штамм вируса иммунодефицита человека 1-го типа ив735 субтипа в для диагностических и вакцинных препаратов

Классы МПК:C12N7/00 Вирусы, например бактериофаги; их композиции; приготовление или очистка их
A61K35/76 вирусы
G01N33/569 микроорганизмов, например протозоа, бактерий, вирусов
Автор(ы):, , , ,
Патентообладатель(и):Федеральное государственное бюджетное учреждение "Научно-исследовательский институт вакцин и сывороток им. И.И. Мечникова" Российской академии медицинских наук (ФГБУ "НИИВС им. И.И. Мечникова" РАМН) (RU)
Приоритеты:
подача заявки:
2012-09-18
публикация патента:

Изобретение относится к штамму вируса иммунодефицита человека, принадлежащему к субтипу B, и может быть использовано в вирусологии, медицине и биотехнологии. Представленный штамм вируса иммунодефицита человека I-го типа ИВ735 субтипа В депонирован в Государственной коллекции вирусов ФГБУ НИИ вирусологии им. Д.И. Ивановского Минздравсоцразвития России под номером № 1189. Штамм обладает стабильной репродуктивной активностью. Инфекционный титр составляет 6 lg ТЦД 50. Штамм является удобной природной моделью для изучения антивирусной активности химиопрепаратов нового поколения, а также для создания вакцины. 1 ил., 3 табл., 3 пр.

штамм вируса иммунодефицита человека 1-го типа ив735 субтипа   в для диагностических и вакцинных препаратов, патент № 2520813

Формула изобретения

Штамм вируса иммунодефицита человека I-го типа ИВ735 субтипа В для диагностических и вакцинных препаратов, депонированный в Государственной коллекции вирусов ФГБУ НИИ вирусологии им. Д.И.Ивановского Минздравсоцразвития России под номером 1189 и имеющий нуклеотидную последовательность, приведенную на фигуре 1.

Описание изобретения к патенту

Изобретение относится к области вирусологии и биотехнологии и может быть использовано для получения диагностических и экспериментальных вакцинных препаратов.

ВИЧ-1 отличается многообразием генетических вариантов. На сегодняшний день известно 9 субтипов ВИЧ-1 и 15 рекомбинантных форм [1]. На территории бывшего Советского Союза в середине 90-х циркулировали 7 подтипов ВИЧ-1 (от А до Н) [2, 3]. Наибольшее распространение в России на тот период получил субтип В, доминирующий среди мужчин-гомосексуалистов [4]. Ситуация резко изменилась в 1996 г., когда ВИЧ-1 проник в среду лиц, практикующих внутривенное введение психотропных препаратов (ПИН), где темпы передачи инфекции очень высоки. На данный момент на территории Российской Федерации одновременно циркулируют 3 генетических варианта ВИЧ-1: субтип А, субтип В и рекомбинант gagA/envB с преобладанием на большей части территории субтипа А [5, 6]. Надо отметить, что варианты ВИЧ-1 субтипа В, циркулирующие в настоящее время на территории РФ, среди ПИН (потребители инъекционных наркотиков) генетически отличаются от субтипа В, который распространен в Западной Европе и Америке и который характерен для мужчин, практикующих секс с мужчинами, а также от вариантов вируса данного субтипа, которые доминировали в начале развития эпидемии ВИЧ-инфекции [7, 8]. Поэтому для разработки диагностических и вакцинных препаратов представляется чрезвычайно важным использовать штамм субтипа В, циркулириующий на территории РФ.

Задача изобретения - получение штамма вируса иммунодефицита человека, принадлежащего к субтипу В, циркулирующему в настоящее время на территории РФ, среди ПИН (потребители инъекционных наркотиков).

Технический результат, который может быть получен при осуществлении изобретения, заключается в использовании его для изучения антивирусного действия химиопрепаратов нового поколения и для создания вакцины.

Штамм вируса иммунодефицита человека I-го типа ИВ735 субтипа В для диагностических и вакцинных препаратов хранится в коллекции вирусов НИИВС им. И.И.Мечникова РАМН и депонирован в Государственной коллекции вирусов ФГБУ НИИ вирусологии им. Д.И.Ивановского Минздравсоцразвития России под номером 1189 от 16.01.12 и имеющий нуклеотидную последовательность, приведенную на фиг. 1.

Штамм вируса выделен из лимфоцитов периферической крови больного СПИД, не получавшего антиретровирусную терапию. При получения штамма использованы методы сокультивации лимфоцитов больного с лимфоцитами крови здорового донора, стимулированных митогеном, а также с человеческими перевиваемыеми клеточными линиями.

Репродукция.

Штамм ВИЧ-1 ИВ710 обладает высокой репродуктивной активностью и реплицируется в лимфоцитах периферической крови, а также в лимфобластоидных клеточных культурах МТ-4 и Jurkat. Репродукция вируса сопровождается характерным цитопатическим действием и синицитиобразованием. Штамм может поддерживаться длительное время при пассировании на клеточных линиях. Через 5-6 дней после инфицирования клеток вируссодержащей культуральной жидкостью инфицированная клеточная взвесь замораживается и после размораживания и осветления при 1000 об/мин вносится к свежим неинфицированным клеткам, в соотношении 1:10.

Инфекционный титр вируса определяли по 50% тканевой цитопатической дозе вируса на модели вышеуказанных клеточных культур в сравнении со штаммом-аналогом ВИЧ-1 LAV, который является первым изолятом ВИЧ-1, выделенным от больного СПИД [9]. Продуктивная активность штамма составляет 6,0 lg ТЦД50 и сопоставима с инфекционным титром штамма-аналога (таблица 1).

Антигенные свойства.

ВИЧ-1 относится к семейству Retroviridae, род Lentivirus. Вирусы этой подгруппы являются оболочечными РНК-содержащими вирусами с размером частиц около 100-150 нм. В составе частиц обнаруживают не менее 6 основных структурных антигенов, обладающих иммуногенными свойствами, которые могут быть выявлены в инфицированных клетках с помощью различных иммунологических и вирусологических методов.

Иммунофлюресценция.

Исследование штамма ИВ735 методом непрямой иммунофлюоресценции с использованием сыворотки больного СПИД, содержащей антитела к ВИЧ-1, показало наличие антигенов ВИЧ-1 в 50-60% инфицированных клеток.

Иммуноблот.

Исследование в иммуноблоте показало, что вирус обладает антигенными детерминантами, характерными для ВИЧ-1: 120/160, 65, 55, 41, 31, 24, 17 кД (таблица 2).

Субтипирование.

Генетический анализ области, кодируемой геном pol, проведенный с помощью субтипспецифических праймеров (CCAAAGGTTAAACAATGG, TTAGATTCTTAAATGGCTCC), подходящих для изучения вариантов ВИЧ-1, циркулирующих на территории России, показал, что данный штамм вируса относится к субтипу В.

Возможность использования изобретения иллюстрируется примерами, которые не ограничивают объем и сущность притязаний, связанных с ними.

Пример 1. Сравнительное исследование инфекционной активности штаммов ВИЧ-1 LAV и ИВ735 по цитопатическому действию.

Исследование инфекционной активности штаммов ВИЧ проводили на модели лимфобластоидных клеток МТ-4 и Jurkat в пластиковой 24-луночной панели (Costar, США). Клетки инфицировали вирусом в дозе 0,01 инфекционных единиц на клетку. Далее инкубировали культуры клеток при 37С° в течение 1 часа и дважды отмывали. После этого к культуре клеток добавляли питательную среду RPMI-1640 с 10% сыворотки эмбрионов коров (производства Sigma) и 100 мкг/мл гентамицина (конечная концентрация клеток 400000 клеток/мл). Учет результатов противовирусной активности производили по жизнеспособности клеток путем окрашивания клеток красителем трипановым синим на 6-7 сутки. За титр вируса принимали величину обратную его максимальному разведению, вызывающему как минимум двухкратное превышение показателя гибели клеток по сравнению с контролем. Результаты исследования представлены в таблице 1.

Сравнительный анализ показал, что инфекционные титры штамма ИВ735 сопоставимы с инфекционным титром штамма-аналога LAV, что свидетельствует об их сходной активности. Данный инфекционный титр позволяет успешно инфицировать лимфобластоидные клеточные культуры с целью дальнейшей наработки инфекционного материала.

Пример 2. Диагностика антител к белкам ВИЧ-1 методом иммуноблота.

Материал для исследования антител к ВИЧ-1 представлен 10 сыворотками, полученными от ВИЧ-инфицированных лиц и содержащих анти-ВИЧ антитела. Сыворотки были предварительно охарактеризованны в коммерческой тест-системе фирмы «Биорад» (США). В качестве антигена использован штамм ИВ735 и штамм-аналог LAV. Выявление антител к ВИЧ-1 проводили с помощью нитроцеллюлозных стрипованных мембран (стрип) с нанесенными на них антигенами ВИЧ-1 фирмы «Биорад» (США). Готовую стрипованную мембрану предварительно замачивали на 5 мин в фосфатно-солевом буфере с твином (ФСБ-Т). Сыворотку крови в количестве 20 мкл разводили в 1 мл ФСБ-Т, содержащего 0,5% БСА (бычий сывороточный альбумин), и вносили в лунку со стрипом. После инкубации в течение 1 час при комнатной температуре и отмывки ФСБ-Т вносили конъюгат, разведенный в 1 мл ФСБ-Т. Далее снова проводили инкубацию в течение 1 час при комнатной температуре и после отмывки ФСБ-Т вносили 1 мл раствора тетраметилбензидина (ТМБ) в цитратно-фосфатном буфере (ЦФБ). Затем инкубировали в темноте до появления четких полос в контрольном стрипе. Реакцию останавливали 1 н. серной кислотой. После промывки стрипа дистиллированной водой его высушивали при комнатной температуре и визуально проводили учет результатов.

Результаты исследований представлены в таблице 2. В результате проведенных исследований установлено, что антиген штамма ИВ735 позволяет выявлять антитела ко всем основным структурным белкам ВИЧ-1 и, следовательно, может быть использован для изучения сероконверсии лиц, инфицированных ВИЧ-1, а также для изучения противовирусного действия химиопрепаратов и создания вакцины против ВИЧ.

Пример 3. Сравнительный анализ инфекционной активности штаммов ВИЧ-1 LAV и ИВ735 по уровню антигена вируса (р24).

Определение уровня вирусного антигена в вируссодержащей жидкости проводили с помощью иммуноферментного анализа с использованием коммерческого иммуноферментного набора фирмы Биорад (США) на 96-луночных панелях. В лунки, в которые предварительно был внесены исследуемые образцы, добавляли конъюгат, содержащий биотилинированные поликлональные антитела к р24 ВИЧ-1. После инкубации в течение 1 часа при 37°С панель отмывали трис-солевым буфером и вносили стрептавидин-пероксидазный конъюгат. Проводили инкубацию в течение 30 мин при комнатной температуре, отмывали панель трис-солевым буфером и затем для визуализации реакции добавляли тетраметилбензидин (ТМБ). После инкубации в течение 30 минут в темноте при комнатной температуре в лунки для остановки реакции вносили 1 н серную кислоту. Результаты учитывали с помощью фотометра "Multiscan" при длине волны 630 нм. За положительный контроль принимали не менее чем 3-кратное превышение оптической плотности по сравнению с таковым показателем неинфицированной клеточной линии.

Результаты исследований представлены в Таблице 3. В результате проведенных исследований установлено, что штамм ИВ735 не уступает по уровню выработки антигена ВИЧ-1, штамму-аналогу LAV и обладает высокой репродуктивной активностью, что позволяет успешно инфицировать им лимфобластоидные клеточные культуры, с целью дальнейшей наработки инфекционного материала.

Таблица 1
Сравнительное исследование инфекционной активности штаммов ВИЧ-1 LAV и ИВ735 на модели клеток МТ-4 и Jurkat
Титр, lg ТЦД 50Штаммы ВИЧ-1 (модель клеток МТ-4)Штаммы ВИЧ-1 (модель клеток Jurkat)
LAVИВ735LAV ИВ735
6,0 6,06,0 6,0

Таблица 2
Исследование штамма ИВ735 методом иммуноблота
Вирусный антигенВыявленные антитела
Контроль (LAV) 160120 655553 413124 17
ИВ735 16012065 5553 413124 17

Таблица 3
Сравнительный анализ инфекционной активности штаммов ВИЧ-1 LAV и ИВ735 по уровню антигена вируса (р24).
Контроль клетокШтаммы ВИЧ-1
Контроль (LAV) ИВ735
0,061* 2,9912,903
* оптическая плотность

Источники информации

1. Spira S., Wainberg M.A., Loemba H. et al. Impact of clade diversity on HIV-1 virulence, antiretroviral drug sensitivity and drug resistance // J. Antimicrob. Chem. - 2003. - V.51. - P.229-240.

2. Leitner Т., Korovina G., Marquina S. et al. Molecular and biological characterization of Russian HIV-1 strains // AIDS Res. Hum. Retroviruses. - 1996. - V.12 - P.1595-1603.

3. Lukashov V., Cornelissen MTE, Goudsmith J. et al. Simultaneous introducrion of distinct HIV-1 subtypes into different risk groups in Russia, Byelorussia and Lithuania // AIDS. - 1995. - V.9. - P.435-439.

4. Bobkov A., Cheingsong-Popov R., Karasyova N. et al. Sequence analysis of glycoprotein 120 coding region of a new human immunodeficiency virus type 1 subtype G from Russia // AIDS Res. Hum. Retroviruses. - 1996. - V.12. - P.1385-1388.

5. K.A.Ryzhov, M.N.Nossik, V.V.Pokrovsky et al. The genetic diversity of human immunodeficency virus-1 circulating in the territory of Russia // 5th IAS Conference on HIV Pathogenesis, Treatment and Prevetntion, 19-22 July 2009, Cape Town, South Africa, Fbs. CDAO34

6. M.H.Носик, K.A.Рыжов, С.Н.Кузин и др. Пути передачи ВИЧ-инфекции на территории Северо-Западного и Дальневосточного регионов России // Русский журнал СПИД, рак и общественное здоровье. - 2010. - Т.14. - № 1(29). - С.32-33.

7. Bobkov A., Cheingsong-Popov R., Selimova L. et al. Genetic heterogeneity of HIV type 1 in Russia: identification of H variants and relationship with epidemiological data // AIDS. - 1996. - V.12. - P.1687-1690.

8. Nabatov A.A., Kravchenko O.N., Lyulchuk M.G. et al. Simultaneous introduction of HIV type 1 subtype A and В viruses into injecting drug users in Southern Ukraine at the beginning of the epidemic in the former Soviet Union // AIDS Res. Hum. Retroviruses. - 2002. - V.18. - P.891-895.

9. Barre-Sinoussi F., Mugeyre M., Dauguet C. Isolation of a T-lymphotropic retroviruses from a patient at risk for AIDS // Science. - 1983. - Vol.220. - P.868-871.

Скачать патент РФ Официальная публикация
патента РФ № 2520813

patent-2520813.pdf

Класс C12N7/00 Вирусы, например бактериофаги; их композиции; приготовление или очистка их

холодоадаптированный штамм вируса гриппа в-в/виктория/2/63/87, предназначенный в качестве штамма-донора аттенуации для получения реассортантов холодоадаптированных штаммов для живой гриппозной вакцины -  патент 2529772 (27.09.2014)
штамм "г 244/11" вируса блютанга 14 серотипа для вирусологических исследований, изготовления вакцинных и диагностических препаратов -  патент 2528057 (10.09.2014)
флавивирус с двухкомпонентным геномом и его использование -  патент 2527891 (10.09.2014)
поликатионное соединение "тривирон (triviron)" и способ его получения -  патент 2527256 (27.08.2014)
аттенуированный рекомбинантный парвовирус, пригодный для защиты собак от инфицирования парвовирусом -  патент 2527157 (27.08.2014)
кодон-оптимизированная кднк, кодирующая дисферлин человека, генно-инженерная конструкция, рекомбинантный аденовирус и фармацевтическая композиция для лечения дисферлинопатий -  патент 2527073 (27.08.2014)
вакцина против ящура типа а инактивированная сорбированная -  патент 2526570 (27.08.2014)
способ оценки противооспенной активности лечебно-профилактических препаратов -  патент 2526504 (20.08.2014)
способ удаления вируса иммунодефицита человека из спермы мужчины -  патент 2526494 (20.08.2014)
набор олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации рнк вируса хунин методом полимеразной цепной реакции в реальном времени -  патент 2525938 (20.08.2014)

Класс A61K35/76 вирусы

кодон-оптимизированная кднк, кодирующая дисферлин человека, генно-инженерная конструкция, рекомбинантный аденовирус и фармацевтическая композиция для лечения дисферлинопатий -  патент 2527073 (27.08.2014)
способ оценки противооспенной активности лечебно-профилактических препаратов -  патент 2526504 (20.08.2014)
способ получения бактериофага -  патент 2525141 (10.08.2014)
способ оценки активности лечебно-профилактических препаратов против вируса натуральной оспы -  патент 2522483 (20.07.2014)
аденовирусные векторы и способы и применения, связанные с ними -  патент 2520823 (27.06.2014)
композиция антибактериальная, штамм бактериофага escherichia coli, используемый для получения такой композиции. -  патент 2518303 (10.06.2014)
штамм вируса иммунодефицита человека 1-го типа ив742 субтипа а для диагностических и вакцинных препаратов -  патент 2513693 (20.04.2014)
штамм вируса иммунодефицита человека 1-го типа ив710 субтипа а резистентный к антиретровирусным препаратам для диагностических и вакцинных препаратов -  патент 2513692 (20.04.2014)
способ лечения обострений хронического ларингита -  патент 2510757 (10.04.2014)
видоспецифический вирулентный штамм бактериофага, обладающий литической активностью в отношении staphylococcus aureus, включая мультирезистентные штаммы -  патент 2503716 (10.01.2014)

Класс G01N33/569 микроорганизмов, например протозоа, бактерий, вирусов

способ прогнозирования риска развития инфекционно-воспалительных осложнений у женщин с внутриматочной патологией после гистероскопии -  патент 2526163 (20.08.2014)
штамм вируса гриппа a/pochard/siberia/249/08-ma h10n7-субтипа для получения антиген-содержащего диагностического препарата и диагностической поликлональной сыворотки, применения в качестве контрольного референс-образца при оценке специфичности тест-систем на основе пцр и для изучения противовирусных препаратов in vitro и in vivo -  патент 2522813 (20.07.2014)
иммуногенные белки streptococcus -  патент 2518315 (10.06.2014)
способ определения неспецифической устойчивости патогенных микроогранизмов к антибиотикам на основании измерения каталитической активности фосфодиэстераз, расщепляющих циклический дигуанозинмонофосфат -  патент 2518249 (10.06.2014)
штамм вируса иммунодефицита человека 1-го типа ив742 субтипа а для диагностических и вакцинных препаратов -  патент 2513693 (20.04.2014)
штамм вируса иммунодефицита человека 1-го типа ив710 субтипа а резистентный к антиретровирусным препаратам для диагностических и вакцинных препаратов -  патент 2513692 (20.04.2014)
штамм диплоидных клеток синовиальной мембраны ягненка ovis aries, используемый для вирусологических исследований -  патент 2507255 (20.02.2014)
штамм диплоидных клеток синовиальной мембраны поросенка sus scrofa, используемый для вирусологических исследований -  патент 2506310 (10.02.2014)
способ конструирования полимерного иммуноглобулинового диагностикума для выявления legionella pneumophila 1,3 и 6 серогрупп (варианты) -  патент 2505819 (27.01.2014)
способ определения антител к mycobacterium leprae -  патент 2500423 (10.12.2013)
Наверх