/этилацетат=3/1) с получением метил-3-гидрокси4-(4-пропоксибензил)бензоата (0,50 г).

1H-ЯМР (CDCl3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,02 (3Н, т, J=7,4 Гц), 1,70-1,85 (2Н, м), 3,80-3,95 (5Н, м), 3,97 (2Н, с), 4,99 (1Н, с), 6,75-6,90 (2Н, м), 7,05-7,20 (3Н, м), 7,47 (1Н, д, J=1,5 Гц), 7,56 (1Н, дд, J=1,5, 7,8 Гц).

Сравнительный пример 4

Метил-3-гидрокси-4-[4-(2-гидроксиэтил)бензил]бензоат

К раствору 2-(бромфенил)этилового спирта (1,7 г) в тетрагидрофуране (100 мл) добавляют 1,45 моль/л раствора трет-бутиллития в н-пентане (12,6 мл) в атмосфере аргона при -78°С. После перемешивания смеси при -78°С в течение 10 минут к реакционной смеси добавляют раствор метил-4-формил-3-гидроксибензоата (0,50 г) в тетрагидрофуране (10 мл). После перемешивания смеси при охлаждении льдом в течение 30 минут к реакционной смеси добавляют насыщенный водный раствор хлорида аммония и воду и смесь экстрагируют этилацетатом. Экстракт промывают водой и сушат над безводным сульфатом магния и растворитель удаляют при пониженном давлении. Остаток очищают колоночной хроматографией на силикагеле (элюент: гексан/этилацетат=1/3) с получением дифенилметанольного соединения (0,28 г). Полученное дифенилметанольное соединение (0,28 г) растворяют в метаноле (5 мл) и к раствору добавляют 10% порошкообразный палладий на угле (0,14 г). После перемешивания смеси при комнатной температуре в течение 14 часов в атмосфере водорода, катализатор удаляют фильтрацией и фильтрат концентрируют при пониженном давлении. Остаток очищают колоночной хроматографией на силикагеле (элюент:гексан/этилацетат=1/1) с получением метил-3-гидрокси- 4-[4-(2-гидроксиэтил)бензил]бензоата (0,26 г).

1 H-ЯМр (CDCl3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,37 (1Н, т, J=5,9 Гц), 2,84 (2Н, т, J=6,5 Гц), 3,75-3,95 (5Н, м), 4,01 (2Н, с), 5,10 (1Н, с), 7,05-7,25 (5Н, м), 7,47 (1Н, д, J=1,6 Гц), 7,56 (1Н, дд, J=1,6, 7,8 Гц).

Сравнительный пример 5

2-(4-изобутилбензил)фенол

Реактив Гриньяра получают из 2-бензилоксибромбензола (0,20 г), магния (0,026 г), каталитического количества иода и тетрагидрофурана (1 мл). Полученный реактив Гриньяра добавляют к раствору 4-изобутилбензальдегида (0,16 г) в тетрагидрофуране (2 мл) и смесь перемешивают при комнатной температуре в течение 30 минут. Реакционную смесь очищают колоночной хроматографией на аминопропилсиликагеле (элюент: тетрагидрофуран) с получением дифенилметанольного соединения (0,23 г). Полученное дифенилметанольное соединение растворяют в этаноле (3 мл) и концентрированной соляной кислоте (0,1 мл). К раствору добавляют каталитическое количество 10% порошкообразного палладия на угле и смесь перемешивают в атмосфере водорода при комнатной температуре в течение ночи. Катализатор удаляют фильтрацией и фильтрат концентрируют при пониженном давлении. Остаток очищают колоночной хроматографией на силикагеле (элюент: дихлорметан/гексан=1/1) с получением 2-(4-изобутилбензил)фенола (0,10 г).

1H-ЯМР (СDСl3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

0,89 (6Н, д, J=6,6 Гц), 1,75-1,90 (1Н, м), 2,43 (2Н, д, J=7,2 Гц), 3,97 (2Н, с), 4,66 (1Н, с), 6,75-6,85 (1Н, м), 6,85-6,95 (1Н, м), 7,00-7,20 (6Н, м).

Сравнительный пример 6

2-(4-изопропоксибензил)фенол

Указанное в заголовке соединение получают способом, описанным в сравнительном примере 5, с использованием 4-изопропоксибензальдегида вместо 4-изобутилбензальдегида.

1H-ЯМР (CDCl3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,31 (6Н, д, J=6,1 Гц), 3,93 (2Н, с), 4,50 (1Н, гептет, J=6,1 Гц), 4,72 (1Н, с), 6,75-6,85 (3Н, м), 6,85-6,95 (1Н, м), 7,05-7,20 (4Н, м).

Сравнительный пример 7

2-(4-этоксибензил)фенол

Реактив Гриньяра получают из 4-этоксибромбензола (1,5 г), магния (0,19 г) и каталитического количества иода и тетрагидрофурана (2 мл) стандартным способом. К полученному раствору реактива Гриньяра добавляют по каплям добавляют раствор 2-бензилоксибензальдегида (1,1 г) в тетрагидрофуране (15 мл) и смесь перемешивают при комнатной температуре в течение 30 минут. К реакционной смеси добавляют насыщенный водный раствор хлорида аммония (10 мл) и воду (20 мл) и смесь экстрагируют этилацетатом (100 мл). Экстракт промывают водой (20 мл) и насыщенным раствором соли (20 мл) и сушат над безводным сульфатом натрия. Затем растворитель удаляют при пониженном давлении. Остаток очищают колоночной хроматографией на силикагеле (элюент: гексан/этилацетат=5/1) с получением дифенилметанольного соединения (1,7 г). Полученное дифенилметанольное соединение (1,7 г) растворяют в этаноле (25 мл). К раствору добавляют концентрированную соляную кислоту (0,42 мл) и каталитическое количество 10% палладия на угле и смесь перемешивают в атмосфере водорода при комнатной температуре в течение 18 часов. Катализатор удаляют фильтрацией и фильтрат концентрируют при пониженном давлении. К остатку добавляют этилацетат (100 мл) и смесь промывают насыщенный водным раствором бикарбоната натрия (30 мл) и насыщенным раствором соли (30 мл). Органический слой сушат над безводным сульфатом натрия и растворитель удаляют при пониженном давлении. Остаток очищают колоночной хроматографией на силикагеле (элюент: гексан/этилацетат=8/1) с получением 2-(4-этоксибензил)фенола (0,85 г).

1H-ЯМР (CDCl3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,39 (3Н, т, J=7,1 Гц), 3,93 (2Н, с), 4,00 (2Н, кв, J=7,1 Гц), 4,72 (1Н, с), 6,75-6,85 (3Н, м), 6,85-6,95 (1Н, м), 7,05-7,20 (4Н, м).

Сравнительный пример 8

2-[4-(3-бензоилоксипропил)бензил]фенол

Реактив Гриньяра получают из 4-(3-бензилоксипропил)бромбензола (3,2 г), магния (0,25 г), каталитического количества иода и тетрагидрофурана (10,5 мл). К полученному раствору реактива Гриньяра добавляют раствор 2-(метоксиметокси)бензальдегида (1,1 г) в тетрагидрофуране (24 мл) и смесь перемешивают при 65°С в течение 25 минут. После охлаждения до комнатной температуры к реакционной смеси добавляют насыщенный водный раствор хлорида аммония (10 мл) и воду (20 мл) и смесь экстрагируют этилацетатом (100 мл). Экстракт промывают водой (20 мл) и насыщенным раствором соли (20 мл). После сушки экстракта над безводным сульфатом натрия растворитель удаляют при пониженном давлении и остаток очищают колоночной хроматографией на силикагеле (элюент: гексан/этилацетат=5/1) с получением дифенилметанольного соединения (2,5 г). Полученное дифенилметанольное соединение (2,5 г) растворяют в этаноле (42 мл), к раствору добавляют каталитическое количество 10% порошкообразного палладия на угле и смесь перемешивают в атмосфере водорода при комнатной температуре в течение 7,5 часов. Катализатор удаляют фильтрацией и фильтрат концентрируют при пониженном давлении. Остаток очищают колоночной хроматографией на силикагеле (элюент: гексан/этилацетат=5/2) с получением фенилпропанольного соединения (1,6 г). После растворения полученного фенилпропанольного соединения (1,6 г) в дихлорметане (29 мл) к раствору добавляют 4-(диметиламино)пиридин (0,069 г), триэтиламин (1,0 мл) и бензоилхлорид (0,79 мл) и смесь перемешивают при комнатной температуре в течение 3 часов. К реакционной смеси добавляют этилацетат (100 мл) и воду (30 мл) и органический слой отделяют. Экстракт промывают насыщенным раствором соли (30 мл), сушат над безводным сульфатом натрия и растворитель удаляют при пониженном давлении. Остаток очищают колоночной хроматографией на силикагеле (элюент: гексан/этилацетат=20/1) с получением сложноэфирного соединения (2,2 г). Смесь полученного сложноэфирного соединения (2,2 г), моногидрата п-толуолсульфоновой кислоты (0,21 г) и метанола (28 мл) перемешивают при комнатной температуре в течение 24 часов. Реакционную смесь концентрируют при пониженном давлении и остаток очищают колоночной хроматографией на силикагеле (элюент: гексан/этилацетат=5/1) с получением

2-[4-(3-бензоилоксипропил)бензил]фенола (1,8 г).

1H-ЯМР (СDСl3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

2,00-2,15 (2Н, м), 2,70-2,80 (2Н, м), 3,96 (2Н, с), 4,33 (2Н, т, J=6,5 Гц), 4,74 (1Н, шир. с), 6,75-6,85 (1Н, м), 6,85-6,95 (1Н, м), 7,05-7,20 (6Н, м), 7,35-7,50 (2Н, м), 7,50-7,65 (1Н, м), 8,00-8,10 (2Н, м).

Сравнительный пример 9

2-[4-(2-бензоилоксиэтил)бензил]фенол

Указанное в заголовке соединение получают способом, описанным в сравнительном примере 8, с использованием 4-(2-бензилоксиэтил)бромбензола вместо 4-(3-бензилоксипропил)бромбензола.

1H-ЯМР (CDCl3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

3,04 (2Н, т, J=7,1 Гц), 3,98 (2Н, с), 4,51 (2Н, т, J=7,1 Гц), 4,66 (1Н, с), 6,75-6,85 (1Н, м), 6,85-6,95 (1Н, м), 7,05-7,25 (6Н, м), 7,35-7,50 (2Н, м), 7,50-7,60 (1Н, м), 7,95-8,05 (2Н, м).

Сравнительный пример 10

5-ацетоксиметил-2-(4-этилбензил)фенол

К суспензии алюмогидрида лития (95 мг) в диэтиловом эфире (10 мл) добавляют раствор метил-4-(4-этилбензил)-3-гидроксибензоата (0,27 г) в диэтиловом эфире (5 мл) при охлаждении льдом. После кипячения смеси с обратным холодильником в течение 45 минут к реакционной смеси при охлаждении льдом последовательно добавляют воду (0,1 мл), 15% водный раствор гидроксида натрия (0,1 мл) и воду (0,3 мл). После перемешивания смеси при комнатной температуре в течение 5 минут реакционную смесь выливают в 0,5 моль/л соляной кислоты и полученную смесь экстрагируют этилацетатом. Экстракт сушат над безводным сульфатом магния и растворитель удаляют при пониженном давлении. Остаток очищают колоночной хроматографией на силикагеле (элюент: гексан/этилацетат=1/1) с получением восстановленного соединения (0,22 г). После растворения полученного восстановленного соединения (0,22 г) в тетрагидрофуране (2 мл) к раствору добавляют винилацетат (2 мл) и бис(дибутилхлоролово)оксид (24 мг) и смесь перемешивают при 30°С в течение 19 часов. Реакционную смесь непосредственно очищают колоночной хроматографией на силикагеле (элюент: гексан/этилацетат=3/1) с получением 5-ацетоксиметил-2-(4-этилбензил)фенола (0,21 г).

1H-ЯМР (CDCl3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,21 (3Н, т, J=7,6 Гц), 2,09 (3Н, с), 2,61 (2Н, кв, J=7,6 Гц), 3,95 (2Н, с), 4,74 (1Н, с), 5,03 (2Н, с), 6,80 (1Н, д, J=1,3 Гц), 6,80-6,90 (1Н, м), 7,05-7,20 (5Н, м).

Сравнительный пример 11

5-ацетоксиметил-2-(4-пропоксибензил)фенол

Указанное в заголовке соединение получают способом, описанным в сравнительном примере 10, с использованием метил-3-гидрокси-4-(4-пропоксибензил)бензоата вместо метил-4-(4-этилбензил)-3-гидроксибензоата.

1H-ЯМР (CDCl3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,02 (3Н, т, J=7,4 Гц), 1,70-1,85 (2Н, м), 2,09 (3Н, с), 3,88 (2Н, 7, J=6,6 Гц), 3,91 (2Н, с), 5,02 (2Н, с), 5,28 (1Н, с), 6,70-6,90 (4Н, м), 7,00-7,20 (3Н, м).

Сравнительный пример 12

2-[4-(2-ацетоксиэтил)бензил]-5-ацетоксиметилфенол

Указанное в заголовке соединение получают способом, описанным в сравнительном примере 10, с использованием метил-3-гидрокси-4-[4-(2-гидроксиэтил)бензил]бензоата вместо метил-4-(4-этилбензил)-3-гидроксибензоата.

1H-ЯМР (СDСl3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

2,03 (3Н, с), 2,09 (3Н, с), 2,90 (2Н, т, J=7,1 Гц), 3,96 (2Н, с), 4,25 (2Н, т, J=7,1 Гц), 4,82 (1Н, с), 5,03 (2Н, с), 6,80 (1Н, д, J=1,5 Гц), 6,87 (1Н, дд, J=1,5, 7,7 Гц), 7,05-7,20 (5Н, м).

Сравнительный пример 13

2-(4-этилтиобензил)фенол

Реактив Гриньяра получают из 1-бром-4-(этилтио)бензола (1,1 г), магния (0,12 г), каталитического количества иода и тетрагидрофурана (5 мл). К раствору реактива Гриньяра добавляют раствор 2-(метоксиметокси)бензальдегида (0,56 г) в тетрагидрофуране (12 мл) и смесь перемешивают при 65°С в течение 10 минут. После охлаждения до комнатной температуры к реакционному раствору добавляют насыщенный водный раствор хлорида аммония (5 мл) и воду (20 мл) и смесь экстрагируют этилацетатом (80 мл). Экстракт промывают водой (20 мл) и насыщенным раствором соли (20 мл), сушат над безводным сульфатом натрия и растворитель удаляют при пониженном давлении. Остаток очищают колоночной хроматографией на силикагеле (элюент: гексан/этилацетат=4/1) с получением дифенилметанольного соединения (0,91 г). Полученное дифенилметанольное соединение (0,90 г) растворяют в дихлорметане (15 мл). К раствору добавляют реагент Десс-Мартина (1,1,1-три(ацетилокси)-1,1-дигидро-1,2-бензодиоксол-3(1Н)-он) (1,5 г) и смесь перемешивают при 25°С в течение 26 часов. К реакционной смеси добавляют диэтиловый эфир (75 мл) и 1 моль/л водного раствора гидроксида натрия (30 мл), смесь интенсивно перемешивают и органический слой отделяют. Органический слой промывают 1 моль/л водного раствора гидроксида натрия (30 мл), водой (30 мл, 3 раза) и насыщенным раствором соли (30 мл), сушат над безводным сульфатом натрия и растворитель удаляют при пониженном давлении. Остаток очищают колоночной хроматографией на силикагеле (элюент: гексан/этилацетат=15/1-9/1) с получением кетонового соединения (0,82 г). Смесь полученного кетонового соединения (0,81 г), моногидрата п-толуолсульфоновой кислоты (0,10 г) и метанола (14 мл) перемешивают при 60°С в течение 4 часов. После охлаждения до комнатной температуры реакционную смесь концентрируют при пониженном давлении. Остаток очищают колоночной хроматографией на силикагеле (элюент: гексан/этилацетат=15/1) с получением соединения со снятой защитой (0,69 г). Полученное соединение со снятой защитой (0,68 г) растворяют в тетрагидрофуране (11 мл), к раствору добавляют триэтиламин (0,41 мл) и метилхлорформиат (0,22 мл) и смесь перемешивают при 25°С в течение 1 часа. Затем к реакционной смеси добавляют триэтиламин (0,11 мл) и метилхлорформиат (0,061 мл) и смесь перемешивают в течение 30 минут. Реакционную смесь фильтруют и фильтрат концентрируют при пониженном давлении. Остаток растворяют в тетрагидрофуране (14 мл) и воде (7 мл), к раствору добавляют борогидрид натрия (0,40 г) и смесь перемешивают при 25°С в течение 7 часов. К реакционной смеси по каплям добавляют 1 моль/л соляной кислоты (15 мл) и смесь экстрагируют этилацетатом (75 мл). Экстракт промывают водой (20 мл), насыщенным водным раствором бикарбоната натрия (20 мл) и насыщенным раствором соли (20 мл), сушат над безводным сульфатом натрия и растворитель удаляют при пониженном давлении. Остаток очищают колоночной хроматографией на силикагеле (элюент: гексан/этилацетат=8/1) с получением 2-(4-этилтиобензил)фенола (0,62 г).

1H-ЯМР (CDCl3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,29 (3Н, т, J=7,3 Гц), 2,90 (2Н, kb, J=7,3 Гц), 3,96 (2Н, с), 4,62 (1Н, с), 6,75-6,80 (1Н, м), 6,85-6,95 (1Н, м), 7,05-7,20 (4Н, м), 7,20-7,30 (2Н, м).

Сравнительный пример 14

2-(4-метоксиОензил)фенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

К раствору 2-(4-метоксибенэил)фенола (46 мг) и 2,3,4,б-тетра-О-ацетил-1-О-трихлорацетоимидоил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозы (0,13 г) в дихлорметане (2 мл) добавляют комплекс трифторид бора - диэтиловый эфир (0,033 мл) и смесь перемешивают при комнатной температуре в течение 1 часа. Реакционную смесь очищают колоночной хроматографией на аминопропилсиликагеле (элюент: дихлорметан) с получением 2-(4-метоксибензил)фенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида (0,11 г).

1H-ЯМР (CDCl3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,91 (3Н, с), 2,03 (3Н, с), 2,05 (3Н, с), 2,08 (3Н, с), 3,77 (3Н, с), 3,80-3,95 (3Н, м), 4,17 (1Н, дд, J=2,5, 12,2 Гц), 4,29 (1Н, дд, J=5,5, 12,2 Гц), 5,11 (1Н, д, J=7,5 Гц), 5,10-5,25 (1H, м), 5,25-5,40 (2Н, м), 6,75-6,85 (2Н, м), 6,95-7,10 (5Н, м), 7,10-7,25 (1H, м).

Сравнительный пример 15

2-(4-метилбензил)фенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

Указанное в заголовке соединение получают способом, описанным в сравнительном примере 14, с использованием 2-(4-метилбензил)фенола вместо 2-(4-метоксибензил)фенола.

1H-ЯМР (CDCl 3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,89 (3Н, с), 2,03 (3Н, с), 2,05 (3Н, с), 2,07 (3Н, с), 2,30 (3Н, с), 3,80-3,95 (3Н, м), 4,17 (1H, дд, J=2,5, 12,3 Гц), 4,28 (1H, дд, J=5,5, 12,3 Гц), 5,11 (1H, д, J=7,5 Гц), 5,10-5,25 (1H, м), 5,25-5,40 (2Н, м), 6,90-7,20 (8Н, м).

Сравнительный пример 16

2-(4-этилбензил)фенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

Указанное в заголовке соединение получают способом, описанным в сравнительном примере 14, с использованием 2-(4-этилбензил)фенола вместо 2-(4-метоксибензил)фенола.

1H-ЯМР (СDСl 3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,20 (3Н, т, J=7,6 Гц), 1,87 (3Н, с), 2,03 (3Н, с), 2,05 (3Н, с), 2,08 (3Н, с), 2,60 (2Н, kb, J=7,6 Гц), 3,80-4,00 (3Н, м), 4,18 (1Н, дд, J=2,3, 12,2 Гц), 4,28 (1Н, дд, J=5,4, 12,2 Гц), 5,11 (1Н, д, J=7,5 Гц), 5,10-5,25 (1Н, м), 5,25-5,40 (2Н, м), 6,90-7,25 (8Н, м).

Сравнительный пример 17

2-(4-изобутилбензил)фенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

Указанное в заголовке соединение получают способом, описанным в сравнительном примере 14, с использованием 2-(4-изобутилбензил)фенола вместо 2-(4-метоксибензил)фенола.

1H-ЯМР (СDСl 3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

0,88 (6Н, д, J=6,6 Гц), 1,75-1,90 (1Н, м), 1,87 (3Н, с), 2,03 (3Н, с), 2,05 (3Н, с), 2,08 (3Н, с), 2,42 (2Н, д, J=7,2 Гц), 3,80-3,95 (3Н, м), 4,18 (1Н, дд, J=2,4, 12,3 Гц), 4,29 (1Н, дд, J=5,5, 12,3 Гц), 5,11 (1Н, д, J=7,6 Гц), 5,10-5,25 (1Н, м), 5,25-5,40 (2Н, м), 6,90-7,25 (8Н, м).

Сравнительный пример 18

2-(4-этоксибензил)фенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

Указанное в заголовке соединение получают способом, описанным в сравнительном примере 14, с использованием 2-(4-этоксибензил)фенола вместо 2-(4-метоксибензил)фенола.

1H-ЯМР (СDСl 3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,39 (3Н, т, J=7,0 Гц), 1,91 (3Н, с), 2,03 (3Н, с), 2,05 (3Н, с), 2,07 (3Н, с), 3,80-3,95 (3Н, м), 3,99 (2Н, кв, J=7,0 Гц), 4,18 (1Н, дд, J=2,5, 12,3 Гц), 4,28 (1Н, дд, J=5,6, 12,3 Гц), 5,10 (1Н, д, J=7,7 Гц), 5,15-5,25 (1Н, м), 5,25-5,40 (2Н, м), 6,75-6,85 (2Н, м), 6,95-7,10 (5Н, м), 7,10-7,20 (1Н, м).

Сравнительный пример 19

2-(4-изопропоксибензил)фенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

Указанное в заголовке соединение получают способом, описанным в сравнительном примере 14, с использованием 2-(4-изопропоксибензил)фенола вместо 2-(4-метоксибензил)фенола.

1H-ЯМР (СDСl 3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,30 (6Н, д, J=6,0 Гц), 1,90 (3Н, с), 2,03 (3Н, с), 2,05 (3Н, с), 2,08 (3Н, с), 3,80-3,90 (3Н, м), 4,18 (1Н, дд, J=2,3, 12,3 Гц), 4,28 (1Н, дд, J=5,5, 12,3 Гц), 4,48 (1Н, гептет, J=6,0 Гц), 5,10 (1Н, д, J=7,7 Гц), 5,10-5,25 (1Н, м), 5,25-5,40 (2Н, м), 6,70-6,85 (2Н, м), 6,90-7,10 (5Н, м), 7,10-7,20 (1Н, м).

Сравнительный пример 20

5-ацетоксиметил-2-(4-этилбензил)фенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

Указанное в заголовке соединение получают способом, описанным в сравнительном примере 14, с использованием 5-ацетоксиметил-2-(4-этилбензил)фенола вместо 2-(4-метоксибензил)фенола.

1H-ЯМР (СDСl 3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,20 (3Н, т, J=1,6 Гц), 1,88 (3Н, с), 2,02 (3Н, с), 2,05 (3Н, с), 2,07 (3Н, с), 2,09 (3Н, с), 2,60 (2Н, кв, J=7,6 Гц), 3,80-3,95 (3Н, м), 4,20 (1Н, дд, J=2,4, 12,3 Гц), 4,27 (1H, дд, J=5,3, 12,3 Гц), 5,00-5,10 (2Н, м), 5,13 (1H, д, J=7,4 Гц), 5,15-5,40 (3Н, м), 6,95-7,15 (7Н, м).

Сравнительный пример 21

Ацетоксиметил-2-(4-пропоксибензил)фенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

Указанное в заголовке соединение получают способом, описанным в сравнительном примере 14, с использованием 5-ацетоксиметил-2-(4-пропоксибензил)фенола вместо 2-(4-метоксибензил)-фенола.

1H-ЯМР (СDСl 3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,01 (3Н, т, J=7,4 Гц), 1,70-1,85 (2Н, м), 1,92 (3Н, с), 2,03 (3Н, с), 2,05 (3Н, с), 2,07 (3Н, с), 2,09 (3Н, с), 3,80-3,95 (5Н, м), 4,20 (1H, дд, J=2,4, 12,3 Гц), 4,27 (1H, дд, J=5,3, 12,3 Гц), 5,00-5,10 (2Н, м), 5,12 (1H, д, J=7,4 Гц), 5,15-5,40 (3Н, м), 6,75-6,85 (2Н, м), 6,95-7,10 (5Н, м).

Сравнительный пример 22

2-[4-(2-Ацетоксиэтил)бензил]-5-ацетоксиметилфенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

Указанное в заголовке соединение получают способом, описанным в сравнительном примере 14, с использованием 2-[4-(2-ацетоксиэтил)бензил]-5-ацетоксиметилфенола вместо 2-(4-метоксибензил)фенола.

1H-ЯМР (СDСl 3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,89 (3Н, с), 2,03 (3Н, с), 2,03 (3Н, с), 2,05 (3Н, с), 2,07 (3Н, с), 2,09 (3Н, с), 2,88 (2Н, т, J=7,1 Гц), 3,85-3,95 (3Н, м), 4,15-4,35 (4Н, м), 5,00-5,10 (2Н, м), 5,13 (1Н, д, J=7,5 Гц), 5,15-5,40 (3Н, м), 6,95-7,15 (7Н, м).

Пример 1

2-(4-метоксибензил)фенил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

Метоксид натрия (28% метанольный раствор; 0,12 мл) добавляют к раствору 2-(4-метоксибензил)фенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида (0,11 г) в метаноле (4 мл) и смесь перемешивают при комнатной температуре в течение 30 минут. Растворитель удаляют при пониженном давлении. Остаток очищают колоночной хроматографией на силикагеле (элюент: дихлорметан/метанол=10/1) с получением 2-(4-метоксибензил)фенил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида (65 мг).

1H-ЯМР (СDСl3) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

3,35-3,55 (4Н, м), 3,69 (1Н, дд, J=5,1, 12,1 Гц), 3,73 (3Н, с), 3,80-4,00 (2Н, м), 4,03 (1Н, д, J=15,1 Гц), 4,91 (1Н, д, J=7,4 Гц), 6,75-6,85 (2Н, м), 6,85-6,95 (1Н, м), 6,95-7,10 (1H, м), 7,10-7,20 (4Н, м).

Пример 2

2-(4-метилбензил)фенил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

Указанное в заголовке соединение получают способом, описанным в примере 1, с использованием 2-(4-метилбензил)фенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида вместо 2-(4-метоксибензил)фенил-2, 3,4, 6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида.

1Н-ЯМР (CD3OD) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

2,27 (3Н, с), 3,35-3,55 (4Н, м), 3,69 (1Н, дд, J=5,2, 12,0 Гц), 3,80-3,90 (1Н, м), 3,94 (1H, д, J=15,0 Гц), 4,05 (1H, д, J - 15,0 Гц), 4,85-4,95 (1H, м), 6,85-6,95 (1H, м), 6,95-7,20 (7Н, м).

Пример 3

2-(4-этилбензил)фенил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

Указанное в заголовке соединение получают способом, описанным в примере 1, с использованием 2-(4-этилбензил)фенил-2,3,4,б-тетра-0-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида вместо 2-(4-метоксибензил)фенил-2, 3,4, 6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида.

1H-ЯМР (CD3OD) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,15-1,25 (3Н, м), 2,50-2,65 (2Н, м), 3,35-3,55 (4Н, м), 3,65-3,75 (1H, м), 3,80-4,00 (2Н, м), 4,06 (1H, д, J=14,9 Гц), 4,85-5,00 (1H, м), 6,85-7,00 (1H, м), 7,00-7,20 (7Н, м).

Пример 4

2-(4-изобутилбензил)фенил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

Указанное в заголовке соединение получают способом, описанным в примере 1, с использованием 2-(4-изобутилбензил)фенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида вместо 2-(4-метоксибензил)фенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида.

1H-ЯМР (CD3OD) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

0,80-0,95 (6Н, м), 1,70-1,90 (1Н, м), 2,41 (2Н, д, J=7,1 Гц), 3,30-3,55 (4Н, м), 3,60-3,75 (1Н, м), 3,80-3,95 (1Н, м), 3,95 (1Н, д, J=15,0 Гц), 4,06 (1Н, д, J=15,0 Гц), 4,85-4,95 (1Н, м), 6,80-7,20 (8Н, м).

Пример 5

2-(4-этоксибензил)фенил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

Указанное в заголовке соединение получают способом, описанным в примере 1, с использованием 2-(4-этоксибензил)фенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида вместо 2-(4-метоксибензил)фенил-2, 3,4, 6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида.

1H-ЯМР (CD3OD) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,35 (3Н, т, J=6,8 Гц), 3,35-3,55 (4Н, м), 3,60-3,75 (1Н, м), 3,80-4,10 (5Н, м), 4,90 (1Н, д, J=7,1 Гц), 6,70-6,85 (2Н, м), 6,85-6,95 (1Н, м), 7,00-7,20 (5Н, м).

Пример 6

2-(4-изопропоксибензил)фенил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

Указанное в заголовке соединение получают способом, описанным в примере 1, с использованием 2-(4-изопропоксибензил)фенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида вместо 2-(4-метоксибензил)фенил-2, 3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида.

1H-ЯМР (CD3OD) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,27 (6Н, д, J=6,0 Гц), 3,35-3,55 (4Н, м), 3,69 (1Н, дд, J=5,4, 12,1 Гц), 3,88 (1Н, дд, J=2,0, 12,1 Гц), 3,91 (1Н, д, J=15,0 Гц), 4,02 (1H, д, J=15,0 Гц), 4,51 (1H, гептет, J=6,0 Гц), 4,91 (1H, д, J=7,7 Гц), 6,70-6,85 (2Н, м), 6,85-6,95 (1H, м), 7,00-7,10 (1H, м), 7,10-7,20 (4Н, м).

Пример 7

5-гидроксиметил-2-(4-пропоксибензил)фенил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

Указанное в заголовке соединение получают способом, описанным в примере 1, с использованием 5-ацетоксиметил-2-(4-пропоксибензил)фенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида вместо 2-(4-метоксибензил)фенил-2, 3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида.

1H-ЯМР (CD3OD) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,02 (3Н, т, J=7,4 Гц), 1,70-1,85 (2Н, м), 3,30-3,55 (4Н, м), 3,65-3,75 (1H, м), 3,80-3,95 (4Н, м), 4,00 (1H, д, J=15,0 Гц), 4,54 (2Н, с), 4,93 (1H, д, J=7,4 Гц), 6,70-6,85 (2Н, м), 6,85-6,95 (1H, м), 7,02 (1H, д, J=7,7 Гц), 7,05-7,20 (3Н, м).

Пример 8

2-(4-этилбензил)-5-гидроксиметилфенил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

Указанное в заголовке соединение получают способом, описанным в примере 1, с использованием 5-ацетоксиметил-2-(4-этилбензил)фенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида вместо 2-(4-метоксибензил)фенил-2, 3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида.

1H-ЯМР (CD3OD) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,19 (3Н, т, J=7,6 Гц), 2,57 (2Н, kb, J=7,6 Гц), 3,30-3,55 (4Н, м), 3,65-3,75 (1Н, м), 3,85-4,00 (2Н, м), 4,04 (1Н, д, J=15,0 Гц), 4,54 (2Н, с), 4,93 (1Н, д, J=7,4 Гц), 6,85-6,95 (1Н, м), 7,02 (1Н, д, J=7,7 Гц), 7,06 (2Н, д, J=8,1 Гц), 7,10-7,20 (3Н, м).

Пример 9

2-[4-(2-гидроксиэтил)бензил]-5-гидроксиметилфенил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

Указанное в заголовке соединение получают способом, описанным в примере 1, с использованием 2-[4-(2-ацетоксиэтил)бензил]-5-ацетоксиметилфенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида вместо 2-(4-метоксибензил)фенил-2,3,4,6-тетра-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида.

1H-ЯМР (CD3OD) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

2,76 (2Н, т, J=7,1 Гц), 3,30-3,55 (4Н, м), 3,60-3,75 (3Н, м), 3,85-4,00 (2Н, м), 4,05 (1Н, д, J=14,6 Гц), 4,54 (2Н, с), 4,92 (1Н, д, J=7,2 Гц), 6,85-6,95 (1Н, м), 7,03 (1Н, д, J=7,9 Гц), 7,09 (2Н, д, J=7,8 Гц), 7,10-7,20 (3Н, м).

Пример 10

2-[4-(2-гидроксиэтил)бензил]фенил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

К раствору 2-[4-(2-бензоилоксиэтил)бензил]фенола (0,49 г) и 1,2,3,4,6-пента-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопираноэы (1/7 г) в толуоле (5,2 мл) и дихлорметане (2,2 мл) добавляют комплекс трифторид бора - диетиловый эфир (0,56 мл) и смесь перемешивают при 25°С в течение 8 часов. К реакционной смеси добавляют этилацетат (70 мл) и насыщенный водный раствор бикарбоната натрия (25 мл) и органический слой отделяют. Органический слой промывают насыщенным раствором соли (25 мл) и сушат над безводным сульфатом натрия и растворитель удаляют при пониженном давлении. Остаток растворяют в метаноле (5 мл) и тетрагидрофуране (2,5 мл), к полученному раствору добавляют метоксид натрия (28% метаноловый раствор, 0,14 мл) и полученную смесь перемешивают при 25°С в течение 12,5 часов. К реакционной смеси добавляют этилацетат (75 мл) и воду (20 мл) и органический слой отделяют. Органический слой промывают насыщенным раствором соли (20 мл), сушат над безводным сульфатом натрия и растворитель удаляют при пониженном давлении. Остаток растворяют в метаноле (7,5 мл), к полученному раствору добавляют метоксид натрия (28% метанольный раствор, 0,085 мл) и полученную смесь перемешивают при 25°С в течение 5 часов. Реакционную смесь очищают колоночной хроматографией на силикагеле (элюент: дихлорметан/метанол=4/1). Растворитель удаляют при пониженном давлении, к остатку добавляют диэтиловый эфир и полученные осадки собирают фильтрацией. Полученное твердое вещество промывают диэтиловым эфиром и сушат при пониженном давлении с получением 2-[4-(2-гидроксиэтил)бензил]фенил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида (0,47 г).

1H-ЯМР (CD3OD) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

2,76 (2Н, т, J=7,1 Гц), 3,35-3,55 (4Н, м), 3,65-3,75 (3Н, м), 3,88 (1Н, дд, J=1,8, 11,8 ГЦ), 3,95 (1Н, д, J=15,2 Гц), 4,07 (1H, д, J=15,2 Гц), 4,90 (1H, д, J=7,4 Гц), 6,85-6,95 (1H, м), 7,00-7,20 (7Н, м).

Пример 11

2- [4- (3-гидроксипропил) бензил] фенил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопираноэид

Указанное в заголовке соединение получают способом, описанным в примере 10, с использованием 2-[4-(3-бензоилоксипропил)бензил]фенола вместо 2-[4-(3-бензоилоксиэтил)бензил]фенола.

1 H-ЯМР (CD3OD) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,70-1,85 (2Н, м), 2,55-2,65 (2Н, м), 3,30-3,60 (6Н, м), 3,69 (1H, дд, J=5,2, 11,9 ГЦ), 3,88 (1H, дд, J=2,0, 11,9 Гц), 3,95 (1H, д, J=15,1 Гц), 4,06 (1H, д, J=15,1 Гц), 4,90 (1H, д, J=7,3 Гц), 6,85-6,95 (1H, м), 7,00-7,20 (7Н, м).

Пример 12

2-(4-этилтиобензил)фенил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозид

К раствору 2-(4-этилтиобензил)фенола (0,51 г) и 1,2,3,4,6-пента-О-ацетил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозы (2,4 г) в толуоле (6,3 мл) и дихлорметане (2,7 мл) добавляют комплекс трифторид бора - диэтиловый эфир (0,78 мл) и смесь перемешивают при комнатной температуре в течение 9 часов. К реакционной смеси добавляют этилацетат (70 мл) и насыщенный водный раствор бикарбоната натрия (25 мл) и органический слой отделяют. Органический слой промывают насыщенным раствором соли (25 мл), сушат над безводным сульфатом натрия и растворитель удаляют при пониженном давлении. Остаток растворяют в метаноле (10,5 мл), к полученному раствору добавляют метоксид натрия (28% метанольный раствор, 0,08 мл) и смесь перемешивают при 25°С в течение 18 часов. К реакционной смеси добавляют этилацетат (75 мл) и воду (20 мл) и органический слой отделяют. Органический слой промывают насыщенным раствором соли (20 мл), сушат над безводным сульфатом натрия и растворитель удаляют при пониженном давлении. Остаток очищают колоночной хроматографией на силикагеле (элюент: дихлорметан/метанол=10/1). Растворитель удаляют при пониженном давлении, к остатку добавляют диэтиловый эфир и полученные осадки собирают фильтрацией. Полученное бесцветное твердое вещество промывают диэтиловым эфиром и сушат при пониженном давлении с получением 2-(4-этилтиобензил)фенил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида (0,51 г).

1H-ЯМР (CD3OD) глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340 м.д.:

1,24 (3Н, т, J=7,3 Гц), 2,88 (2Н, kв, J=7,3 Гц), 3,35-3,55 (4Н, м), 3,69 (1Н, дд, J=5,0, 12,2 Гц), 3,88 (1Н, дд, J=2,0, 12,2 Гц), 3,95 (1Н, д, J=15,1 Гц), 4,08 (1Н, д, J=15,1 Гц), 4,91 (1Н, д, J=7,3 Гц), 6,85-7,00 (1Н, м), 7,00-7,10 (1H, м), 7,10-7,30 (6Н, м).

Пример испытаний 1

Анализ на ингибирующее действие в отношении активности SGLT2 человека

1) Конструирование плазмидного вектора, экспрессирующего SGLT2 человека

кДНК-библиотеку для ПЦР-амплификации получали посредством обратной транскрипции полной РНК, полученной из человеческой почки (гена Ori), с использованием oligo-dT в качестве праймера и системы для предварительной амплификации (SUPERSCRIPT Preamplification System (Gibco-BRL; LIFE TECHNOLOGIES). ДНК-фрагмент, кодирующий SGLT2 человека, амлифицировали посредством реакции ПЦР с использованием ДНК-полимеразы Pfu (Stratagene), где вышеуказанную кДНК-библиотеку человеческой почки использовали в качестве матрицы, а нижеуказанные олигонуклеотиды 0702F и 0712R, представленные как Последовательности №№1 и 2, соответственно, использовали в качестве праймеров. Амплифицированный ДНК-фрагмент лигировали в pCR-Blunt (Invitrogen), вектор для клонирования, в соответствии со стандартным методом с использованием набора. Компетентную клетку, Escherichia coli HB101 (Toyobo), трансформировали в соответствии со стандартным методом, а затем осуществляли отбор трансформантов на агаровой среде LB, содержащей 50 мкг/мл канамицина. После экстракции и выделения плазмидной ДНК из одного из этих трансформантов осуществляли амплификацию ДНК-фрагмента, кодирующего SGLT2 человека, посредством реакции ПЦР с использованием ДНК-полимеразы Pfu (Stratagene), где нижеуказанные олигонуклеотиды 0714F и 0715R, представленные как Последовательности №№3 и 4, соответственно, были использованы в качестве праймеров. Дмплифицированный ДНК-фрагмент гидролизовали ферментами рестрикции Xhol и HindIII, а затем очищали с использованием системы очистки Wizard (Promega). Полученный очищенный ДНК-фрагмент встраивали в соответствующие рестрикционные сайты pcDNA3.1 (-) Myc/His-A (Invitrogen), т.е. вектора для экспрессии гибридного белка. Компетентную клетку, Escherichia coli HB101 (Toyobo), трансформировали в соответствии со стандартным методом, а затем осуществляли отбор трансформантов на агаровой среде LB, содержащей 100 мкг/мл ампициллина. После выделения и очистки плазмидной ДНК из одного из этих трансформантов, анализировали последовательность ДНК-фрагмента, встроенного в сайты множественного клонирования вектора pcDNA3.1 (-) Myc/His-A. Этот клон, по сравнению с человеческим SGLT2, описанным Wells et al. (Am. J. Physiol., Vol. 263, pp. 459-465 (1992)) имел замену в одном основании (АТС, который кодирует изолейцин 433, был заменен на GTC). Поэтому был получен клон, в котором изолейцин 433 был заменен на валин. Этот плазмидный вектор, экспрессирующий SGLT2 человека, в котором пептид, представленный Последовательностью №5, был лигирован с карбоксильным концевым аланиновым остатком, был обозначен KL29.

Последовательность №1 ATGGAGGAGCACACAGAGGC

Последовательность №2 GGCATAGAAGCCCCAGAGGA

Последовательность №3 AACCTCGAGATGGAGGAGCACACAGAGGC

Последовательность №4 AACAAGCTTGGCATAGAAGCCCCAGAGGA

Последовательность №5 KLGPEQKLISEEDLNSAVDHHHHHH

2) Получение клеток, неустойчиво экспрессирующих SGLT2 человека

KL29, плазмиду, кодирующую SGLT2 человека, трансфецировали в клетки COS-7 (RIKEN CELL BANK RCB0539) электропорацией. Электропорацию осуществляли с использованием генного генератора импульсов GENE PULSER II (Bio-Rad Laboratories) при следующем условии: 0,290 кВ, 975 мкФ, 2×106 клеток COS-7 и 20 мкг KL29 в 500 мкл среды OPTI-MEM I (Gibco-BRL: LIFE TECHNOLOGIES) в кювете типа 0,4 см. После переноса гена, клетки собирали центрифугированием и ресуспендировали в среде OPTI-MEM I (1 мл/кювету). В каждую лунку 96-луночного планшета добавляли 125 мкл этой клеточной суспензии. После культивирования в течение ночи при 37°С и при 5% CO2, в каждую лунку добавляли 125 мкл среды DMEM (Gibco-BRL: LIFE TECHNOLOGIES), содержащей 10% фетальную бычью сыворотку (Sanko Jyunyaku), 100 единиц/мл натрийсодержащего пенициллина G (Gibco-BRL: LIFE TECHNOLOGIES), и 100 мкг/мл сульфата стрептомицина (Gibco-BRL: LIFE TECHNOLOGIES). После культивирования вплоть до следующего дня эти клетки использовали для измерения ингибирующей активности, направленной против поглощения метил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида.

3) Измерение ингибирующей активности, направленной на поглощение метил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида

После удаления среды клеток COS-7, временно экспрессирующих SGLT2 человека, в каждую лунку добавляли 200 мкл буфера для предварительной обработки (буфер, рН 7,4, содержащий 140 мМ хлорида холина, 2 мМ хлорида калия, 1 мМ хлорида кальция, 1 мМ хлорида магния, 10 мМ 2-[4-(2-гидроксиэтил)-1-пиперазинил]этансульфоновой кислоты и 5 мМ трис(гидроксиметил)аминометана), и клетки инкубировали при 37°С в течение 10 минут. Буфер для предварительной обработки удаляли и снова добавляли 200 мкл того же самого буфера, а затем клетки инкубировали при 37°С в течение 10 минут. Семь мкл метил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D- (U-14C) глюкопиранозида (Amersham Pharmacia Biothech) добавляли к 525 мкл указанного буфера для поглощения, содержащего тестируемый образец (буфер, рН 7,4, содержащий 140 мМ хлорида натрия, 2 мМ хлорида калия, 1 мМ хлорида кальция, 1 мМ хлорида магния, 5 мМ метил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида, 10 мМ 2-[4-(2-гидроксиэтил)-1-пиперазинил]этансульфоновой кислоты и 5 мМ трис(гидроксиметил)аминометана), и полученную смесь перемешивали, а затем получали буфер для измерения поглощения. В качестве контроля получали буфер для измерения поглощения без тестируемого соединения. Для оценки базального поглощения в отсутствие тестируемого соединения и натрия, аналогичным образом получали буфер для измерения базального поглощения, который вместо хлорида натрия содержал 140 мМ хлорида холина. После удаления буфера для предварительной обработки, в каждую лунку добавляли 75 мкл буфера для измерения поглощения и клетки инкубировали при 37°С в течение 2 часов. После удаления буфера для измерения поглощения в каждую лунку добавляли 200 мкл промывочного буфера (буфера, рН 7,4, содержащего 140 мМ хлорида холина, 2 мМ хлорида калия, 1 мМ хлорида кальция, 1 мМ хлорида магния, 10 мМ метил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозида, 10 мМ 2-[4-(2-гидроксиэтил)-1-пиперазинил]этансульфоновой кислоты и 5 мМ трис(гидроксиметил)аминометана), и сразу удаляли. После двух дополнительных промывок клетки солюбилизировали добавлением в каждую лунку 75 мкл 0,2 н гидроксида натрия. После переноса клеточных лизатов в PicoPlate (Packard) и добавления в каждую лунку 150 мкл MicroScint-40 (Packard) измеряли радиоактивность с использованием сцинтилляционного счетчика TopCount для микропланшетов (Packard). Разность поглощения получали как 100% величину путем вычитания радиоактивности при базальном поглощении из радиоактивности при контрольном поглощении, а затем методом наименьших квадратов вычисляли концентрации, при которых ингибируется 50% поглощения (величина IC50), исходя из кривой "концентрация - ингибирование". Результаты представлены в нижеследующей таблице 1.

[Таблица 1]
Испытуемое соединение Величина IC50 (нМ)
Пример 1 350
Пример 2 450
Пример 3 140
Пример 4 500
Пример 5 330
Пример 6 370
Пример 7 140
Пример 8 8,1
Пример 9 27
Пример 10 210
Пример 11 75
Пример 12 110

Пример испытаний 2

Анализ на действие, облегчающее экскрецию (выделение) глюкозы в мочу

В качестве экспериментальных животных использовали крыс 3D, которых выдерживали в условиях голодания в течение ночи (SLC., самцы в возрасте 7-недель, 180-240 г). Десять мг испытуемого соединения суспендировали или растворяли в 300 мкл этанола, а затем растворяли добавлением 1,2 мл полиэтиленгликоля 400 и 1,5 мл физиологического раствора, после чего получали 3,3 мг/мл раствора. Триста мкл этого раствора растворяли в 2,7 мл раствора для разведения (физиологический раствор:полиэтиленгликоль 400:этанол=5:4:1), а затем получали 0,33 мг/мл раствора. После измерения массы тела крыс в хвостовую вену крыс инъецировали испытуемое соединение в дозе 3 мл/кг (1 мг/кг). В качестве контроля, в хвостовую вену крыс внутривенно инъецировали лишь один физиологический раствор (физиологический раствор:полиэтиленгликоль 400:этанол=5:4:1) в дозе 3 мл/кг. Сразу после внутривенной инъекции в хвостовую вену крысам перорально вводили 200 г/л раствора глюкозы в дозе 10 мл/кг (2 г/кг). Внутривенные инъекции в хвостовую вену проводили иглой для инъекций калибра 26 G и 1-мл шприцем. Пероральное введение осуществляли с помощью желудочного зонда для крыс и 2,5-мл шприца. Число крыс в одной группе составляло 2 или 3. Сбор мочи осуществляли в метаболической клетке после окончания перорального введения глюкозы. Сбор мочи для анализа проводили через 24 часа после окончания перорального введения глюкозы. После окончания сбора мочи объем мочи регистрировали и измеряли концентрацию глюкозы в моче. Концентрацию глюкозы в моче измеряли с использованием набора для лабораторного теста: Glucose B-Test WAKO (Wako Pure Chemical Industries, Ltd.). Затем определяли количество выделения глюкозы с мочой за 24 часа на 200 г массы тела для всего объема мочи, концентрацию глюкозы в моче и массу тела. Результаты представлены в нижеследующей таблице 2.

[Таблица 2]
Испытуемое соединение Количество выделения глюкозы с мочой (мг)
Пример 1 27,4
Пример 7 109,1
Пример 8 238,9
Пример 10 69,5

Пример испытаний 3

Тест на острую токсичность

Пятинедельных самцов мышей ICR (CLEA JAPAN, INC., 29-34 г, 5 животных в каждой группе) выдерживали в условиях голодания в течение 4 часов, после чего подкожно вводили 666 мг/мл суспензии, которая была получена добавлением к 2-[4-(2-гидроксиэтил)бензил]фенил-глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340-D-глюкопиранозиду смеси физиологический раствор:полиэтиленгликоль 400:этанол (5:4:1) в дозе 3 мл/кг (2000 мг/кг). В течение 24 часов после введения гибели животных не наблюдалось.

Промышленная применимость

Глюкопиранозилоксибензилбензольные производные настоящего изобретения, представленные вышеуказанной общей формулой (I), обладают превосходной ингибирующей активностью в отношении SGLT2 человека. Настоящее изобретение позволяет получить агенты для предупреждения или лечения диабета, осложнений диабета, ожирения или т.п. Кроме того, поскольку соединения, представленные вышеуказанной общей формулой (II), имеют важное значение как промежуточные соединения для получения соединений, представленных вышеуказанной общей формулой (I), то с помощью таких соединений могут быть легко получены соединения настоящего изобретения, представленные вышеуказанной общей формулой (I).

ФОРМУЛА ИЗОБРЕТЕНИЯ

1. Производное глюкопиранозилоксибензилбензола общей формулы

глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340

где R1 представляет атом водорода или гидрокси(низший)алкил, а R2 представляет низшую алкильную группу, низшую алкоксигруппу и низшую алкилтиогруппу, каждая из которых необязательно замещена гидрокси или (низшей)алкокси группой, или его фармацевтически приемлемая соль.

2. Производное глюкопиранозилоксибензилбензола по п.1 общей формулы

глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340

где R1 представляет атом водорода или гидрокси(низший)алкил, а R3 представляет низшую алкильную группу, низшую алкоксигруппу или гидрокси(низший)алкил, или его фармацевтически приемлемая соль.

3. Фармацевтическая композиция, обладающая гипогликемической активностью и ингибирующей активностью по отношению к SGLT2 человека, содержащая в качестве активного ингредиента производное глюкопиранозилоксибензилбензола по п.1 или 2 или его фармацевтически приемлемую соль.

4. Фармацевтическая композиция по п.3, представляющая собой ингибитор человеческого SGLT2.

5. Фармацевтическая композиция по п.4, представляющая собой средство для предупреждения или лечения диабета или осложнений, связанных с диабетом.

6. Фармацевтическая композиция по п.4, представляющая собой средство для предупреждения или лечения ожирения.

7. Способ предупреждения или лечения заболевания, связанного с гипергликемией, включающий введение производного глюкопиранозилоксибензилбензола по п.1 или 2 или его фармацевтически приемлемой соли.

8. Способ предупреждения или лечения заболевания по п.7, где указанным заболеванием, связанным с гипергликемией, является диабет или осложнения диабета.

9. Способ предупреждения или лечения заболевания по п.7, где указанным заболеванием, связанным с гипергликемией, является ожирение.

10. Производное глюкопиранозилоксибензилбензола по п.1 или 2 или его фармацевтически приемлемая соль в качестве активного ингредиента фармацевтической композиции для предупреждения или лечения заболевания, связанного с гипергликемией.

11. Производное глюкопиранозилоксибензилбензола или его фармацевтически приемлемая соль по п.10, где указанным заболеванием, связанным с гипергликемией, является диабет или осложнения диабета.

12. Производное глюкопиранозилоксибензилбензола или его фармацевтически приемлемая соль по п.10, где указанным заболеванием, связанным с гипергликемией, является ожирение.

13. Бензилфенольное производное общей формулы

глюкопиранозилоксибензилбензольные производные, лекарственные   композиции, содержащие эти производные, и промежуточные соединения   для получения указанных производных, патент № 2254340

где R11 представляет атом водорода или защищенный гидрокси(низший)алкил, a R12 представляет низшую алкильную группу, низшую алкоксигруппу, низшую алкилтиогруппу, защищенный гидрокси(низший)алкил, защищенный гидрокси(низший)алкокси, защищенный гидрокси(низший)алкилтио, низший алкокси-замещенный низший алкил, низший алкокси-замещенный низший алкокси или низший алкокси-замещенный низший алкилтио; при условии, что R12 не является метильной группой, этильной группой, изопропильной группой, трет-бутильной группой или метоксигруппой, когда R11 представляет атом водорода; или его соль.


Скачать патент РФ Официальная публикация
патента РФ № 2254340

patent-2254340.pdf
Патентный поиск по классам МПК-8:

Класс C07H15/203 моноциклические карбоциклические кольца, кроме циклогексановых; бициклические карбоциклические системы

Патенты РФ в классе C07H15/203:
способы конвергентного синтеза производных калихимицина -  патент 2436790 (20.12.2011)
5,6-бис-(1',2':3',4'-ди-о-изопропилиден- -d-галактопиранозо-6'-ил)-1,3-дииминоизоиндолин -  патент 2409586 (20.01.2011)
4,5-бис-(1',2':3',4'-ди-о-изопропилиден- -d-галактопиранозо-6'-ил)фталонитрил -  патент 2409585 (20.01.2011)
гликозидное пролекарство 5-аминосалициловой кислоты -  патент 2341529 (20.12.2008)
новые ароматические фторгликозидные производные, содержащие эти соединения лекарственные средства, и их применение -  патент 2340622 (10.12.2008)
производные арил 5-тио- -d-глюкопиранозида и терапевтические средства при диабете, содержащие их -  патент 2322449 (20.04.2008)
производное олигосахаридов -  патент 2290408 (27.12.2006)
о-арилглюкозидные ингибиторы sglt2 и способ их применения -  патент 2269540 (10.02.2006)
гликоконъюгаты 20(s)-камптотецина -  патент 2184122 (27.06.2002)
инозитолгликаны с инсулиноподобным действием, способ их получения, фармацевтическая композиция и способ ее получения -  патент 2178794 (27.01.2002)

Класс C07C69/78 эфиры бензойной кислоты 

Патенты РФ в классе C07C69/78:
соль цинка или меди (ii) и ее применение в качестве биоцида -  патент 2497857 (10.11.2013)
соединения коричной кислоты (варианты), промежуточные соединения для их получения, фармацевтическая композиция на их основе, способ ингибирования гистоновой деацетилазы, способ лечения диабета, способ лечения опухоли или заболевания, связанного с пролиферацией клеток, способ усиления роста аксонов и способ лечения нейродегенеративных заболеваний и спинной мышечной атрофии -  патент 2492163 (10.09.2013)
сложноэфирные соединения бензойной кислоты, композиция (варианты) и способ получения композиции (варианты) -  патент 2485936 (27.06.2013)
способ получения алкиловых эфиров бензойной кислоты -  патент 2481324 (10.05.2013)
способ получения низкомолекулярных замещенных фенилбензоатов -  патент 2471770 (10.01.2013)
смеси изомерных изонониловых эфиров бензойной кислоты, способ их получения, их смеси с алкиловыми эфирами фталевой, адипиновой или циклогександикарбоновой кислоты, а также применение этих смесей -  патент 2335489 (10.10.2008)
соединения для контролируемого высвобождения активных молекул -  патент 2296118 (27.03.2007)
способ получения сложных эфиров карбоновых кислот -  патент 2202536 (20.04.2003)
способ получения бензилбензоата -  патент 2128162 (27.03.1999)
способ получения дизащищенного 2,3- гидроксиметилцитилциклобутанола -  патент 2118312 (27.08.1998)

Класс C07C69/16 диоксисоединений 

Класс C07C69/18 триоксисоединений 

Класс C07C323/18 с атомом серы по меньшей мере одной из тиогрупп, присоединенным к атому углерода шестичленного ароматического кольца углеродного скелета

Класс C07C39/04 фенол 

Класс A61K31/7034  присоединенные к карбоциклическому соединению, например флоридзин

Патенты РФ в классе A61K31/7034:
средство, обладающее мочегонным и противовоспалительным действием -  патент 2522925 (20.07.2014)
фармацевтическая композиция на основе растительной докозагексаеновой кислоты для лечения и профилактики заболеваний печени -  патент 2505289 (27.01.2014)
фармацевтическая композиция, содержащая фермент дезоксирибонуклеазу, альфа-фетопротеин и глицирризиновую кислоту или ее соли: глицирризинат аммония, или дикалия, или тринатрия -  патент 2494757 (10.10.2013)
производные нистатина и их применение в качестве противогрибковых агентов -  патент 2488590 (27.07.2013)
применение полидатина для лечения заболеваний печени и фармацевтическая композиция на основе полидатина -  патент 2468803 (10.12.2012)
новые аминогликозидные антибиотики -  патент 2458931 (20.08.2012)
субстраты из класса олигосахаридов, модифицированных флуоресцентной группой, для детектирования ферментов целлюлазного комплекса на твердых средах -  патент 2378283 (10.01.2010)
субстраты из класса олигосахаридов для детектирования эндо-гликозидгидролаз в присутствии экзо-действующих ферментов -  патент 2378282 (10.01.2010)
новые ароматические фторгликозидные производные, содержащие эти соединения лекарственные средства, и их применение -  патент 2340622 (10.12.2008)
производные арил 5-тио- -d-глюкопиранозида и терапевтические средства при диабете, содержащие их -  патент 2322449 (20.04.2008)

Класс A61P3/04 анорексанты; средства против ожирения

Патенты РФ в классе A61P3/04:
новый вариант эксендина и его конъюгат -  патент 2528734 (20.09.2014)
способ снижения веса, комплексный состав продуктов для снижения веса, комплект для упаковки, хранения, транспортировки продуктов для снижения веса -  патент 2528480 (20.09.2014)
новое производное пиразол-3-карбоксамида, обладающее антагонистической активностью в отношении рецептора 5-нт2в -  патент 2528406 (20.09.2014)
терапевтические агенты 713 -  патент 2526055 (20.08.2014)
производные fgf21 со связующим альбумина а-в-с-d-e- и их применение -  патент 2525393 (10.08.2014)
способ коррекции ожирения абдоминального типа -  патент 2525007 (10.08.2014)
растворимые во рту и/или шипучие композиции, содержащие по меньшей мере один s-аденозилметионин (sam) -  патент 2524645 (27.07.2014)
лекарственное средство, включающее совместное применение или комбинацию ингибитора dpp-iv и другого лекарственного средства для лечения диабета -  патент 2523552 (20.07.2014)
соли производных тетерагидро-имидазо[1,5-a]пиразина, способы их получения и их медицинское применение -  патент 2523543 (20.07.2014)
соединение для лечения метаболических расстройств -  патент 2521284 (27.06.2014)

Класс A61P3/10 для лечения гипергликемии, например антидиабетические средства

Патенты РФ в классе A61P3/10:
новый вариант эксендина и его конъюгат -  патент 2528734 (20.09.2014)
хиназолиноны как ингибиторы пролилгидроксилазы -  патент 2528412 (20.09.2014)
соли метил(r)-7-[3-амино-4-(2,4,5-трифторфенил)-бутирил]-3-трифторметил-5,6,7,8-тетрагидро-имидазо[1,5-a]пиразин-1-карбоксилата -  патент 2528233 (10.09.2014)
инсулин-олигомерные конъюгаты, их препараты и применения -  патент 2527893 (10.09.2014)
ингибиторы поли(адф-рибозо)полимеразы-1 человека на основе производных урацила -  патент 2527457 (27.08.2014)
аналоги хроменона в качестве модуляторов сиртуина -  патент 2527269 (27.08.2014)
способ повышения фармакологической активности действующего вещества лекарственного средства и фармацевтическая композиция -  патент 2526153 (20.08.2014)
способ комплексного лечения артериальной гипертонии при метаболических нарушениях -  патент 2525593 (20.08.2014)
способ коррекции ожирения абдоминального типа -  патент 2525007 (10.08.2014)
применение apl пептида для лечения воспалительной болезни кишечника и диабета типа 1 -  патент 2524630 (27.07.2014)

Класс A61P43/00 Лекарственные средства для специфических целей, не указанные в группах  1/00

Патенты РФ в классе A61P43/00:
улучшение памяти у пациентов с оценкой 24-26 баллов по краткой шкале оценки психического статуса -  патент 2529815 (27.09.2014)
способ лечения больных с синдромом внутрипеченочной портальной гипертензии -  патент 2529414 (27.09.2014)
способ лечения ран мягких тканей различной этиологии -  патент 2528905 (20.09.2014)
хиназолиноны как ингибиторы пролилгидроксилазы -  патент 2528412 (20.09.2014)
новый агонист бета рецептора тиреоидного гормона -  патент 2527948 (10.09.2014)
стабильная жидкая фармацевтическая композиция комплекса 3-(2,2,2-триметилгидразиний) пропионат-2-этил-6-метил-3-гидроксипиридина дисукцината, обладающая антигипоксическим, антиоксидантным и адаптогенным действием -  патент 2527347 (27.08.2014)
четырехзамещенные бензолы -  патент 2527177 (27.08.2014)
способ коррекции негативных эффектов низких температур на предстательную железу крыс -  патент 2527172 (27.08.2014)
способ модулирования биологических функций, ассоциированных с процессом старения пожилого или старого животного-компаньона. -  патент 2525617 (20.08.2014)
гомографт сердечно-сосудистой системы (варианты), способ получения гомографта, среда для воздействия на ткани гомографта (варианты) -  патент 2525197 (10.08.2014)

Наверх