ПАТЕНТНЫЙ ПОИСК В РФ
НОВЫЕ ПАТЕНТЫ, ЗАЯВКИ НА ПАТЕНТ
БИБЛИОТЕКА ПАТЕНТОВ НА ИЗОБРЕТЕНИЯ

способ идентификации генов стафилококковых экзотоксинов, с высокой структурной гомологией с суперантигенами, методом мультиплексной полимеразной цепной реакции и тест-система для его осуществления

Классы МПК:C12Q1/68 использующие нуклеиновые кислоты
C12Q1/02 использующие жизнеспособные микроорганизмы
C12N15/00 Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев
C12N15/11 фрагменты ДНК или РНК; их модифицированные формы
Автор(ы):,
Патентообладатель(и):Федеральное бюджетное учреждение науки "Казанский научно-исследовательский институт эпидемиологии и микробиологии" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (RU)
Приоритеты:
подача заявки:
2013-05-07
публикация патента:

Изобретение относится к биотехнологии и микробиологии и представляет собой способ идентификации кластера генов, кодирующих стафилококковые белки, являющиеся экзотоксинами. Для осуществления настоящего способа проводят мультипраймерную полимеразную цепную реакцию в один прием в двух реакционных смесях, первая из которых содержит праймеры к генам, кодирующим такие белки стафилококков, как термонуклеаза, бета-глюкозидаза у видов S.aureus, S.epidermidis, S.haemolyticus, S.lugdunensis, S.saprophyticus, а вторая - к генам set1, set2, set3, set4, set5, кодирующим экзотоксины. Затем проводят анализ путем сравнения амплицированных фрагментов генов, полученных в двух аликвотах образца, с положительным контрольным образцом в соответствии с идентификационной таблицей. Настоящее изобретение также раскрывает тест-систему для осуществления указанного способа, которая содержит компоненты для выделения ДНК, компоненты для проведения ПЦР и компоненты для анализа результатов. При этом компоненты для проведения ПЦР содержат 10-кратный буферный раствор, рН 8,4, деионизированную стерильную воду, один положительный контрольный образец, фермент Taq-полимеразу, смесь четырёх дНТФ, смесь праймеров № 1, содержащую epi-F, epi-R, aur-F, aur-R, hae-F, hae-R, lug-F, lug-R, sap-F, sap-R в соотношении 1:1:1:1:1:1:1:1:1:1, и смесь прамеров № 2, содержащую set1-F, set1-R, set2-F, set2-R, set3-F, set3-R, set4-F, set4-R, set5-F, set5-R в соотношении 1:1:1:1:1:1:1:1:1:1. Настоящее изобретение позволяет выявить кластер генов, кодирующих стафилококковые белки, молекулярная масса которых составляет от 25 до 35 кДа, состоящих почти из 200 аминокислотных остатков и имеющих третичную структуру, высокогомологичную с некоторыми суперантигенами стафилококка (энтеротоксины, TSST-1 токсин) и с пирогенным стрептококковым экзотоксином C. 2 н.п. ф-лы, 3 табл., 1 пр.

Изобретение относится к микробиологии и может быть использовано в медицинской микробиологии для определения генов экзотоксинов в клинических штаммах стафилококков.

Данный способ позволяет выявить с помощью ПЦР-анализа кластер генов, кодирующих стафилококковые белки, молекулярная масса которых составляет от 25 до 35 кДа, состоящих почти из 200 аминокислотных остатков и имеющих третичную структуру высокогомологичную с некоторыми суперантигенами стафилококка (энтеротоксины, TSST-1 токсин) и с пирогенным стрептококковым экзотоксином C [2].

Данные белки - экзотоксины стафилококков в отличие от суперантигенов характеризуются отсутствием поликлональной активацией лимфоцитов, но способны вызывать продукцию провоспалительных цитокинов макрофагами, а также специфически взаимодействовать с Toll-подобными рецепторами 2 (TLR2) [3] на человеческих иммунекомпетентных клетках, например на макрофагах. Установлена также способность этих белков блокировать TLR2 рецепторы клеток [4], ингибировать связывание сывороточных IgA с рецепторами на фагоцитах, снижая бактерицидную активность последних [5, 6], связывать молекулы IgG, предотвращая их взаимодействие с компонетном комплимента Clq и Feспособ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 рецепторами на нейтрофилах [10]. Экзотоксины стафилококка также способны взаимодействовать с другим рецепторным белком для молекул Р-селектина (Р-selectin гликопротеин лиганда 1, PSGL-1), тем самым ингибируя взаимодействие PSGL-1 с P-селектином на эндотелии и тромбоцитах [7]. Экзотоксины ингибируют протеолитическую активность матриксной металлопротеиназы 9 (ММП-9) в тканях воздействуя на миграцию нейтрофилов [8], способны также изменять хемотаксис опухолевых клеток [9].

Таким образом, экзотоксины стафилококка способны нарушать функционирование иммунных механизмов элиминации патогенных и условно-патогенных бактерий и могут выступать в качестве дополнительных факторов, модифицирующих известные представления об основных звеньях патогенеза стафилококковых инфекций.

Детектируемые гены set1, set2, set3, set4, set5 [2], как правило, содержаться в т.н. патогенных остравах генома стафилококка и представлены кластером генов. В заявленном способе предлагается детектировать гены, образующие кластер, состоящий из 5 генов, следующих друг за другом set2-set3-setl-set5-set4, между генами располагаются межгенные участки или вставки (нуклеотидные последовательностей размером от 339 до 446 п.н.) [2].

Известен способ идентификации токсигенных штаммов v. Cholerae O1, определения их биовара и дифференциации штаммов биовара эльтор на типичные и измененные методом мультиплексной полимеразной цепной реакции и тест-система для его осуществления [1], который является прототипом данного изобретения, отличающийся тем, что объектом исследования в данном изобретении являются грамположительные микрорганизмы, относящиеся к роду Staphylococcus spp., и идентифицированные на коагулазопозитивные или коагулазонегативные, имеющие важное медицинское значение в патологии человека.

Таким образом, в медицинской микробиологии существует очевидная потребность в разработке высокочувствительного, специфичного и быстрого способа, генотипической идентификации способности к экзотоксинообразованию у клинически значимых штаммов стафилококков, выделяемых от человека, и объектах медицинского назначения, а также тест-системы для его осуществления, которая может быть применима в практике современных бактериологических лабораторий.

Техническим результатом изобретения является молекулярно-генетическая идентификации кластера генов, включающего гены set1, set2, set3, set4, set5, кодирующих экзотоксиноподобные белки, в выделенной культуре штаммов стафилококков, с использованием оригинальных праймеров, разработанных и предложенных в изобретении.

Технический результат достигается способом идентификации праймер-специфических участков генов setl, set2, set3, set4, set5 в ДНК стафилококковых штаммов методом мультиплексной полимеразной цепной реакции, характеризующимся тем, что ПЦР проводят в двух реакционных смесях, каждая из которых содержит специально подобранное сочетание праймеров к генам, кодирующим такие белки стафилококков, как термонуклеаза, бета-глюкозидаза, у видов S.aureus, S.epidermidis, S.haemolyticus, S.lugdunensis, S.saprophyticus, нуклеотидная последовательность которых была использована из работы японских исследователей Shintaro Н., Takashi S. et al., 2011 [12], в первой ( № 1), и оригинальных праймеров, специфичных к генам set1, set2, set3, set4, set5, с нуклеотидной последовательностью, предложенной в изобретении, во второй ( № 2), с температурой отжига праймеров 59°C в течение 10 с, при числе циклов амплификации, равном 25, с последующим анализом путем сравнения амплифицированных фрагментов генов исследуемых и контрольных штаммов. Для штаммов стафилококков, содержащих гены экзотоксинов, характерно наличие ампликонов генов set1, set2, set3, set4, set5, идентичных контрольным образцам штаммов. В качестве контрольных образцов используется ДНК, выделенная из штаммов S.aureus MRSA 252, S.aureus RF122, S. epidermidis АТСС12228

Технический результат достигается тест-системой для «Идентификации генов стафилококковых экзотоксинов», включающей компоненты для выделения ДНК и компоненты для проведения ПЦР: 10-кратный ПЦР-буферный раствор, pH 8,4; деионизованную стерильную воду; один положительный контроль; фермент Taq-полимеразу; смесь четырех дНТФ; смесь праймеров № 1, содержащую (epi-F epi-R, aur-F aur-R, hae-F hae-R, lug-F lug-R, sap-F sap-R) в соотношении 1:1:1:1:1:1:1:1:1:1:1, соответственно; смесь праймеров № 2, содержащую (setl-F, setl-R, set2-F, set2-R, setS-F, set3-R, set4-F, set4-R, set5-F, set5-R) в соотношении 1:1:1:1:1:1:1:1:1:1, соответственно, а также компоненты для анализа результатов.

В качестве положительного контроля были выбраны образцы ДНК штаммов S. aureus RF122, S. aureus 252, S. epidermidis АТСС12228, содержащие в своем составе гены экзотоксинов set1, set2, set3, set4, set5, штаммы получены из ГИСК им. Тарасевича. Праймеры для выявления генов экзотоксинов сконструированы авторами с помощью программ Primer-Blast и vector NT 9.01 на основании представленных в базе Genbank нуклеотидных последовательностей генов штамма S.aureus RF122 и являются высокоспецифичными, праймеры были синтезированы по оригинальным последовательностям в ЗАО «Синтол», Москва, Россия.

Последовательности праймеров (epi-F epi-R, aur-F aur-R, hae-F hae-R, lug-F lug-R, sap-F sap-R) для видовой генотипической идентификации стафилококков взяты из работы японских исследователей Shintaro Н., Takashi S. et al., 2011 [12] и были синтезированы ЗАО «Синтол», Москва, Россия. Праймеры и их последовательности приведены в таблице 1.

Таблица 1
Праймеры, используемые для видовой идентификации штаммов
праймерпоследовательность (5способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -3способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 )ПЦР-продукт (ампликон), н.п. Вид штамма, которому соответствует ПЦР-продукт (ампликон)
epi-F TTGTAAACCATTCTGGACCG251 S.epidermidis
epi-RATGCGTGAGATACTTCTTCG
aur-FTCGCTTGCTATGATTGTGG 359 S.aureus
aur-R G CCAATG TTCTACCATAG С
hae-F TAGTGGTAGGCGTATTAGCC 434S.haemolyticus
hae-RACGATATTTGCCATTCGGTG
lug-FTCCAATGATGGTAACGAGGC 695S.lugdunensis
способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 TTTTGCGCCTCGTTTTGTGC способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225
sap-F sap-R TTTTGGATGCGATAGATTGG843 S.saprophyticus
способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 TCTTCAGACTTTTCAAAGGC способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225

Праймеры, используемые в заявляемом способе, для идентификации генов экзотоксинов в штаммах стафилококков, характеризуются как: set1-F и set1-R - праймеры на ген setl (кодирующий superantigen-like protein), обеспечивающие образование фрагмента размером 576 п.н. и имеющие прямую и обратную последовательности: set1-F 5способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -TCAGCCAGTAAAAGCAGACGA-3способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 , set1-R 5способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -TCACCCATACGGTGTGTTTGT-3способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 ; set2-F и set2-R - праймеры на ген set2 (кодирующий superantigen-like protein), обеспечивающие образование фрагмента размером 330 п.н. и имеющие прямую и обратную последовательности: set2-F 5способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -AACAGAGGCTCATTCCAGCC-3способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 , set3-R 5способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -ATTGGGGCACTGACAACTCC-3способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 ; set3-F и set3-R - праймеры на ген set3 (кодирующий экзотоксин superantigen-like protein 5), обеспечивающие образование фрагмента размером 147 п.н. и имеющие прямую и обратную последовательности: set3-F 5способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -GCAAAGGTGGCAAGCACTAC-3способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 set3-R 5способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -CGTTGCGATTTTCCGCTTCT-3способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 ; set4-F и set4-R - праймеры на ген set4 (кодирующий экзотоксин superantigen-like protein), обеспечивающие образование фрагмента размером 201 п.н. и имеющие прямую и обратную последовательности: set4-F 5способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -ACAACAGAGGCCCATTCAGG-3способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 , set4-R 5способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -ACGGTACTCATCTCCAGGCA-3способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 ; set5-F и set5-R - праймеры на ген set5 (кодирующий экзотоксин), обеспечивающие образование фрагмента размером 78 п.н. и имеющие прямую и обратную последовательности: set5-F 5способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -CGGCATATATAGCGTTGGCG-3способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 , set5-R 5способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -TGCAGTCCCGGATGACTTAC-3способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 .

Праймеры подобраны на уникальные последовательности генов set1, set2, set3, set4, set5 в геноме S.aureus RF122 и S.aureus MRSA 252 таким образом, чтобы минимизировать вероятность их неспецифичного отжига. Праймеры проверены на возможность образования шпилечных структур с высокими температурами плавления, а также образования димерных соединений как одноименных праймеров, так и двух праймеров между собой. Выбор длины и GC% состава праймеров производился в соответствии с режимом отжига других праймеров, входящих в набор. Размеры получаемых фрагментов были подобраны для упрощения процесса учета результатов таким образом, чтобы амплифицируемые фрагменты были визуально отделимы от прочих.

Экспериментально установлен оптимальный состав реакционной смеси для проведения мультиплексной полимеразной цепной реакции, подобрано сочетание праймеров, необходимое и достаточное соотношение компонентов реакционной смеси и определен режим постановки ПЦР, что является важным при проведении ПЦР анализа.

Для подтверждения специфичности праймеров с помощью ПЦР было изучено 36 клинических штаммов стафилококков, 2 штамма стрептококков Str. piogenes, 1 штамм Lactobacillus acidophilus, выделенный из препарата "Лактобактерин", 1 штамм Е.coli. Результаты тестирования штаммов представлены в таблице 3.

Заявляемая тест-система разделена на 3 комплекта:

комплект 1 содержит компоненты для выделения ДНК, упакованные в шесть пластиковых флаконов, содержащих раствор 1 (деионизированная стерильная вода не содержащая нуклеаз) 1 мл;

комплект 2 содержит компоненты для проведения ПЦР и включает 2 пластиковые пробирки со смесью № 1 по 500, мкл (праймеры, дНТФ и вода), 2 пластиковые пробирки со смесью № 2 по 500, мкл (праймеры, дНТФ и вода), 1 пластиковую пробирку с 10-кратным буфером, 1 пластиковую пробирку, содержащую Taq-полимеразу, 1 пластиковую пробирку с ТЕ-буфером, 1 пластиковую пробирку, содержащую контрольный положительный образец лиофильно высушенной ДНК штаммов S.aureus MRSA 252, S.aureus RF122, S.epidermidis ATCC12228;

комплект 3 содержит компоненты для учета результатов анализа и включает 1 пластиковый флакон, содержащий ТАЕ буфер, 2 флакона с агарозой для электрофореза и 1 флакон с буфером для нанесения проб.

Тест-система предназначена для определения методом мультиплексной полимеразной цепной реакции генов стафилококковых экзотоксинов, с высокой структурной гомологией с суперантигенами.

Система рассчитана на проведение 100 определений, включает 1 контрольный образец.

Заявляемый способ идентификации включает следующие этапы.

а) Выделение ДНК (комплект 1).

б) Проведение ПЦР (комплект 2).

ПЦР проводят в 2 этапа (первый - генотипическая видовая идентификация стафилококков и второй идентификация генов setl-set5) по следующей программе:

1-й этап, включает предварительную денатурацию 95°C - 5 мин, 30 циклов из 95°C - 30 с, 58°C - 30 с, 72°C - 70 с, заключительная достройка цепи 72°C - 2 мин;

2-й этап, включает предварительную денатурацию 96°С - 2 мин, 25 циклов из 96°С - 10 с, 58,2°С - 10 с, 72°С - 30 с, заключительную достройку цепи 72°С - 5 мин.

в) Анализ результатов (комплект 3).

Детекцию амплифицированной ДНК после ПЦР осуществляют методом горизонтального гельэлектрофореза в 1,5% агарозном геле. Учет результатов ПНР-анализа проводят путем сравнения полученных ампликонов с контрольным образцом в соответствии с идентификационной таблицей (табл.2).

Способ осуществляют следующим образом.

Подготовку проб проводят согласно МУ 1.3. 2569-09 «Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности» в боксе биологической безопасности III класса в защитной одежде в резиновых или латексных перчатках.

Выделение ДНК осуществляют с использованием комплекта 1.

Комплект для выделения ДНК извлекают из холодильника и выдерживают при комнатной температуре.

Экстрацию ДНК из бактерий проводят по методу, прописанному в работе Zhang К., McClure Jo-Ann et al., 2005 [11]. Штаммы стафилококков, выращенные на плотных питательных средах в течение 18 часов, забирают бактериологической петлей и ресуспендируют в 50,0 мкл стерильной деионизованной воде, не содержащей нуклеаз, с последующим разведением этой же водой до концентрации 2 млрд мк. т. на 1 мл и нагревают в термостате до 99°C в течение 10 мин. Затем центрифугируют при 30000 g в течение 1 мин. Полученный супернатант переносят в две пробирки (аликвоты) и используют в качестве матрицы для проведения ПЦР. После выполнения. данной процедуры материал считается обеззараженным.

2. Для проведения ПЦР готовят необходимое количество микропробирок, соответствующее 2-кратному числу исследуемых проб, а также еще по две для каждой реакционной смеси: 1 положительный контроль, в качестве которого берут образцы ДНК контрольных штаммов и 1 отрицательный контроль (деионизированная стерильная вода).

Компоненты комплекта № 2 извлекают из морозильной камеры, размораживают содержимое пробирок и готовят реакционные смеси для проведения ПЦР.

Для приготовления реакционной смеси № 1 смешивают 10,0 мкл смеси 1, содержащей сочетание праймеров epi-F, epi-R, aur-F, aur-R, hae-F, hae-R, lug-F, lug-R, sap-F, sap-R в соотношении 1:1:1:1:1:1:1:1:1:1, смесь дНТФ и деионизованную воду с 5,0 мкл 10-кратного ПЦР буфера и 0,5 мкл Taq-полимеразы.

Для приготовления реакционной смеси № 2 смешивают 10,0 мкл смеси № 2, содержащей сочетание праймеров set1-F, set1-R, set2-F, set2-R, set3-F, set3-R, set4-F, set4-R, set5-F, set5-R в соотношении 1:1:1:1:1:1:1:1:1:1, соответственно, смесь дНТФ и деионизованную воду с 5,0 мкл 10-кратного буфера и 0,5 мкл Taq-полимеразы.

В подготовленные пробирки вносят по 10,0 мкл пробы из аликвот. В пробирку, обозначенную как отрицательный контроль, вносят 10,0 мкл деионизованной воды, а в пробирку с положительным контролем соответственно по 10,0 мкл ДНК из штаммов S.aureus MRSA 252, S.aureus RF122, S.epidermidis АТСС'12228 (контроль K+).

Амплификацию ДНК осуществляют с использованием многоканального программируемого термостата "Терцик" (ДНК-Технология, Россия) либо используют его аналоги при следующих температурных режимах (по матричному способу регулирования):

для 1-го этапа (первая аликвота образца) - предварительная денатурация 95°C - 5 мин, 25 циклов: 95°C - 30 с, 58°C - 30 с, 72°C - 70 с, заключительная достройка цепи 72°C - 2 мин;

для 2-го этапа (вторая аликвота образца) предварительная денатурация - 96°C в течение 2 мин; 25 циклов: 9°C - 10 с, 59°C - 10 с, 72°C - 30 с, заключительная достройка цепи 72°C - 5 мин.

Амплификацию контрольных образцов: К+, отрицательный контроль, проводят одновременно с исследуемыми аликвотами образцов в том же приборе и при тех же условиях.

3. Для подготовки 50 мл 1,5% агарозного геля к 750 мг агарозы добавляют 50 мл ТАЕ буфера, разведенного в 50 раз. Агарозу доводят до кипения, охлаждают до 50°C и заливают в специальную ванночку, затем устанавливают гребенку и оставляют застывать. После полимеризации осторожно извлекают гребенку и переносят гель в камеру для проведения электрофореза. Затем к амплификату добавляют 5 мкл буфера для нанесения проб, перемешивают при помощи того же наконечника и вносят в карманы геля. Камеру подключают к источнику тока и задают напряжение 12 B/см.

Электрофоретическое разделение продолжают в течение 45 мин до прохождения лидирующим красителем около 1/3 длины трека (рекомендуемая длина трека - 10 см), после чего гель извлекают из камеры и помещают на стекло трансиллюминатора с УФ-излучением 310 нм. Фрагменты анализируемой ДНК проявляются в виде светлых полос.

Оценивают результаты путем сравнения полученных в ПЦР ампликонов с идентификационной таблицей (табл.2).

Выявление ампликонов размером 251 п.н. в смеси № 1 указывает на присутствие в пробе образца ДНК штамма S.epidermidis, а присутствие ампликонов размером 575 или 147 п.н. в смеси № 2 указывает на присутствие в пробе штамма S.epidermidis экзотоксигенного, содержащего ген set1 или set3 (S.epidermidis set1+ или set3+). Только отсутствие в смеси № 2 ампликонов указывает на штамм S. epidermidis, не содержащий локусов генов set 1+, set2, +set3+, set4, set5.

Выявление ампликонов размером 359 п.н. в смеси № 1 указывает на присутствие в пробе образца ДНК штамма S.aureus, а присутствие ампликонов размером 576, 147, 201, 78 п.н. в смеси № 2 указывает на присутствие в пробе экзотоксигенного штамма S. aureus, содержащего гены set1, set3, set4, set5 (S.aureus set1+, set3+, set4, set5). Только отсутствие в смеси № 2 ампликонов указывает на не экзотоксигенный штамм S. aureus, не содержащий локусов генов set1+, set2, +set3+, set4, set5.

Выявление ампликонов размером 434 п.н. в смеси № 1 указывает на присутствие в пробе образца ДНК штамма S.hemolyticus, а присутствие ампликона размером 147 п.н. в смеси № 2 указывает на присутствие в пробе экзотоксигенного штамма S.hemolyticus, содержащего ген set3 (S.hemolyticus set3+). Только отсутствие в смеси № 2 ампликонов указывает штамм S. hemolyticus, не содержащий локусов генов set1+, set2, +set3+, set4, set5.

Выявление ампликонов размером 695 п.н. в смеси № 1 указывает на присутствие в пробе образца ДНК штамма S.lugdunensis, а присутствие ампликона размером 330, 147, 78 п.н. в смеси № 2 указывает на присутствие в пробе экзотоксигенного штамма S.lugdunensis, содержащего гены set2, set3, set5 (S.lugdunensis set2+set3+set5+). Только отсутствие в смеси № 2 ампликонов указывает на штамм S.lugdunensis, не содержащий локусов генов set1+, set2,+set3+, set4, set5.

Выявление ампликонов размером 843 п.н. в смеси № 1 указывает на присутствие в пробе образца ДНК штамма S.saprophytics, а присутствие ампликона размером 147, 201, 78 п.н. в смеси № 2 указывает на присутствие в пробе экзотоксигенного штамма S.saprophyticus, содержащего гены set3, set4, set5 (S.saprophyticus set2+set3+set5+). Только отсутствие в смеси № 2 ампликонов указывает на штамм S. saprophyticus, не содержащий локусов генов set1+, set2, +set3+, set4, set5.

Специфичность заявляемого способа и тест-системы подтверждена на основе использования штаммов таких видов, как Str. Piogenes - 2 штамма, Lactobacillus acidophilus - 1 штамм, выделенный из препарата "Лактобактерин", Е.coli - 1 штамм. Результаты ПЦР тестирования указанных штаммов были отрицательными: отсутствовали в смеси № 1, № 2 ампликоны, что указывало на отсутствие образцов, принадлежащих экзотоксигенным штаммам стафилококков.

Изобретение, иллюстрируется следующим примером.

Пример 1. Для определения эффективности заявляемого способа и тест-системы исследовано 23 клинических штамма коагулазопозитивных стафилококков, выделенных из образцов, полученных со слизистой носа, кожи, наружного уха, и 13 штаммов коагулазоотрицательных стафилококков, выделенных со слизистой носа, мочи, кожи, грудного молока пациентов, обследованных в лаборатории микробиологии (штаммы любезно предоставлены зав. лаб. микробиологии ФБУН КНИИЭМ Л.Т.Баязитовой).

Установлено, что у 5 из 23 (5/23) изолятов коагулазопозитивных штаммов стафилококков идентифицированы кластеры генов экзотоксинов, так как в образцах от этих штаммов происходила амплификация фрагментов ДНК размером 576, 147, 201 и 78 п.н. в реакционной смеси № 2, что свидетельствует о присутствии в их геноме кластера генов, содержащих экзотоксины set1, set3, set4, set5 соответственно, у коагулазоотрицательных штаммов только 1 из 13 (1/13) штаммов идентифицирован как S. lugdunensis, в образцах которого происходила амплификация фрагментов ДНК размером 330, 147 п.н. в реакционной смеси № 2, что свидетельствует о присутствии в их геноме кластера генов, содержащих экзотоксины set2, set3, соответственно (табл.3).

Таблица 3
Кол-во штаммовРезультаты видовой генетической идентификации (реакционная смесь № 1)Результаты идентификации экзотоксигенности (реакционная смесь № 2)
23 штамма коагулазопозитивных стафилококков23 образца содержали амплифицированый фрагмент ДНК размером 359 п.н. - S.aureus у 5 образцов содержали амплификацированые фрагменты ДНК размерами 576, 147, 201 и 78 - гены set1, set3, set4, set5
13 штаммов коагулазоотрицательных стафилококков 1 - образец содержал амплифицированый фрагмент ДНК размером 695 п.н. - S.lugdunensis амплификация фрагментов ДНК размером 330, 147 п.н. - гены set2, set3
способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 4 - образца содержали амплифицированый фрагмент ДНК размером 843 п.н. - S.saprophytics амплификация фрагментов отсутствовала
способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 1 - образец содержал амплифицированый фрагмент ДНК размером 434 п.н. - S.haemolyticus амплификация фрагментов отсутствовала
способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 7 - образецов содержал амплифицированый фрагмент ДНК размером 251 п.н. - S.epidermidis амплификация фрагментов отсутствовала
1 штамм Lactobacillus acidophilusФрагментов ДНК не выявленоамплификация фрагментов отсутствовала
1 штамм Е.coli Фрагментов ДНК не выявлено амплификация фрагментов отсутствовала
2 штамма стрептококков Str. piogenesФрагментов ДНК не выявленоамплификация фрагментов отсутствовала

Таким образом, предлагаемый способ и мультипраймерная ПЦР тест-система позволяют быстро и достоверно идентифицировать штаммы таких видов коагулазоположительных и коагулазоотрицательных стафилококков, как S.aureus, S.epidermidis, S.haemolyticus, S.lugdunensis, S.saprophyticus, и определить в составе их генома кластер генов set1, set2, set3, set4, set5, кодирующий белки, гомологичные стафилококковым энтеротоксинам, TSST-1 токсину и пирогенному стрептококковому экзотоксину С.

Литература

1. Патент РФ 2458141. Способ идентификации токсигенных штаммов v. Cholerae O1, определенияих биовара и дифференциации штаммов биовара эльтор на типичные и измененные методом мультиплексной полимеразной цепной реакции и тест-система для его осуществления // Смирнова Н.И., Горяев А.А., Шубина А.В., Заднова С.П., Кутырев В.В., 10.08.2012, Бюл. № 22.

2. Rachel J.W., John M.W., В.Henderson, et al. Identification of a novel gene cluster encoding Staphylococcal exotoxin-like proteins: characterization of the prototypic gene and its protein product, SET1 // Nair Infect Immun. 2000 68(8).

3. Fournier B, Philpott D.J. Recognition of Staphylococcus aureus by the innate immune system // Clin. Microbiol. Rev. 2005. 18:521-540.

4. Yokoyama R., Itoh S., Kamoshida G., et al. Staphylococcal superantigen-like protein 3 binds to the Toll-like receptor 2 extracellular domain and inhibits cytokine production induced by Staphylococcus aureus, cell wall component, or lipopeptides in murine macrophages // Infect Immun. 2012 August; 80(8): 2816- 2825.

5. Bestebroer J, et al. Functional basis for complement evasion by staphylococcal superantigen-like 7 // Cell. Microbiol. 2010. 12:1506-1516.

6. Langley R, et al. The staphylococcal superantigen-like protein 7 binds IgA and complement C5 and inhibits IgA-Fca RJ binding and serum killing of bacteria // J. Immunol. 2005. 174:2926-2933.

7. Bestebroer J, et al. Staphylococcal superantigen-like 5 binds PSGL-1 and inhibits P-selectin-mediated neutrophil rolling // Blood 2007.109:2936-2943.

8. Itoh S, et al. Staphylococcal superantigen-like protein 5 inhibits matrix metalloproteinase 9 from human neutrophils// Infect. Immun. 2010.78:3298-3305.

9. Walenkamp A.M, et al. Staphylococcal superantigen-like 10 inhibits CXCL12-induced human tumor cell migration // Neoplasia 2009. 11:333-344.

10. Patel D., Wines B.D., Langley R.J., et al. Specificity of staphylococcal superantigen-like protein 10 toward the human IgGl Fc domain // J. Immunol. 2010. 184:6283-6292.

11. Zhang K., McClure Jo-Ann, Elsayed S., et al. Novel multiplex PCR assay for characterization and concomitant subtyping of Staphylococcal cassette chromosome mec Types I to V in methicillin-resistant Staphylococcus aureus // J Clin Microbiol. 2005; 43(10): 5026-5033.

12. Shintaro H., Takashi S., Kyoko Kuwahara-Arai, Keiichi H. Rapid and Accurate Identification of Human-Associated Staphylococci by Use of Multiplex PCR. Clin Microbiol. 2011 October; 49(10): 3627-3631.

Таблица 2
Идентификационная таблица для учета результатов, полученных патентуемым способом идентификации генов стафилококковых экзотоксинов на основе анализа образцов методом мультиплексной ПЦР
Образец Интерпретация результата анализа образца
аликвота 1 (размер ампликона, п.н.) аликвота 2 (размер ампликона, п.н.)
251359434 695843 78201147 330576
-- --- --- --К отриц нет ампликонов
способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 К1+
способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -- -- --способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 S.epidermidis: экзотоксигенный штамм set1+
- способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -- -способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 S.aureus: экзотоксигенный штамм set 1+, set3+set4+set5+
- способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -- -способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 S.aureus: экзотоксигенный штамм set1+, set2+, set3+ set4+ set5+
- -способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -- -- способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -- S.hemolyticus: экзотоксигенны штамм set3+
-- -способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 _S.lugdunensis: экзотоксигенный штамм set2+ set3+ set5+
--- -способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -- S.saprophyticus экзотоксигенный штамм set3+ set4+ set5+
- -способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -- -- --S lug: не экзотоксигенный штамм
- --- способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -- -- -S.saprophyticus: не экзотоксигенный штамм
способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -- -- --- --S.epidermidis: не экзотоксигенный штамм
способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -- -- --- -S aureus: не экзотоксигенный штамм
-- способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -- -- --- S.hemolyticus: не экзотоксигенный штамм
--- способ идентификации генов стафилококковых экзотоксинов, с высокой   структурной гомологией с суперантигенами, методом мультиплексной   полимеразной цепной реакции и тест-система для его осуществления, патент № 2532225 -- -- --S.saprophyticus: не экзотоксигенный штамм

ФОРМУЛА ИЗОБРЕТЕНИЯ

1. Способ идентификации кластера генов, кодирующих стафилококковые белки, получившие название суперантигено-подобные экзотоксины, характеризующийся тем, что проводят мультипраймерную полимеразную цепную реакцию в один прием в двух реакционных смесях, каждая из которых содержит специально подобранное сочетание праймеров к генам, кодирующим такие белки стафилококков, как термонуклеаза, бета-глюкозидаза у видов S.aureus, S.epidermidis, S.haemolyticus, S.lugdunensis, S.saprophyticus, в первой реакционной смеси и к генам set1, set2, set3, set4, set5, кодирующим белки экзотоксины, во второй реакционной смеси, с температурой отжига праймеров 58°C в течение 30 с при числе циклов амплификации, равном 25, для первой реакционной смеси, и температурой отжига праймеров 59°C в течение 10 с при числе циклов амплификации, равном 25, для второй реакционной смеси, с последующим анализом путем сравнения амплифицированных фрагментов генов, полученных в двух аликвотах образца, с положительным контрольным образцом в соответствии с идентификационной таблицей 2; для экзотоксигенных штаммов стафилококков характерно наличие ампликонов генов set1, set2, set3, set4, set5, идентичных контрольному положительному образцу.

2. Тест-система для осуществления способа по п.1 методом мультипраймерной полимеразной цепной реакции, характеризующаяся тем, что включает компоненты для выделения ДНК, компоненты для проведения ПНР, компоненты для анализа результатов, при этом компоненты для проведения ПЦР содержат: 10-кратный буферный раствор, pH 8,4, деионизированную стерильную воду, один положительный контрольный образец, фермент Taq-полимеразу, смесь четырех дНТФ, смесь праймеров № 1, содержащую epi-F epi-R, aur-F aur-R, hae-F hae-R, lug-F lug-R, sap-F sap-R в соотношении 1:1:1:1:1:1:1:1:1:1, соответственно; и смесь праймеров № 2, содержащую (set1-F, set1-R, set2-F, set2-R, set3-F, set3-R, set4-F, set4-R, set5-F, set5-R) в соотношении 1:1:1:1:1:1:1:1:1:1, соответственно, а также компоненты для анализа результатов.


Скачать патент РФ Официальная публикация
патента РФ № 2532225

patent-2532225.pdf
Патентный поиск по классам МПК-8:

Класс C12Q1/68 использующие нуклеиновые кислоты

Патенты РФ в классе C12Q1/68:
способ идентификации вызывающих муковисцидоз мутаций в гене cftr человека, набор праймеров, биочип, набор мишеней и тест-система, используемые в способе -  патент 2529717 (27.09.2014)
аптамер, специфичный к опухолевым тканям легкого человека -  патент 2528870 (20.09.2014)
способ выявления микобактерий туберкулеза генотипа веijing в режиме реального времени -  патент 2528866 (20.09.2014)
способ проведения пцр и пцр-пдрф для идентификации аллельных вариантов waxy-генов пшеницы -  патент 2528748 (20.09.2014)
синтетические олигонуклеотидные праймеры для идентификации вируса блютанга нуклеотипа в (3, 13 и 16 серотипы) методом от-пцр -  патент 2528745 (20.09.2014)
способ проведения пцр-пдрф для генотипирования крупного рогатого скота по аллелям а и к гена dgat1 -  патент 2528743 (20.09.2014)
синтетические олигонуклеотидные праймеры и способ выявления генотипов для идентификации личности с помощью системы микросателлитных днк-маркеров y-хромосомы -  патент 2528742 (20.09.2014)
способ оценки чувствительности клеток рака легкого к доксорубицину на основании уровней экспрессии маркерных генов и набор для его осуществления -  патент 2528247 (10.09.2014)
биологический микрочип для выявления и многопараметрического анализа противохолерных антител -  патент 2528099 (10.09.2014)
набор синтетических олигонуклеотидов для амплификации и секвенирования its1-5.8s-its2 сосудистых растений -  патент 2528063 (10.09.2014)

Класс C12Q1/02 использующие жизнеспособные микроорганизмы

Патенты РФ в классе C12Q1/02:
способ повышения чувствительности микроорганизмов к антимикробным препаратам -  патент 2529367 (27.09.2014)
способ видовой дифференциации жизнеспособных родококков, иммобилизованных в гелевом носителе -  патент 2525934 (20.08.2014)
способ оценки детоксикационной активности черноземов в агроценозах -  патент 2525677 (20.08.2014)
способ выращивания колоний микробных клеток и устройство для его реализации -  патент 2522005 (10.07.2014)
способ учета нефтеокисляющих бактерий в морской воде -  патент 2520084 (20.06.2014)
способ оценки токсичности продукции из полимерных и текстильных материалов -  патент 2518306 (10.06.2014)
способ определения неспецифической устойчивости патогенных микроогранизмов к антибиотикам на основании измерения каталитической активности фосфодиэстераз, расщепляющих циклический дигуанозинмонофосфат -  патент 2518249 (10.06.2014)
способ определения активации плазминогена бактериями в условиях in vitro -  патент 2514662 (27.04.2014)
контейнер для изоляции и идентификации микроорганизма -  патент 2510844 (10.04.2014)
способ количественной оценки бактерицидной активности дезинфицирующих средств -  патент 2510610 (10.04.2014)

Класс C12N15/00 Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев

Патенты РФ в классе C12N15/00:
способ идентификации вызывающих муковисцидоз мутаций в гене cftr человека, набор праймеров, биочип, набор мишеней и тест-система, используемые в способе -  патент 2529717 (27.09.2014)
рекомбинантная днк, кодирующая гранулоцитарный колониестимулирующий фактор человека (g-csf) и рекомбинантная плазмида рas017, обеспечивающая синтез g-csf в клетках escherichia coli -  патент 2529363 (27.09.2014)
рекомбинантный штамм бактерий escherichia coli n41 (pbpun4/mr)-продуцент сайт-специфической эндонуклеазы рестрикции bpun4i -  патент 2529362 (27.09.2014)
рекомбинантная плазмидная днк ppa-oprf-eta, кодирующая синтез рекомбинантного белка oprf-eta pseudomonas aeruginosa, штамм escherichia coli pa-oprf-eta - продуцент рекомбинантного белка oprf-eta pseudomonas aeruginosa и способ получения рекомбинантного белка oprf-eta pseudomonas aeruginosa -  патент 2529359 (27.09.2014)
модифицированная дрожжевая двугибридная система для эффективного исследования взаимодействия между белками и их доменами. -  патент 2529356 (27.09.2014)
нуклеиноваяя кислота, обладающая активностью гена фосфатазы фосфатидной кислоты (варианты), белок, рекомбинантный вектор, трансформант и способ получения композиции жирной кислоты -  патент 2528875 (20.09.2014)
аптамер, специфичный к опухолевым тканям легкого человека -  патент 2528870 (20.09.2014)
лейколектины и их применение -  патент 2528860 (20.09.2014)
дисплей на поверхности клеток полипептидных изоформ на основе прочитывания терминирующего кодона -  патент 2528858 (20.09.2014)
модифицированный фактор виллебранда с удлиненным полупериодом существования in vivo, его применения и способы получения -  патент 2528855 (20.09.2014)

Класс C12N15/11 фрагменты ДНК или РНК; их модифицированные формы

Патенты РФ в классе C12N15/11:
способ идентификации вызывающих муковисцидоз мутаций в гене cftr человека, набор праймеров, биочип, набор мишеней и тест-система, используемые в способе -  патент 2529717 (27.09.2014)
синтетические олигонуклеотидные праймеры и способ выявления генотипов для идентификации личности с помощью системы микросателлитных днк-маркеров y-хромосомы -  патент 2528742 (20.09.2014)
способ оценки чувствительности клеток рака легкого к доксорубицину на основании уровней экспрессии маркерных генов и набор для его осуществления -  патент 2528247 (10.09.2014)
проникающие в клетку пептиды и полипептиды для клеток микроорганизмов -  патент 2526511 (20.08.2014)
набор синтетических олигонуклеитидов для выявления видовой принадлежности родиолы четырехнадрезной (rhodiola quadrifida (pall.) fisch. et mey.) -  патент 2526499 (20.08.2014)
способ определения генотипов золотистого стафилококка -  патент 2526497 (20.08.2014)
набор для выявления возбудителя ку-лихорадки в биологическом материале методом полимеразной цепной реакции в режиме реального времени (пцр-рв) -  патент 2525059 (10.08.2014)
набор последовательностей олигонуклеотидов для диагностики герминальных мутаций в гене ret, ассоциированных с наследственной предрасположенностью к раку щитовидной железы -  патент 2524433 (27.07.2014)
синтетические 5 utr (нетранслируемые области), экспрессионные векторы и способ повышения трансгенной экспрессии -  патент 2524431 (27.07.2014)
одноцепочечная кольцевая рнк и способ ее получения -  патент 2523596 (20.07.2014)


Наверх