Поиск патентов
ПАТЕНТНЫЙ ПОИСК В РФ

способ профилактики и/или лечения зависимости от психоактивных веществ

Классы МПК:A61B5/00 Измерение для диагностических целей
A61K31/498  пиразины или пиперазины орто- или пери-конденсированные с карбоциклической системой, например хиноксалин, феназин
A61K31/197  амино- и карбоксильная группы присоединены к одной и той же ациклической углеродной цепи, например гамма-аминомасляная кислота (ГАМК), бета-аланин, эпсилон-аминокапроновая кислота, пантотеновая кислота
A61P25/30 для лечения злоупотребления или зависимости
Автор(ы):, ,
Патентообладатель(и):Общество с ограниченной ответственностью "Идеи для здоровья. Группа компаний" (RU)
Приоритеты:
подача заявки:
2008-12-26
публикация патента:

Изобретение относится к медицине, а именно к психиатрии, и может быть использовано при профилактике и/или лечении зависимости от психоактивных веществ. Способ включает генотипирование по генам дофаминовой, серотониновой, норадреналиновой и гамма-аминомасляной кислоты систем нейромедиаторного обмена, психодиагностическое тестирование с последующим формированием психологических типов в соответствии с полиморфизмами в указанных генах. Затем назначают БАД и/или фармакотерапию с учетом результатов генотипирования и выявленных психологических типов с нарушением нейромедиаторного обмена. Использование изобретения позволяет повысить эффективность лечения за счет коррекции нарушения баланса нейромедиаторов, предрасполагающего к формированию зависимости. 7 з.п. ф-лы, 1 табл.

Изобретение относится к области медицины и может быть использовано для лечения и/или профилактики от психоактивных веществ, в частности наркомании и/или алкоголизма и/или коморбидных расстройств по генетическому нейромедиаторному обмену и психологическому тестированию пациента.

В патогенезе развития зависимости от психоактивных веществ (ПАВ) большое значение придается личностным особенностям. В настоящее время некоторые личностные особенности рассматриваются как предрасполагающие к формированию хронической алкогольной и наркотической зависимостям. Очевидно, что злоупотребление ПАВ может быть обусловлено разными характерологическими особенностями, однако, и в нашей стране и за рубежом в настоящее время разрабатываются методы по выделению типов личности, чаще других связанных с развитием этого заболевания.

Из уровня техники известен способ лечения алкоголизма, включающий воздействие на рефлексогенные зоны переменным электрическим током частотой 5-30 Гц через введенные в них иглы. Воздействие осуществляют на биологически активные точки симметрично с обеих сторон, при этом в точки тоу-цзяо-инь и бай-хуэй вводят иглы, на которые через 10-15 мин от начала воздействия подают электрический ток в течение 10-15 с, иглы извлекают через 5-10 мин после прекращения воздействия электрическим током, после этого в точки нао-ху и шэнь-тин вводят лекарственный препарат - центральный анальгетик (RU 2056110, 20.03.1996).

Известен способ лечения больных с зависимостью от психоактивных веществ, заключающийся в применении наномолекулярного селенотерпенопротеинового средства, представляющее собой две полипептидные способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 - и способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 -цепи протеина, соединенные дисульфидным мостиком по остаткам цистеина, селеновыми связями между аминокислотами валином и лейцином, а также глутаминовыми кислотами и двумя диселенидными связями между способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 - и способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 -цепью, при этом наномолекула селенопротеина при всех физиологических значениях pH ионизирована, заряженными являются С- и N-концевые группы и связанные с способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 -углеродными атомами боковые цепи, содержащие карбоксильную или аминогруппы, к наномолекуле селенопротеина присоединен сесквитерпеновый лактон (СТЛ) к карбоксильным группам боковых цепей к остаткам глутаминовой и/или аспарагиновой кислот и/или к С-концевым карбоксильным группам через сложную эфирную связь при молярном соотношении СТЛ : селенопротеин = 4:1. Селенотерпенопротеиновое средство вводят ежедневно, чередуя внутримышечные и внутривенные инъекции в дозе 0,2-0,3 мл (RU 2242235, 20.12.2004).

Наиболее близким аналогом заявленного изобретения является способ профилактики наркомании и/или алкоголизма, или лечения и/или реабилитации больных наркоманией и/или алкоголизмом, заключающийся в выявлении у пациента синдром дефицита удовлетворенности путем осуществления генетического анализа по наличию, по меньшей мере, одного из генов, кодирующих обмен нейромедиаторов и свойства рецепторов, входящих в систему удовлетворения человека, и компенсируют дефицит удовлетворенности путем выполнения, по меньшей мере, одного комплекса физических упражнений, оказывающих эффект, обеспечивающий компенсацию дефицита удовлетворенности. При наличии у пациента патологической аллели гена дофаминового D2 рецептора и/или гена белка обратного захвата дофамина используют комплекс физических упражнений, включающий упражнения, оказывающие седативный эффект, а при наличии у пациента патологической аллели гена белка дофамин-способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 -гидроксилазы используют комплекс физических упражнений, включающий упражнения, оказывающие активизирующий эффект (RU 2243757, 10.01.2005).

Предлагаемые способы не позволяют в полной мере оптимизировать эффективность лечения больных с зависимостью к психоактивным веществам, в частности наркомании и/или алкоголизма и/или коморбидных расстройств, а также не позволяет правильно подобрать методику лечения.

Задача, на решение которой направлено предложенное изобретение, заключается в разработке диагностических мероприятий, направленных на выявление личностных особенностей, предрасполагающих к аддикциям, а также применение терапевтических и профилактических подходов с учетом фармакогенетического анализа.

Технический результат, достигаемый при реализации данного изобретения, заключается в повышении эффективности лечения зависимости от психоактивных веществ, в частности наркомании и/или алкоголизма и/или коморбидных расстройств по генетическому нейромедиаторному обмену и психологическому тестированию пациента за счет детального выяснения причин зависимости от психоактивных веществ и индивидуального подбора лечения пациента при помощи анализа ДНК и психологического тестирования для определения психологического типа, к которому относится пациент, и проведения оценки адекватности применяемого лечения.

Указанный технический результат достигается в способе профилактики и/или лечения зависимости от психоактивных веществ, включающем генотипирование по генам дофаминовой, серотониновой, норадреналиновой и гамма-аминомасляной кислоты систем нейромедиаторного обмена, психодиагностическое тестирование с последующим формированием психологических типов в соответствии с полиморфизмами в указанных генах и назначение БАД и/или фармакотерапии с учетом результатов генотипирования и выявленных психологических типов с нарушением нейромедиаторного обмена.

При недостаточности дофаминового обмена при выявлении незначительной предрасположенности вводят БАД тирозин, при выявлении средней предрасположенности вводят БАД тирозин и диметиламиноэтанол (ДМАЕ), при выявлении высокой предрасположенности вводят БАД тирозин, ДМАЕ и препарат энерион, а при выявлении максимальной предрасположенности вводят БАД тирозин, ДМАЕ и препарат семакс.

При недостаточности серотонинового обмена при средней предрасположенности вводят БАД мелаксен, при выявлении высокой предрасположенности вводят БАД 5-гидрокситриптофан и мелаксен, а при выявлении максимальной предрасположенности вводят БАД 5-гидроксигрипгофан, мелаксен и препарат асентра.

При избыточности серотонинового обмена при выявлении высокой предрасположенности вводят БАД таурин и ДМАЕ, а при выявлении максимальной предрасположенности вводят БАД таурин, ДМАЕ и препарат пиразидол.

При избыточности норадреналинового обмена при выявлении средней предрасположенности вводят БАД тирозин, а при выявлении максимальной предрасположенности вводят БАД тирозин и препарат ремерон.

При недостаточности дофаминового обмена в сочетании с избыточностью серотонинового обмена выявлении незначительной предрасположенности вводят БАД ДМАЕ, при выявлении средней предрасположенности вводят БАД таурин и ДМАЕ, при выявлении высокой предрасположенности вводят БАД ДМАЕ и препарат пиразидол, а при выявлении максимальной предрасположенности вводят БАД таурин, ДМАЕ и препарат пиразидол.

При недостаточности дофаминового обмена в сочетании с недостаточностью серотонинового обмена при выявлении средней предрасположенности вводят БАД тирозин, при выявлении высокой предрасположенности вводят БАД тирозин и ДМАЕ, а при выявлении максимальной предрасположенности вводят БАД тирозин, ДМАЕ и препарат леривон.

При недостаточности дофаминового обмена в сочетании с недостаточностью обмена гамма-аминомасляной кислоты при выявлении высокой предрасположенности вводят БАД таурин и препарат аминалон, а при выявлении максимальной предрасположенности вводят БАД таурин, ДМАЕ и препарат нейробутал.

Сущность заявленного изобретения поясняется следующим.

Применяется, во-первых, способ генотипирования по генам дофаминовой, серотониновой, норадреналиновой и гамма-аминомасляной кислоты (ГАМК) систем нейромедиаторного обмена.

Кроме того, применяется психодиагностическое тестирование и проведение структурированного клинического интервью. Процедура психодиагностического тестирования и клинического интервьюирования проводится с целью комплексного подхода к формированию «групп риска» - психологических типов с личностными особенностями, предрасполагающими к аддикциям. Кроме того, психодиагностическое тестирование позволяет провести оценку адекватности применяемого лечения.

Многофакторный анализ личности - стандартизированный многофакторный метод исследования личности (СМИЛ) предназначен для многофакторной оценки устойчивых индивидуальных особенностей. Опросник СМИЛ для данного исследования учитывает спектр таких структурных компонентов личности, как отношение к другим людям и положению в обществе, стиль межличностного поведения, черты характера, фон настроения, склонность к агрессии, предрасположенность к алкоголизму.

МЦВ (метод цветовых выборов) - тест Люшера. МЦВ диагностирует не свойства личности, а ее состояние, отражает наиболее значимые характеристики на момент обследования.

Способ назначения пищевых добавок и фармакотерапии обосновывается с учетом результатов генотипирования и выявления специфических психотипов с нарушением нейромедиаторного обмена.

Основными психологическими характеристиками, связанными с формированием зависимого (аддиктивного) поведения являются импульсивность, низкий уровень самоконтроля, тревожно-депрессивные реакции, агрессивное поведение, низкая нормативность социального поведения, неустойчивость к стрессу, низкая чувствительность к опасности и риску, компульсивность и нарушение поведения по гистрионическому типу.

Формирование устойчивых психологических типов зависит от баланса нейромедиаторов. При избыточности или недостаточности основных нейромедиаторов проявляются предрасполагающие к формированию зависимого поведения черты характера.

Взаимосвязи дисбаланса каждого из нейромедиаторов с нарушениями поведения.

Основными нейромедиаторами центральной нервной системы (ЦНС) являются дофамин, серотонин, норадреналин и гамма-аминомасляная кислота.

Дофамин обеспечивает механизмы закрепления положительных и отрицательных эмоций. Дофаминовая недостаточность связана с «синдромом дефицита удовлетворения». Основными личностными характеристиками при дофаминовой недостаточности являются низкий уровень самоконтроля, импульсивность и низкая нормативность социального поведения. Серотонин обеспечивает необходимый уровень седации (спокойствия). Недостаточность серотонинового обмена проявляется неустойчивостью к стрессу, повышенной тревожностью. Избыточность серотонинового обмена проявляется в агрессивном поведении. При этом агрессия может быть внешненаправленной (конфликтное поведение), так и внутренненаправленной (низкая самооценка, самобичевание). Норадреналин обеспечивает уровень активности в состоянии бодрствования. Избыточность норадреналинового обмена проявляется в склонности к меланхолической депрессии, ригидности и высокой истощаемости при психоэмоциональном стрессе.

Дисбаланс основных нейромедиаторов может быть изолированным и выражаться в избыточности, или недостаточности каждого из них.

Кроме того, возможны «смешанные» формы дисбаланса нескольких нейромедиаторов.

В настоящее время методов прямого измерения метаболизма нейромедиаторов в ЦНС не существует. Однако, для дофамина, серотонина, норадреналина и гамма-аминомасляной кислоты известны гены, кодирующие рецепторы, переносчики и ферменты их метаболизма. Полиморфизмы в этих генах связаны с нарушением баланса каждого из нейромедиаторов.

В соответствии с полиморфизмами в генах обмена дофамина, серотонина, норадреналина и гамма-аминомасляной кислоты определяются специфические психологические типы, связанные с формированием зависимого от ПАВ поведения. Всего мы выделяем 7 типов нарушений нейромедиаторного обмена:

1. недостаточность дофаминового обмена;

2. недостаточность серотонинового обмена;

3. избыточность серотонинового обмена;

4. избыточность норадреналинового обмена;

5. недостаточность дофаминового обмена в сочетании с избыточностью серотонинового обмена;

6. недостаточность дофаминового обмена в сочетании с недостаточностью серотонинового обмена;

7. недостаточность дофаминового обмена в сочетании с недостаточностью обмена гамма-аминомасляной кислоты.

Фармакотерапию проводят с учетом известного механизма действия каждого препарата или БАД.

1. Для коррекции недостаточности дофаминового обмена используют БАД тирозин и диметиламиноэтанол (ДМАЕ) и препараты «энерион» и «семакс». Тирозин - аминокислота, метаболический предшественник дофамина, вводимый экзогенно, восполняет дефект в синтезе дофамина. ДМАЭ при попадании в организм превращается в ацетилхолин. Ацетилхолин - нейромедиатор, отвечающий за передачу и регулирование синаптических сигналов. Семакс - синтетический аналог фрагмента кортикотропина, обладающий ноотропными свойствами и лишенный гормональной активности. Влияет на процессы, связанные с формированием памяти и обучением. Способствует сохранению и ускоряет восстановление умственной работоспособности.

2. Для коррекции недостаточности серотонинового обмена используют БАД 5-гидрокситриптофан и препараты «мелаксен» и «асентра». 5-гидрокситриптофан является метаболическими предшественником серотонина. Аминокислота триптофан превращается в 5-гидрокситриптофан (5-НТР), а он, в свою очередь, - в серотонин. Мелаксен - синтетический аналог гормона шишковидной железы (эпифиза), полученный из аминокислот растительного происхождения. Эпифиз производит мелатонин из аминокислоты триптофана в ночное время суток, в дневное время им производится из триптофана нейромедиатор серотонин. Таким образом увеличивается концентрация ГАМК и серотонина в среднем мозге и гипоталамусе, изменяется активность пиридоксалькиназы, участвующей в синтезе ГАМК, дофамина и серотонина. Асентра - антидепрессант, специфический ингибитор обратного захвата серотонина (5-НТ) в нейронах. На метаболизм норадреналина и допамина влияет незначительно. Препарат не оказывает стимулирующего, седативного или антихолинергического действия. Не обладает сродством к серотониновым, допаминовым, гистаминовым, бензодиазепиновым, GABA, холино- и адренорецепторам.

3. Для коррекции избыточности серотонинового обмена используют БАД таурин, ДМАЕ и препарат «пиразидол». Таурин - тормозной нейромедиатор головного мозга, является продуктом метаболизма незаменимой аминокислоты цистеина. Таурин, вводимый экзогенно, восполняет дефицит эндогенного таурина. Пиразидол-избирательно, кратковременно и обратимо ингибирует МАО типа А; в высокой степени блокирует дезаминирование серотонина и норадреналина, в меньшей степени - тирамина. Частично ингибирует обратный захват моноаминов. Стимулирует адренергические структуры; потенцирует эффекты предшественника серотонина 5-окситриптофана (стимулирует серотонинергические структуры).

4. Для коррекции избыточности норадреналинового обмена используют БАД тирозин и препарат «ремерон».

Принцип действия Ремерона отличается от всех известных антидепрессантов (ТЦА, ИОЗС, ингибиторы моноаминооксидазы - ИМАО). Ремерон повышает норадренергическую и серотонинергическую нейротрансмиссии, блокируя центральные а2-ауто и гетероадренорецепторы. При этом серотонин стимулирует только рецепторы типа 5-НТ1, тогда как рецепторы 5-НТ2 и 5-НТЗ блокируются Ремероном. Таким образом, Ремерон правильнее всего определить как Норадренергический и Специфический Серотонинергический Антидепрессант (НаССА).

5. Для коррекции недостаточности дофаминового обмена в сочетании с избыточностью серотонинового обмена используют тирозин, ДМАЕ и препарат «пиразидол».

6. Для коррекции недостаточности дофаминового обмена в сочетании с недостаточностью серотонинового обмена используют тирозин, ДМАЕ и препарат «леривон». Леривон - механизм действия связан с угнетением обратного захвата нейромедиаторных моноаминов пресинаптическими нервными окончаниями, в результате чего происходит накопление медиаторов в синаптической щели и активация синаптической передачи. Препарат одновременно уменьшает захват разных нейромедиаторных аминов (норадреналина, серотонина, дофамина).

7. Для коррекции недостаточности дофаминового обмена в сочетании с недостаточностью обмена гамма-аминомасляной кислоты используют таурин, ДМАЕ и препараты «аминалон» и «нейробутал». Нейробутал обладает ГАМК-миметическим эффектом, коррегирует нарушения обменных процессов ЦНС, повышает устойчивость мозга к гипоксии и воздействию токсических веществ, стимулирует анаболические процессы в нейронах и утилизацию глюкозы и кислорода, Оказывает седативное действие, способствует нормализации сна, улучшает память. Аминалон (ГАМК) принимает участие в нейромедиаторных и метаболических процессах в мозге. ГАМК является основным медиатором, участвующим в процессах центрального торможения. Под влиянием ГАМК активируются также энергетические процессы мозга, повышается дыхательная активность тканей, улучшается утилизация мозгом глюкозы, улучшается кровоснабжение. Действие ГАМК в ЦНС осуществляется путем ее взаимодействия со специфическими ГАМКергическими рецепторами, которые в последнее время подразделяют на ГАМК-А- и ГАМК-Б-рецепторы.

Проведение диагностики психологических типов на основе данных генотипирования и коррекция расстройств поведения. При проведении диагностики психологических типов учитываются данные генотипирования в сочетании с анамнезом и данными психодиагностического обследования, включающими профиль личности СМИЛ, тест ЦМВ и тестирование уровней тревожности и депрессии.

1. Психологический тип «недостаточности дофаминового обмена» с низким уровнем самоконтроля, импульсивностью и низкой нормативностью социального поведения. Выявляется при наличии у пациента предрасполагающих генотипов: 1/1 гена рецептора дофамина D2, 7 аллеля гена рецептора дофамина D4, 9/10 гена переносчика дофамина, 1/1 гена бета-гидроксилазы дофамина.

При выявлении только одного патологического генотипа - рецептора D2 или рецептора D4 предрасположенность определяется как «незначительная». Для коррекции используют БАД тирозин. При выявлении двух предрасполагающих генотипов - одного из рецепторов D2 или D4 в сочетании с генотипом переносчика дофамина предрасположенность определяется как «выраженная в средней степени». Для коррекции используют БАД тирозин и диметиламиноэтанол (ДМАЕ). При выявлении трех предрасполагающих генотипов рецепторов D2 и D4 в сочетании с генотипом переносчика дофамина предрасположенность интерпретируется как «высокая». Для коррекции используют БАД тирозин и ДМАЕ в сочетании с препаратом «энерион». При выявлении всех четырех предрасполагающих генотипов предрасположенность интерпретируется как «максимальная». Для коррекции используют тирозин и ДМАЕ в сочетании с препаратом «семакс».

Пример 1. Денис Т., 30 лет.

Наследственность психопатологически отягощена алкоголизацией отца. Впервые употребил спиртное в 15 лет, в 18 лет героин. Эпизодическое употребление алкоголя с 20 лет, с постепенным нарастанием толерантности, частоты употребления. Систематическое злоупотребление алкоголем около 10 лет. Утрачен защитный рвотный рефлекс. Сформирован абстинентный синдром по сомато-вегетативному типу. Утрачен количественный и ситуационный контроль. Пьянство носит псевдозапойный характер. Запои по 10-14 дней. Светлые промежутки до 1-2 недель, с тенденцией к сокращению. Появились алкогольные палимпсесты. Суточная толерантность до 2,5 литра крепких спиртных напитков в сутки. Алкоголизировался в компании и в одиночку. Спонтанная ремиссия отсутствует, кодировался 3 раза - без эффекта. За наркологической помощью обращается по настоянию родителей. Последнее употребление алкоголя - накануне поступления.

Интерпретация профиля личности СМИЛ при поступлении в клинику.

Профиль имеет "позитивный" наклон, свидетельствующий о большом риске поведенческих реакций. По отношению к другим людям и положению в обществе выявлены стремление к соперничеству, упрямство, скептицизм, отсутствие конформности, трудности адаптации в микросоциальной среде и стремление к доминированию. По отношению к собственной личности выявлены положительная самооценка и трудность переубеждения. Импульсивные черты в характере снижают продуманность и взвешенность принимаемых решений. Это снижает использование пережитого опыта и повышает вероятность повторения уже совершенных ошибок.

Ведущими потребностями являются потребность в свободе, активности, избавлении от каких-либо ограничений.

Результаты теста МЦВ при поступлении в клинику.

Неудовлетворенность потребности в физиологическом комфорте, эмоциональная напряженность с тенденцией к биологизации тревоги (плохое самочувствие). Экспансивность высказываний и поведения, стремление к переживанию сильных ощущений. Оригинальность и творческий подход в решениях. Настойчивость в отстаивании собственной индивидуальности, что несколько усложняет адаптацию. Настойчивая потребность в избавлении от каких бы то ни было ограничений.

Уровни депрессии - 4 (низкий) и тревоги - 6 (средний) при поступлении в клинику.

При генотипировании выявлены три предрасполагающих генотипа генов рецепторов D2 (1/1) и D4 (аллель7) в сочетании с генотипом гена переносчика дофамина (9/10). Результаты интерпретированы как «высокая предрасположенность к недостаточности дофаминового обмена». Определен соответствующий психологический тип с низким уровнем самоконтроля, импульсивностью и низкой нормативностью социального поведения. Для коррекции дезадаптивного поведения были назначены БАД тирозин и ДМАЕ в сочетании с препаратом «энерион».

Интерпретация профиля личности СМИЛ при выписке из клиники.

По эмоциональному состоянию - настроение повышено, гиперактивность, бравада. По отношению к собственной личности - высокая самооценка, уверенность в себе, убежденность в собственной правоте.

Результаты теста МЦВ при выписке из клиники.

Потребность в прочной и глубокой привязанности, эмоциональном комфорте и защите от внешних воздействий. Дружелюбие, конформность установок. Сензитивность в отношении критических замечаний в свой адрес. Удовлетворенность физиологических потребностей. Стремление упрочить свою позицию.

Уровни депрессии - 1 (низкий) и тревоги - 5 (низкий) при выписке из клиники.

1. Психологический тип «недостаточности серотонинового обмена» с неустойчивостью к стрессу и повышенной тревожностью. Выявляется при наличии у пациента предрасполагающих генотипов: SS и SL гена переносчика серотонина, с/с и c/g гена ресептора серотонина 2С, 9/10 гена переносчика дофамина. При выявлении только одного патологического генотипа гена переносчика серотонина предрасположенность определяется как «выраженная в средней степени». Для коррекции используют БАД мелаксен. При выявлении предрасполагающих генотипов переносчика серотонина и рецептора серотонина 2С предрасположенность интерпретируется как «высокая». Для коррекции используют 5-гидроксигриптофан и мелаксен. При выявлении предрасполагающих генотипов всех трех генов предрасположенность определяется как «максимальная». Для коррекции используют 5-гидроксигриптофан, мелаксен и препарат «асентра».

Пример 2. Людмила Ч., 55 лет.

Наследственность психопатологически отягощена алкоголизацией отца. Впервые употребила спиртное в 20 лет. Эпизодическое употребление с 30 лет, с постепенным нарастанием толерантности, частоты употребления. Систематическое злоупотребление алкоголем около 6 лет. Утрачен защитный рвотный рефлекс. Сформирован абстинентный синдром по сомато-вегетативному типу. Снижен количественный и ситуационный контроль. Пьянство носит псевдозапойный характер. Запои по 3-4 дня. Светлые промежутки до 1-2 недель, с тенденцией к сокращению. Появились алкогольные палимпсесты. Суточная толерантность до 0,5 литра крепких спиртных напитков в сутки. Алкоголизировалась в одиночку, скрывая от окружающих, прятала спиртное. Спонтанная ремиссия около 4-х месяцев после пребывания в санатории в 2007 г.

За наркологической помощью обращается впервые. Последнее употребление алкоголя - 2 недели назад.

Интерпретация профиля личности СМИЛ при поступлении в клинику.

По эмоциональному состоянию - склонность к пониженному настроению, недовольству ситуацией и собой. Уровень тревоги повышен.

Обеспокоенность своей отгороженностью и трудностями социальной адаптации. По отношению к другим людям и положению в обществе выявлены обеспокоенность своей отгороженностью и трудностями социальной адаптации. По отношению к собственной личности выявлены склонность к пониженной самооценке и неуверенность в себе. Наиболее вероятными реакциями на стресс являются депрессивные реакции, усиление тревоги, страх, дистанцирование и эмоциональное отчуждение.

Результаты теста МЦВ при поступлении в клинику.

Эмоциональная неустойчивость и зависимость от средовых воздействий. Чувство тревоги и неуверенности, физического перенапряжения. Страхи, обостренная мнительность, дискомфорт, потребность в отдыхе и расслаблении. Противоречивое соотношение между оптимистичностью и пессимизмом. Неустойчивое настроение.

Уровни депрессии - 4 (низкий) и тревоги - 2 (низкий) при поступлении в клинику. При генотипировании выявлены предрасполагающие генотипы переносчика серотонина (SL) и рецептора серотонина 2С (с/с). Результаты интерпретированы как «максимальная предрасположенность к недостаточности серотонинового обмена». Определен соответствующий психологический тип с неустойчивостью к стрессу и повышенной тревожностью. Для коррекции эмоциональной лабильности были назначены БАД 5-гидрокситриптофан, мелаксен и препарат «асентра».

Интерпретация профиля личности СМИЛ при выписке из клиники.

По отношению к другим людям и положению в обществе выявлены гибкость, отсутствие злопамятности и застревания на обидах. Миролюбие, дружелюбие, стремление к сглаживанию конфликтов. По отношению к собственной личности - защитная реакция в виде вытеснения информации, занижающей самооценку, смягчение эмоционального напряжения.

Результаты теста МЦВ при выписке из клиники.

Потребность в отстаивании собственных установок, упорство, противодействие обстоятельствам, которое носит защитный характер. Практичность и трезвость суждений, рационализм, тенденция к системному подходу при решении проблем. Ориентировка на собственное мнение, сопротивление внешне-средовым воздействиям. Значимость собственной социальной позиции.

Уровни депрессии - 4 (низкий) и тревоги - 1 (низкий) при выписке из клиники.

3. Психологический тип «избыточности серотонинового обмена» с агрессивным поведением (аутоагрессия или конфликтное поведение).

Выявляется при наличии у пациента предрасполагающих генотипов:

«3-repeat» гена моноаминооксидазы МАО-А и а/а гена моноаминооксидазы МАО-В. При выявлении предрасполагающих генотипов одного из генов моноаминооксидазы предрасположенность интерпретируется как «высокая». Для коррекции используют таурин и ДМАЕ. При выявлении предрасполагающих генотипов двух генов моноаминооксидазы (МАО-А и МАО-В) предрасположенность определяется как «максимальная». Для коррекции используют таурин, ДМАЕ и препарат «пиразидол».

Пример 3. Наталья Р., 19 лет.

Наследственность психопатологически не отягощена. Наркотизируется с подросткового возраста: в 14 лет испытала алкогольное опьянение, в 15-16 лет первые пробы стимуляторов. Систематическое употребление героина около года, в/в практически без пауз. Сформирована психологическая и физическая зависимость. Суточная толерантность до 1,0-2,0 г вещества. В июле 2008 г. пыталась покончить с собой через передозировку. Последнее употребление 28.08.2008 г. Прошла процедуру УБОД.

Интерпретация профиля личности СМИЛ при поступлении в клинику.

По эмоциональному состоянию - настроение снижено, раздражительность.

Противоречивое и дисгармоничное сочетание эмоциональной лабильности с эмоциональной ригидностью. По отношению к другим людям и положению в обществе выявлены конфликтность, упрямство. Повышенная внутренняя агрессивность подавляется повышенным самоконтролем, что смягчает ее внешние проявления. Проявляется в виде критических замечаний, реакций протеста. При близких контактах конфликтность или агрессивность выше, а самоконтроль меньше. Возможна избирательная враждебность или конфликтность по отношению к определенным близким людям при сохранении видимости конформности при более отдаленных контактах. Сдерживаемая внутренняя агрессивность может проявляться в провоцировании своим поведением окружающих на агрессию с последующим обвинением их в недоброжелательном отношении.

Результаты теста МЦВ при поступлении в клинику.

Протестная реакция, сопротивление внешним обстоятельствам, давлению средовых воздействий. Стремление отстоять собственную позицию ограничением контактов, пассивным противодействием. Внешнеобвиняющая реакция, прикрывающая собственное бессилие. Субъективизм и индивидуалистичность утрированы и проявляются в виде негативизма и категоричного критиканства по отношению к любым мнениям и ценностям.

Уровни депрессии - 5 (низкий) и тревоги - 8 (средний) при поступлении в клинику.

При генотипировании выявлены предрасполагающие генотипы двух генов моноаминооксидазы МАО-А («3-repeat») и МАО-В (а/а). Результаты интерпретированы как «максимальная предрасположенность к избыточности серотонинового обмена». Определен соответствующий психологический тип с агрессивным поведением (аутоагрессия или конфликтное поведение). Для коррекции агрессивного поведения были назначены БАД таурин, ДМАЕ и препарат «пиразидол».

Интерпретация профиля личности СМИЛ при выписке из клиники.

По эмоциональному состоянию - настроение хорошее, удовлетворенность собой. Выраженность эмоциональных проявлений, глубина переживаний. По отношению к другим людям и положению в обществе выявлены ранимость, упрямство, эмоциональная отгороженность. Эмоциональный подтекст межличностных контактов снижен. Сензитивность. Повышенная чувствительность к критическому или негативному отношению окружающих.

Результаты теста МЦВ при выписке из клиники.

Нешаблонный, самобытный подход к решению проблем, оригинальность мышления, богатое воображение, недостаток практицизма, реалистичности. Индивидуалистичность, создающая трудности в попытках завязывания контактов. Ранимость, сензитивность. Тонкая нюансированность чувств, своеобразие интересов, суждений сочетается с такими особенностями, как потребность в прочной и глубокой привязанности, эмоциональном комфорте и защите от внешних воздействий. Дружелюбие, конформность установок. Потребность в понимании, любви и поддержке.

Уровни депрессии - 2 (низкий) и тревоги - 3 (низкий) при выписке из клиники.

4. Психологический тип «избыточности норадреналинового обмена» с меланхолической депрессией и психосоматической астенизацией. Выявляется при наличии у пациента предрасполагающих генотипов: 9/10 гена переносчика дофамина и 2/2 гена бета-гидроксилазы дофамина. При выявлении патологического генотипа только гена бета-гидроксилазы дофамина предрасположенность интерпретируется как «выраженная в средней степени». Для коррекции используют тирозин. При выявлении предрасполагающих генотипов генов бета-гидроксилазы дофамина и переносчика дофамина предрасположенность определяется как «максимальная». Для коррекции используют тирозин и препарат «ремерон».

Пример 4. Денис В., 27 лет.

Наследственность психопатологически отягощена алкоголизацией отца. Акушерский анамнез неизвестен. Впервые употребил спиртное в 15 лет. Эпизодическое употребление алкоголя с 18 лет, с постепенным нарастанием толерантности, частоты употребления. В 19 лет около года эпизодически наркотизировался - марихуана. Систематическое злоупотребление алкоголем около 5 лет. Утрачен защитный рвотный рефлекс. Сформирован абстинентный синдром по сомато-вегетативному типу. Утрачен количественный и ситуационный контроль. Светлые промежутки до 2 недель, с тенденцией к сокращению. Появились алкогольные палимпсесты. Суточная толерантность до 1,0 литров водки на уровне плато, предпочитает крепкие спиртные напитки. Алкоголизировался в компании и в одиночку. За наркологической помощью обращается в связи с ухудшением здоровья, отношений в семье и на работе. Последнее употребление алкоголя, марихуаны - накануне поступления.

Интерпретация профиля личности СМИЛ при поступлении в клинику.

По эмоциональному состоянию - склонность к "застреванию" на отрицательных эмоциях, эмоциональная ригидность. Легко возникает ощущение угрозы, страх. По отношению к другим людям и положению в обществе выявлены ранимость и обидчивость.

Результаты теста МЦВ при поступлении в клинику.

Пессимистическая оценка ситуации. Ощущение изолированности и одиночества. Потребность в ярких эмоциональных переживаниях, эгоцентрическая сосредоточенность на своих проблемах, обидчивость. Неудовлетворенная потребность в признании, беспокойство, тревога, комплекс собственного несовершенства маскируется демонстративностью поведения.

Уровни депрессии - 9 (средний) и тревоги - 13 (высокий) при поступлении в клинику.

При генотипировании выявлены предрасполагающие генотипы бета-гидроксилазы до фамина (2/2) и переносчика дофамина (9/10). Результаты интерпретированы как «максимальная предрасположенность к избыточности норадреналинового обмена». Определен соответствующий психологический тип с меланхолической депрессией и психосоматической астенизацией. Для коррекции высоких уровней тревожности и депрессии была назначена БАД тирозин и препарат «ремерон».

Интерпретация профиля личности СМИЛ при выписке из клиники.

По эмоциональному состоянию - веселое настроение, удовлетворенность собой. Эмоциональное своеобразие со снижением способности к эмоциональным контактам. По отношению к другим людям и положению в обществе - ранимость, обидчивость, недоверчивость, формальность контактов. Эмоциональная отгороженность. Трудности адаптации в больших коллективах. Узкий круг знакомств. Повышенная чувствительность к критическому или негативному отношению окружающих.

Результаты теста МЦВ при выписке из клиники.

Выраженный самоконтроль в сфере чувственности приводит к изоляции. Стремление к завоеванию признания и уважения со стороны значимых других.

Уровни депрессии - 6 (низкий) и тревоги - 7 (средний) при выписке из клиники.

5. Психологический тип «недостаточности дофаминового обмена в сочетании с избыточностью серотонинового обмена» с низким уровнем самоконтроля, импульсивностью, низкой чувствительностью к опасности и риску, асоциальным поведением. Выявляется при наличии у пациента предрасполагающих генотипов: 1/1 гена рецептора дофамина D2, 7 аллеля гена рецептора дофамина D4, 9/10 гена переносчика дофамина DAT, 1/1 гена бета-гидроксилазы дофамина, g/g гена рецептора серотонина 2С, LL гена переносчика серотонина. При выявлении двух генотипов серотониновых генов и одного из предрасполагающих генотипов дофаминовых генов - рецептора D2, или рецептора D4, или переносчика дофамина предрасположенность определяется как «незначительная». Для коррекции используют БАД ДМАЕ. При выявлении двух генотипов серотониновых генов в сочетании с двумя патологическими генотипами дофаминовых генов - рецептора D2, или рецептора D4, и переносчика дофамина предрасположенность определяется как «выраженная в средней степени». Для коррекции используют таурин и ДМАЕ. При выявлении двух генотипов серотониновых генов в сочетании с тремя патологическими генотипами дофаминовых генов - рецептора D2, рецептора D4 и переносчика дофамина предрасположенность определяется как «высокая». Для коррекции используют ДМАЕ и препарат «пиразидол». При выявлении двух генотипов серотониновых генов в сочетании с патологическими генотипами четырех дофаминовых генов - рецептора D2, рецептора D4, переносчика дофамина и бета-гидроксилазы дофамина предрасположенность определяется как «максимальная». Для коррекции используют таурин, ДМАЕ и препарат «пиразидол».

Пример 5. Сергей С., 37 лет.

Наследственность психопатологически отягощена алкоголизацией отца. Получил высшее образование, занимается логистикой, в течении последних лет часто менял работу, не удерживаясь из-за употребления, последние 3 месяца не работает. Судимость - 2 года из-за драки в состоянии алкогольного опьянения. Впервые употребил спиртное в 13 лет, так же пробы марихуаны. Эпизодическое употребление алкоголя с 18 лет, с постепенным нарастанием толерантности, частоты употребления. Систематическое злоупотребление алкоголем около 10 лет. Утрачен защитный рвотный рефлекс. Сформирован абстинентный синдром по сомато-вегетативному типу. Утрачен количественный и ситуационный контроль. Пьянство носит псевдозапойный характер. Запои по 10-14 дней. Светлые промежутки до 1-2 недель, с тенденцией к сокращению. Появились алкогольные палимпсесты. Суточная толерантность до 1,0 литра крепких спиртных напитков в сутки. Алкоголизировался в компании и в одиночку. Спонтанная ремиссия отсутствует, неоднократно детоксикации на дому, кодировался, максимальная ремиссия около 1 года.

За наркологической помощью обращается по настоянию родителей. Последнее употребление алкоголя - накануне поступления.

Интерпретация профиля личности СМИЛ при поступлении в клинику.

По эмоциональному состоянию - эмоциональная холодность. Эмоциональная отгороженность. По отношению к другим людям и положению в обществе выявлены отсутствие конформности, трудности адаптации в микросоциальной среде. Эмоциональный подтекст межличностных контактов снижен. Ведущими являются потребности в реализации интересов, находящихся в стороне от социальной вовлеченности; в свободе, избавлении от каких-либо ограничений. Особенностью личности является выраженное своеобразие.

Результаты теста МЦВ при поступлении в клинику.

Неустойчивая, созерцательная позиция, трудности социальной адаптации, эмоциональность и субъективность пристрастий превалирует над рассудочностью. Нешаблонный, самобытный подход к решению проблем, оригинальность мышления. Индивидуалистичность, создающая трудности в попытках завязывания контактов. Трудно вырабатываются навыки общепринятых норм поведения.

Уровни депрессии - 6 (низкий) и тревоги - 5 (низкий) при поступлении в клинику.

При генотипировании выявлены предрасполагающие генотипы двух генотипов серотониновых генов - SERT (LL) и HTR2C (g/g) в сочетании с патологическими генотипами четырех дофаминовых генов - рецептора D2 (1/1), рецептора D4 (аллель 7), переносчика дофамина (9/10) и бета-гидроксилазы дофамина (1/1). Результаты интерпретированы как «максимальная предрасположенность к недостаточности дофаминового обмена в сочетании с избыточностью серотонинового обмена». Определен соответствующий психологический тип с низким уровнем самоконтроля, импульсивностью, низкой чувствительностью к опасности и риску и асоциальным поведением. Для коррекции дезадаптивного поведения были назначены БАД таурин, ДМАЕ и препарат «пиразидол».

Интерпретация профиля личности СМИЛ при выписке из клиники.

По эмоциональному состоянию - веселое настроение, удовлетворенность собой. По отношению к другим людям и положению в обществе - сензитивность. Повышенная чувствительность к критическому или негативному отношению окружающих. По отношению к собственной личности - положительная самооценка, уверенность в себе, убежденность в собственной правоте.

Результаты теста МЦВ при выписке из клиники.

Потребность в действии, эмоциональной вовлеченности, в переменах, в общении. Оптимистичность, эмоциональная неустойчивость, легкое вживание в разные социальные роли, потребность нравиться окружающим, зависимость от средовых воздействий, поиски признания и стремления к сопричастности в межличностном взаимодействии. Любые формальные рамки тесны и плохо переносятся. Выраженная эмоциональная переключаемость без глубины переживаний и непостоянство в привязанностях. Непосредственность чувств, пристрастие к забавам, игровому компоненту в деятельности.

Уровни депрессии - 4 (низкий) и тревоги - 1 (низкий) при выписке из клиники.

6. Психологический тип «недостаточности дофаминового обмена в сочетании с недостаточностью серотонинового обмена» с низким уровнем самоконтроля, импульсивностью, низкой самооценкой и тревожно-депрессивными реакциями. Выявляется при наличии у пациента предрасполагающих генотипов: 1/1 гена рецептора дофамина D2, 7 аллеля гена рецептора дофамина D4, 9/10 гена переносчика дофамина DAT, «4-repeat» гена моноаминооксидазы МАО-А и g/g гена моноаминооксидазы МАО-В. При выявлении одного из генотипов серотониновых генов (МАО-А или МАО-В) в сочетании с патологическим генотипом одного из дофаминовых генов - рецептора D2 или рецептора D4, или переносчика дофамина предрасположенность определяется как «выраженная в средней степени». Для коррекции используют тирозин. При выявлении одного из генотипов серотониновых генов (МАО-А или МАО-В) в сочетании с патологическими генотипами двух дофаминовых генов - рецептора D2 или рецептора D4, или переносчика дофамина предрасположенность определяется как «высокая». Для коррекции используют тирозин и ДМАЕ.

При выявлении двух генотипов серотониновых генов в сочетании с патологическими генотипами трех дофаминовых генов - рецептора D2, рецептора D4 и переносчика дофамина предрасположенность определяется как «максимальная». Для коррекции используют тирозин, ДМАЕ и препарат «леривон».

Пример 6. Эдуард Ш., 38 лет.

Наследственность психопатологически отягощена по линии отца. Впервые употребил спиртное в 14 лет. До 23 лет эпизодическое употребление алкоголя с постепенным нарастанием толерантности, частоты употребления. Систематическое злоупотребление алкоголем около 4 лет. Утрачен защитный рвотный рефлекс. Сформирован абстинентный синдром по сомато-вегетативному типу. Утрачен количественный и ситуационный контроль. Пьянство носит псевдозапойный характер. С 38 лет запои до 10 дней. Светлые промежутки до 1 месяца, с тенденцией к сокращению. Появились алкогольные палимпсесты. Суточная толерантность до 5,0 литра пива, крепкие спиртные напитки употребляет редко. Алкоголизировался в компании и в одиночку. За наркологической помощью обращался неоднократно, в т.ч. в наркологические клиники, последнее - с 8 сентября 2008 г. Последнее употребление алкоголя - около 6 дней назад.

Интерпретация профиля личности СМИЛ при поступлении в клинику.

Данный профиль характерен для депрессивного синдрома. Иногда такой профиль бывает при дезадаптации личности с выраженными тревожными (гипотимными) чертами и склонностью к депрессивным реакциям. Настроение резко снижено до степени депрессивного. Слабость, адинамия, безрадостное восприятие действительности. Высокий уровень тревоги. Легкое попадание в зависимость.

Результаты теста МЦВ при поступлении в клинику.

Эмоциональная неустойчивость, зависимость от средовых воздействий. Тенденция к избеганию ответственности. Любые формальные рамки тесны и плохо переносятся. Выраженная эмоциональная переключаемость без глубины переживаний и непостоянство в привязанностях. Непосредственность чувств, пристрастие к забавам, игровому компоненту в деятельности. Состояние эмоциональной напряженности, физическая усталость, дискомфорт. Эмоциональная неустойчивость усугубляется тревожными ощущениями надвигающейся опасности. Вытеснение психологических причин и соматизация конфликта. Напряженность физиологических потребностей.

Уровни депрессии - 4 (низкий) и тревоги - 5 (низкий) при поступлении в клинику.

При генотипировании выявлены предрасполагающие генотипы двух генотипов серотониновых генов - SERT (SL) и HTR2C (с/с) в сочетании с патологическими генотипами трех дофаминовых генов - рецептора D2 (1/1), рецептора D4 (аллель 7) и переносчика дофамина (9/10). Результаты интерпретированы как «максимальная предрасположенность к недостаточности дофаминового обмена в сочетании с недостаточностью серотонинового обмена». Определен соответствующий психологический тип с низким уровнем самоконтроля, импульсивностью, низкой самооценкой и тревожно-депрессивными реакциями. Для коррекции дезадаптивного поведения и тревожно-депрессивных реакций были назначены БАД тирозин, ДМАЕ и препарат «леривон».

Интерпретация профиля личности СМИЛ при выписке из клиники.

По эмоциональному состоянию - настроение изменчивое вследствие циклотимных колебаний или эмоциональной незрелости. Эмоциональное напряжение. По отношению к другим людям и положению в обществе - недостаток дипломатичности. Скептицизм. Ведущей является потребность в избегании конфликтов и чутком отношении окружающих.

Результаты теста МЦВ при выписке из клиники.

Потребность в отстаивании собственных установок, упорство, противодействие обстоятельствам, которое носит защитный характер. Практичность и трезвость суждений, рационализм, тенденция к системному подходу при решении проблем. Опора на накопленный опыт. Ориентировка на собственное мнение, сопротивление внешне-средовым воздействиям. Установка на избегание конфликта. Повышенная ранимость в отношении критических замечаний со стороны окружающих, уязвимое самолюбие, значимость социального престижа. Потребность в самоуважении и уважении со стороны окружающих.

Уровни депрессии - 2 (низкий) и тревоги - 4 (низкий) при выписке из клиники.

7. Психологический тип «недостаточности дофаминового обмена в сочетании с недостаточностью обмена гамма-аминомасляной кислоты» с периодами употребления ПАВ по «булимическому» типу. Низкий самоконтроль, компульсивность. Выявляется при наличии у пациента предрасполагающих генотипов: 1/1 гена рецептора дофамина D2, 7 аллеля гена рецептора дофамина D4, 9/10 гена переносчика дофамина DAT, a/g гена глутаматдекарбоксилазы. При выявлении двух предрасполагающих генотипов генов дофаминовой системы и a/g гена глутаматдекарбоксилазы предрасположенность определяется как «высокая». Для коррекции используют таурин и препарат «аминолон». При выявлении всех трех предрасполагающих генотипов генов дофаминовой - 1/1 гена рецептора дофамина D2, 7 аллеля гена рецептора дофамина D4, 9/10 гена переносчика дофамина DAT и a/g гена глутаматдекарбоксилазы предрасположенность определяется как «максимальная». Для коррекции используют таурин, ДМАЕ и препарат «нейробутал».

Пример 7. Алексей В., 40 лет.

Наследственность психопатологически не отягощена. Впервые употребил в 16 лет вследствие любопытства, субъективные ощущения приятные. Эпизодическое употребление в течение нескольких лет с нарушением дозы и толерантности. С 27 лет отмечает запои по 3-4 дня. Сформирован похмельный синдром. Суточная толерантность до 1,5 л коньяка. Снижен количественный и ситуационный контроль. С 2003 по 2006 - вынужденная ремиссия в МЛС. Последние полгода пьянство носило постоянный характер. Последнее употребление - накануне.

Интерпретация профиля личности СМИЛ при поступлении в клинику.

По эмоциональному состоянию - веселое настроение, удовлетворенность собой, эмоциональная устойчивость, малая зависимость эмоционального состояния от внешних факторов. Недостаток осторожности. Отсутствие боязливости. По отношению к другим людям и положению в обществе - общительность, стремление к расширению круга знакомств. Большое количество поверхностных контактов. Легкая смена знакомств. Снижена способность к крепкой длительной привязанности. Общительность настолько высока, что граничит с назойливостью.

Результаты теста МЦВ при поступлении в клинику.

Упорство в отстаивании своих позиций. Эгоцентрическая сосредоточенность на своих проблемах. Возбуждение, импульсивность и повышенная раздражительность на фоне выраженного переутомления. Беспокойные поиски новых взаимоотношений, которые могли бы принести радость и спокойствие.

Уровни депрессии - 9 (средний) и тревоги - 12 (средний) при поступлении в клинику.

При генотипировании выявлены предрасполагающие генотипы генов - рецептора дофамина D2 (1/1), рецептора дофамина D4 (аллеля 7), переносчика дофамина DAT (9/10) и глутаматдекарбоксилазы (a/g). Результаты интерпретированы как «максимальная предрасположенность к недостаточности дофаминового обмена в сочетании с недостаточностью обмена гамма-аминомасляной кислоты». Определен соответствующий психологический тип с периодами употребления ПАВ по «булимическому» типу, низким самоконтролем и компульсивностью.

Интерпретация профиля личности СМИЛ при выписке из клиники.

По эмоциональному состояние - настроение повышено. Гиперактивность. Склонность к соперничеству, демонстрации сильных черт характера, выносливости. По отношению к другим людям и положению в обществе - гибкость, отсутствие злопамятности и застревания на обидах. Отсутствие застенчивости. Стремление к лидерству. По отношению к собственной личности - высокая самооценка, уверенность в себе, переоценка собственных возможностей, недооценка объективных трудностей.

Результаты теста МЦВ при выписке из клиники.

Активность позиции, высокая мотивация достижения, потребность в обладании жизненными благами, стремление к доминированию, целенаправленность действий, непосредственность и раскрепощенность поведения, высокая самооценка, потребность в самореализации, противодействие обстоятельствам, препятствующим свободной самореализации личности, черты стеничности (активности) и мужественности, склонность к риску.

Уровни депрессии - 4 (низкий) и тревоги - 6 (низкий) при выписке из клиники.

Генетические методы исследования.

В качестве материала для генотипирования использовали ДНК, извлеченную из клеток слизистой оболочки рта методом фенол-хлороформной экстракции.

Полимеразная цепная реакция синтеза ДНК (ПЦР).

Амплификацию последовательностей в составе исследуемых генов осуществляли следующим образом. В среднем 200 нг геномной ДНК помещали в 25 мкл реакционного буфера, содержащего по 0,1-0,2 мМ каждого дезоксирибонуклеотидтрифосфата, 1 единицу активности Taq ДНК-полимеразы, 15 рМ каждого олигопраймера. Состав реакционного буфера для ПЦР: 16,6 мМ сульфата аммония, 67 мМ Tris-HCl, pH 8,8 при 250 С, 2,0 мМ хлорида магния, 0,1% Twin 20. В пробирку добавляли 2 капли минерального масла для предотвращения испарения и помещали в автоматический термоциклер (Терцик-2) для амплификации изучаемых последовательностей, используя следующую программу:

способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974

способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974

способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974

* Та - температура отжига для пары праймеров, длины фрагментов, последовательности праймеров, и ферменты рестрикции указаны для каждого гена в Таблице 1.

Для идентификации аллелей генов, содержащих однонуклеотидные замены, проводили рестрикцию продуктов амплификации с помощью эндонуклеаз (фирма «СибЭнзим»). Для этого к 25 мкл амплификата добавляли 2 мкл воды, 3 мкл 10× рестрикционного буфера и 2 е.а. фермента, смесь инкубировали 2-3 часа при температуре, оптимальной для каждой рестриктазы.

Таблица 1
ТаGene name Ферменты рестрикции Длины фрагментов Последовательности праймеров
68 SerTVNTR 20-23 bp485 bp >R=ggc gtt gcc get ctg aat gc
способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 528 bp >F=gag gga ctg age tgg аса асе ас
62NPY Bse1I (BsrI) 147/141/109/ >F=aagttgcgcgaagttttcaggtggag
способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 (NciI) 65C 288/109 395bp >R=gtgtcgcagcgccgagtagtatctgg
58-62HTR2C 37C HinfI 174bp >2C-FF=taa ttg gcc tat tgg ttt ggg aat
способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 gantc 152+22 >2C-RR171=gga tgt tgc cac cta ttg tea
62GAD2 AluI 37C 80+52+47 127+52 >F=cct caa atg ctc tgg ggc tc
способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 agct 178bp >R=ggt gtc acg cag gaa cag aa
60-62DRD4 VNTR 48 bpR7=619bp >DRD4-R2 AGGACCCTCATGGCCTTG
способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 R4=475bp >DRD4-F2 GCGACTACGTGGTCTACTCG
способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 R2=379bp способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974
58-62МАОА VNTR 30 bp2R=179bp >MAOV-F cccagcgtgctccagaaac
способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 3R=209bp >MAOV-R ggacctgggcagttgtgc
способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 5R=269bp 4R=239bp праймеры из статьи
58MAOB 37C AsuHPI (HphI) 185bp>MAOB-F acactggcaaatagcaaagg
способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 ggtga(n) 155+30 >MAOB-R gtaagcctaatgattggaacctc
58DRD2 TaqI 65C 88+261 >DRD2-F2 аса tga tgc cct get ttc
способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 tcga 349bp >DRD2-R2 aac tgg act ccc ctg cac
58DBH TaqI 65C300+164 >DBH-F=ctg tat ttg gaa ctt ggc ate
способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 tcga 464bp >DBH-R=agg cat ttt act ace cag agg
58-68DAT VNTR 40 bp480 bp >T3-5L=tgt ggt gta ggg aac ggc ctg ag
способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 440 bp >T7-3A=ctt cct gga ggt cac ggc tea agg
58DRD2 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 >971= CCG TCG ACG GCT GGC CAA GTT GTC ТА
способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 способ профилактики и/или лечения зависимости от психоактивных   веществ, патент № 2402974 >5014=CCG TCG ACC CTT CCT GAG TGT CAT CA

Проведение электрофореза и визуализация фрагментов ДНК.

Разделение продуктов амплификации и продуктов рестрикции ампликонов проводили в горизонтальном 3% агарозном геле для продуктов размером более 250 п.о. и в вертикальном 7% полиакриламидном геле (ПААГ) продуктов размером менее 250 п.о. По окончании электрофореза гели помещали на 5 мин в кювету с бромистым этидием (0,5 мкг/мл) для окрашивания ДНК.

Результаты электрофоретического разделения фрагментов ДНК регистрировали фотографированием окрашенного геля, помещенного на трансиллюминатор, через красный фильтр в проходящем ультрафиолетовом свете (длина волны 360 нм). Генотип по каждому гену определялся в соответствии с представленными в таблице 1 длинами фрагментов амплифицированной ДНК.

ФОРМУЛА ИЗОБРЕТЕНИЯ

1. Способ профилактики и/или лечения зависимости от психоактивных веществ, включающий генотипирование по генам дофаминовой, серотониновой, норадреналиновой и гаммааминомасляной кислоты систем нейромедиаторного обмена, психодиагностическое тестирование с последующим формированием психологических типов в соответствии с полиморфизмами в указанных генах и назначение БАД и/или фармакотерапии с учетом результатов генотипирования и выявленных психологических типов с нарушением нейромедиаторного обмена.

2. Способ по п.1, характеризующийся тем, что при недостаточности дофаминового обмена при выявлении незначительной предрасположенности вводят БАД тирозин, при выявлении средней предрасположенности вводят БАД тирозин и диметиламиноэтанол (ДМАЕ), при выявлении высокой предрасположенности вводят БАД тирозин, ДМАЕ и препарат энерион, а при выявлении максимальной предрасположенности вводят БАД тирозин, ДМАЕ и препарат семакс.

3. Способ по п.1, характеризующийся тем, что при недостаточности серотонинового обмена при средней предрасположенности вводят БАД мелаксен, при выявлении высокой предрасположенности вводят БАД 5-гидрокситриптофан и мелаксен, а при выявлении максимальной предрасположенности вводят БАД 5-гидрокситриптофан, мелаксен и препарат асентра.

4. Способ по п.1, характеризующийся тем, что при избыточности серотонинового обмена при выявлении высокой предрасположенности вводят БАД таурин и ДМАЕ, а при выявлении максимальной предрасположенности вводят БАД таурин, ДМАЕ и препарат пиразидол.

5. Способ по п.1, характеризующийся тем, что при избыточности норадреналинового обмена при выявлении средней предрасположенности вводят БАД тирозин, а при выявлении максимальной предрасположенности вводят БАД тирозин и препарат ремерон.

6. Способ по п.1, характеризующийся тем, что при недостаточности дофаминового обмена в сочетании с избыточностью серотонинового обмена при выявлении незначительной предрасположенности вводят БАД ДМАЕ, при выявлении средней предрасположенности вводят БАД таурин и ДМАЕ, при выявлении высокой предрасположенности вводят БАД ДМАЕ и препарат пиразидол, а при выявлении максимальной предрасположенности вводят БАД таурин, ДМАЕ и препарат пиразидол.

7. Способ по п.1, характеризующийся тем, что при недостаточности дофаминового обмена в сочетании с недостаточностью серотонинового обмена при выявлении средней предрасположенности вводят БАД тирозин, при выявлении высокой предрасположенности вводят БАД тирозин и ДМАЕ, а при выявлении максимальной предрасположенности вводят БАД тирозин, ДМАЕ и препарат леривон.

8. Способ по п.2, характеризующийся тем, что при недостаточности дофаминового обмена в сочетании с недостаточностью обмена гаммааминомасляной кислоты при выявлении высокой предрасположенности вводят БАД таурин, ДМАЕ и препарат нейробутал.


Скачать патент РФ Официальная публикация
патента РФ № 2402974

patent-2402974.pdf
Патентный поиск по классам МПК-8:

Класс A61B5/00 Измерение для диагностических целей

Патенты РФ в классе A61B5/00:
устройство для контроля состояния здоровья -  патент 2529808 (27.09.2014)
способ профилактики профессиональной потери слуха -  патент 2529700 (27.09.2014)
способ прогнозирования эффективности лечения у больных с гипертензионно-гидроцефальным синдромом после перенесенной легкой боевой черепно-мозговой травмы без психопатологической симптоматики -  патент 2529698 (27.09.2014)
способ диагностики увеличения щитовидной железы у мужчин и женщин -  патент 2529630 (27.09.2014)
способ прогнозирования ухудшения клинического течения идиопатической саркомы капоши, перехода хронической формы в подострую, затем в острую форму заболевания -  патент 2529628 (27.09.2014)
способ оценки восприятия информации -  патент 2529482 (27.09.2014)
система получения изображений с кардио-и/или дыхательной синхронизацией и способ 2-мерной визуализации в реальном времени с дополнением виртуальными анатомическими структурами во время процедур интервенционной абляции или установки кардиостимулятора -  патент 2529481 (27.09.2014)
устройство и способ для сбора данных с лица и языка -  патент 2529479 (27.09.2014)
способ подготовки полиграфолога -  патент 2529418 (27.09.2014)
способ дистанционной регистрации и обработки электрокардиограммы и дыхания человека и животных -  патент 2529406 (27.09.2014)

Класс A61K31/498  пиразины или пиперазины орто- или пери-конденсированные с карбоциклической системой, например хиноксалин, феназин

Патенты РФ в классе A61K31/498:
способ лечения инфицированных ран и свищей у онкологических больных -  патент 2527175 (27.08.2014)
производные 5-амино-2-(1-гидроксиэтил)тетрагидропирана -  патент 2525541 (20.08.2014)
1-(4-этилфенил)-2-[3-(4-этилфенил)-2-(1н)-хиноксалинилиден]-1-этанон, обладающий анальгетической активностью -  патент 2525397 (10.08.2014)
соединения, ингибирующие (блокирующие) горький вкус, способы их применения и получения -  патент 2522456 (10.07.2014)
усовершенствованные способы и композиции для безопасного и эффективного лечения эритемы -  патент 2519676 (20.06.2014)
способ лечения больных хроническими формами туберкулеза легких -  патент 2519140 (10.06.2014)
оксазолидиниловые антибиотики -  патент 2516701 (20.05.2014)
способ лечения гнойно-некротических заболеваний мягких тканей -  патент 2515395 (10.05.2014)
антибактериальное и регенерирующее средство, выполненное в форме маслянистого геля для наружного применения -  патент 2512757 (10.04.2014)
производные оксазолидиновых антибиотиков -  патент 2506263 (10.02.2014)

Класс A61K31/197  амино- и карбоксильная группы присоединены к одной и той же ациклической углеродной цепи, например гамма-аминомасляная кислота (ГАМК), бета-аланин, эпсилон-аминокапроновая кислота, пантотеновая кислота

Патенты РФ в классе A61K31/197:
биодеградируемое гемостатическое лекарственное средство для остановки капиллярных и паренхиматозных кровотечений -  патент 2522879 (20.07.2014)
применение 5-аминолевулиновой кислоты и ее производных в твердой форме для фотодинамического лечения и диагностики -  патент 2521228 (27.06.2014)
комбинированный гемостатический препарат для наружного применения -  патент 2519026 (10.06.2014)
антисептическое средство с гемостатическим действием и способ его получения -  патент 2508104 (27.02.2014)
глазные капли -  патент 2504372 (20.01.2014)
сульфонамидные соединения и их применение -  патент 2502730 (27.12.2013)
4-триметиламмониобутираты в качестве ингибиторов срт2 -  патент 2502727 (27.12.2013)
кровоостанавливающая спичка -  патент 2501556 (20.12.2013)
способ проведения интраоперационной комбинированной спектроскопической диагностики опухолей головного и спинного мозга -  патент 2497558 (10.11.2013)
композиции на основе тапентадола для лечения боли -  патент 2497512 (10.11.2013)

Класс A61P25/30 для лечения злоупотребления или зависимости

Патенты РФ в классе A61P25/30:
синтетический иммуноген для защиты от токсического действия наркотических и психоактивных веществ -  патент 2526807 (27.08.2014)
гидроксиметилциклогексиламины -  патент 2514192 (27.04.2014)
фармацевтическая композиция, содержащая алкалоиды, резистентная к рекреационным злоупотреблениям (варианты), и способ ее получения, способ приема фармацевтической субстанции, содержащей алкалоиды, теплокровным существом, добавка для предотвращения рекреационных злоупотреблений фармацевтической субстанцией, содержащей алкалоиды, и способ ее получения -  патент 2501569 (20.12.2013)
способ коррекции аддиктивного поведения -  патент 2495670 (20.10.2013)
композиции и способы профилактики и лечения зависимостей -  патент 2492858 (20.09.2013)
способы лечения зависимости -  патент 2491067 (27.08.2013)
производное 3-фенилпиразоло[5,1-b]тиазола -  патент 2482120 (20.05.2013)
двойные модуляторы 5-ht2a и d3-рецепторов -  патент 2480466 (27.04.2013)
производные 1,2,4-триазин-3,5-диона для лечения нарушений, реагирующих на модулирование рецептора допамина d3 -  патент 2478633 (10.04.2013)
имплантируемое лекарственное средство на основе налтрексона для лечения пациентов, зависимых от алкоголя или опиатов -  патент 2476209 (27.02.2013)

Наверх