рекомбинантная плазмидная днк phins11, кодирующая гибридный белок-предшественник инсулина человека, клетка escherichia coli, трансформированная рекомбинантной плазмидной днк phins11, штамм бактерий escherichia coli jm109/phins11 - продуцент гибридного белка-предшественника инсулина человека и способ получения инсулина человека

Классы МПК:C12N15/62 ДНК последовательности, кодирующие белки при слиянии
C12N15/17 инсулины
C12N15/63 введение чужеродного генетического материала с использованием векторов; векторы; использование их хозяев; регулирование экспрессии
C12N15/70 векторы или системы экспрессий, специально приспособленные для Ecoli
C07K14/62 инсулины
C12N1/21 модифицированные введением чужеродного генетического материала
C12P21/02 с известной последовательностью из двух или более аминокислотных остатков, например глутатиона
Автор(ы):, , , , ,
Патентообладатель(и):ОАО "Национальные биотехнологии" (RU)
Приоритеты:
подача заявки:
2006-10-25
публикация патента:

Изобретение относится к области биотехнологии, а именно к получению рекомбинантного инсулина человека, и может быть использовано для приготовления лекарственных препаратов для лечения сахарного диабета. Гибридный белок - предшественник инсулина человека состоит из N-концевого фрагмента гамма-интерферона человека, соединенного через пептидный линкер с аминокислотной последовательностью проинсулина человека. Рекомбинантный инсулин человека получают путем культивирования штамма-продуцента Escherichia coli JM109/pNINS11, несущего плазмиду pHINS11, выделения телец включений и растворения их в буфере, содержащем мочевину и дитиотреитол. Далее проводят ренатурацию гибридного белка, осаждение примесных соединений, очистку ренатурированного гибридного белка ионообменной хроматографией, совместный ферментативный гидролиз гибридного белка трипсином и карбоксипептидазой Б. На последнем этапе проводят очистку инсулина катионообменной хроматографией и методом высокоэффективной жидкостной хроматографии на обращенных фазах. Изобретение позволяет упростить получение высокоочищенного рекомбинантного инсулина человека и повысить его выход. 6 н.п. ф-лы, 2 ил., 4 табл.

рекомбинантная плазмидная днк phins11, кодирующая гибридный белок-предшественник   инсулина человека, клетка escherichia coli, трансформированная   рекомбинантной плазмидной днк phins11, штамм бактерий escherichia   coli jm109/phins11 - продуцент гибридного белка-предшественника   инсулина человека и способ получения инсулина человека, патент № 2354702 рекомбинантная плазмидная днк phins11, кодирующая гибридный белок-предшественник   инсулина человека, клетка escherichia coli, трансформированная   рекомбинантной плазмидной днк phins11, штамм бактерий escherichia   coli jm109/phins11 - продуцент гибридного белка-предшественника   инсулина человека и способ получения инсулина человека, патент № 2354702

Формула изобретения

1. Гибридный белок предшественник инсулина человека формулы (I) [leader]-[linker]-[proinsulin] (I),

где leader представляет собой лидерную пептидную последовательность для экспрессии гибридного белка, содержащую 42 аминокислотных остатка N-концевого фрагмента гамма-интерферона человека (SEQ ID NO:1);

linker представляет собой линкерную последовательность HisProGlySerHisHisHisHisGlySerArg (SEQ ID NO:2);

proinsulin представляет собой аминокислотную последовательность проинсулина человека (SEQ ID NO:3).

2. ДНК, кодирующая гибридный белок-предшественник инсулина человека и характеризующаяся нуклеотидной последовательностью (SEQ ID NO:6), определяющей аминокислотную последовательность гибридного белка по п.1.

3. Рекомбинантная плазмида pHINS11 (фиг.1), содержащая ДНК, кодирующую гибридный белок по п.2 размером 139 а.о., в котором N-концевой фрагмент гамма-интерферона человека соединен через пептидный линкер HisProGlySerHisHisHisHisGlySerArg с аминокислотной последовательностью проинсулина человека, имеющая молекулярную массу 2,36 МДа (3534 п.о.), содержащая BamHI-EcoRI фрагмент векторной плазмиды рКК223-3, включающий промотор транскрипции tac, EcoRI-HindIII фрагмент с геном, имеющим нуклеотидную последовательность, представленную на фиг.2, и кодирующим N-концевой фрагмент гамма-интерферона человека, пептидный линкер HisProGlySerHisHisHisHisGlySerArg и аминокислотную последовательность проинсулина человека, HindIII-SnaI фрагмент плазмиды рКК223-3, включающий терминаторы транскрипции рибосомного оперона Е.coli, ген рекомбинантная плазмидная днк phins11, кодирующая гибридный белок-предшественник   инсулина человека, клетка escherichia coli, трансформированная   рекомбинантной плазмидной днк phins11, штамм бактерий escherichia   coli jm109/phins11 - продуцент гибридного белка-предшественника   инсулина человека и способ получения инсулина человека, патент № 2354702 -лактамазы (bla), участок инициации репликации (ori), Eco47III-EheI фрагмент плазмиды рКК223-3, включающая уникальные сайты узнавания эндонуклеазами рестрикции, расположенные на следующем расстоянии вправо от сайта EcoRI:BamHI - 159 п.о., HindIII - 430 п.о., PvuI - 1370 п.о.

4. Клетка Escherichia coli, трансформированная рекомбинантной плазмидной ДНК pHINS11 по п.3, - продуцент гибридного белка, содержащего проинсулин человека.

5. Штамм бактерий Escherichia coli JM109/pHINS11 - продуцент гибридного белка, содержащего проинсулин человека.

6. Способ получения рекомбинантного инсулина человека, включающий культивирование штамма Escherichia coli - продуцента гибридного белка с проинсулином человека, разрушение клеток дезинтеграцией, отделение телец включения, содержащих гибридный белок, их растворение в буфере, содержащем мочевину и дитиотреитол, ренатурацию гибридного белка, кислотное осаждение примесных соединений, и очистку гибридного белка, его ферментативное расщепление трипсином и карбоксипептидазой Б с последующей очисткой и выделением инсулина, отличающийся тем, что проводят культивирование штамма Escherichia coli JM109/pHINS11 - продуцента гибридного белка, содержащего проинсулин человека; очистку гибридного белка проводят хроматографией на КМ-сефарозе, уравновешенной 0,05 М Na-ацетатным буфером, рН 4,0÷5,5, при этом белок элюируют градиентом 0,1-0,6 М хлорида натрия в 0,05 М Na-ацетатном буфере, рН 4,0÷5,5, содержащем 1,5 М мочевину; расщепление гибридного белка проводят совместным гидролизом трипсином и карбоксипептидазой Б, а полученный инсулин очищают ионообменной хроматографией на сорбентах с сульфопропильными группами в 0,05÷0,2 М аммоний-ацетатном буфере, рН 3,0÷6,0, содержащем 1÷6 М мочевину и 10÷50 мМ KCl, а затем методом обращенно-фазовой высокоэффективной жидкостной хроматографии.

Описание изобретения к патенту

Изобретение относится к области биотехнологии, а именно к получению рекомбинантного инсулина человека, используемого для приготовления лекарственных препаратов для лечения сахарного диабета.

Инсулин - гормон поджелудочной железы, регулирующий процессы углеводного обмена и поддержания нормального уровня сахара в крови. Потребности в данном препарате не могут быть покрыты инсулином животного происхождения из-за ограниченности сырьевой базы. Кроме того, существует необходимость в использовании при лечении диабета различных препаратов инсулина. Поэтому разработка способов получения генно-инженерного инсулина человека является актуальной медицинской задачей.

В настоящее время большую часть инсулина человека получают с использованием методологии экспрессии гена проинсулина человека в клетках Escherichia coli в составе гибридных белков в виде нерастворимых "телец включения". Гибридный белок - предшественник инсулина человека состоит из лидерного пептида и аминокислотной последовательности проинсулина, в котором А- и В-цепи инсулина соединены С-пептидом. В качестве лидерных последовательностей, защищающих рекомбинантный белок от протеолитической деградации, использовали бычий протимозин [1], глутатион-S-трансферазу [2], иммуноглобулин, связывающий (IgG) домен белка А из S.aureus X [3], и др.

Известен способ получения рекомбинантного инсулина человека, предложенный J.Nilsson с соавторами [4]. Способ заключается в культивировании штамма Е.coli, продуцирующего гибридный белок, содержащий проинсулин человека и два синтетических IgG связывающих домена стафилококкового белка А. Схема выделения заключалась в разрушении бактериальных клеток, получении телец включения, содержащих гибридный белок, растворении телец включения, окислительного сульфитолиза гибридного белка, его ренатурации, очистке ренатурированного гибридного белка на IgG-Sepharose аффинной хроматографией, его расщеплении протеолитическими ферментами (трипсином и карбоксипептидазой Б) и заключительной очистке инсулина методом высокоэффективной обращенно-фазовой жидкостной хроматографией.

Существенным недостатком данного способа являются высокая себестоимость целевого продукта, обусловленная использованием для очистки аффинного сорбента, дорогостоящего в производстве и недолговечного при промышленном использовании.

Известен способ получения рекомбинантного инсулина человека [5], включающий культивирование штамма-продуцента Escherichia coli JM 109/pPINS07, разрушение клеток дезинтеграцией, отмывку телец включения, растворение гибридного белка и восстановление дисульфидных связей в буферном растворе, содержащем мочевину и дитиотреитол, ренатурацию восстановленного гибридного белка, очистку гибридного белка ионообменной хроматографией, расщепление гибридного белка совместньм гидролизом трипсином и карбоксипептидазой Б, очистку инсулина гидрофобной хроматографией с использованием сорбента Butyl-Toyopearl 650 с последующей гель-фильтрацией.

Недостатками данного способа являются следующие.

1. Использование в технологическом процессе многочисленных стадий центрифугирования: а) высаливание инсулина и центрифугирование полученного осадка после гидролиза гибридного белка; б) осветление раствора инсулина центрифугированием перед гидрофобной хроматографией; в) переосаждение инсулина и его центрифугирование перед гель-фильтрацией (пункты 5, 6 и 7 схемы очистки инсулина).

2. При заявленных условиях проведения совместного гидролиза - массовом соотношении гибридного белка, трипсина и карбоксипептидазы Б, равном 4000:2:1 (пример 1), образуется значительное количество трудноотделимой примеси В30-дезтреонининсулина [6].

Известен наиболее близкий к заявленному способ получения рекомбинантного инсулина человека [7], включающий культивирование штамма-продуцента E.coli JM109/pPINS07, разрушение бактериальных клеток дезинтеграцией, отделение телец включения, содержащих гибридный белок, их растворение в буфере, содержащем мочевину и дитиотреитол, кислотное осаждение примесных соединений, очистку гибридного белка хроматографией на КМ-сефарозе, расщепление гибридного белка трипсином и карбоксипептидазой Б осуществляют последовательно, при этом продукты трипсинолиза хроматографируют на СП-сефарозе, а полученную после расщепления карбоксипептидазой Б фракцию инсулина очищают методом обращенно-фазовой высокоэффективной жидкостной хроматографии (ОФ ВЭЖХ) с последующей гель-фильтрацией.

Основным недостатком способа является многостадийная технологическая цепочка при выделении рекомбинантного инсулина. Последовательное расщепление гибридного белка трипсином и карбоксипептидазой Б требует последовательных хроматографических очисток диаргинин-инсулина после триптического гидролиза гибридного белка и инсулина после расщепления карбоксипептидазой Б, которые приводят к значительным потерям конечного продукта.

Кроме того, в данном способе использован штамм-продуцент E.coli JM109/pPINS07, несущий рекомбинантную плазмиду pPINS07, которая кодирует гибридный белок с высокой долей лидерного пептида, составляющего около 50% [8]. Поэтому использование данного штамма при получении инсулина удорожает процесс производства из-за повышения затрат на биосинтез и снижает выход целевого продукта.

Наиболее близкими по технической сущности к предлагаемому изобретению в той его части, которая касается получения штамма-продуцента гибридного белка с проинсулином человека, являются штамм-продуцент E.coli JM109/pHINS05 и рекомбинантная плазмидная ДНК pHINS05, кодирующая гибридный белок с проинсулином человека, в котором в качестве лидерной последовательности использовали N-концевой фрагмент гамма-интерферона человека [9]. Данная плазмидная конструкция направляет синтез гибридного полипептида с более высокой долей проинсулина человека. Однако недостатком гибридного белка, продуцируемого штаммом E.coli JM109/pHINS05, является его неэффективная ренатурация и, как следствие, неудовлетворительный выход правильно свернутого полипептида.

Настоящее изобретение в одной своей части направлено на получение высокопродуктивного бактериального штамма - продуцента предшественника инсулина человека, а в другой - на упрощение технологического процесса получения высокоочищенного рекомбинантного инсулина человека и увеличение выхода конечного продукта.

Для достижения данного технического результата предложен способ получения инсулина человека, включающий культивирование штамма-продуцента Escherichia coli, разрушение бактериальных клеток дезинтеграцией, отделение телец включения, их растворение в буфере, содержащем мочевину и дитиотреитол, ренатурацию и очистку ренатурированного гибридного белка, его расщепление трипсином и карбоксипептидазой Б с последующей очисткой и получением целевого продукта, при этом культивируют новый штамм E.coli JM109/pHINS11, несущий новую плазмиду pHINS11, очистку ренатурированного гибридного белка осуществляют путем осаждения примесных соединений с последующей хроматографией на КМ-сефарозе, расщепление гибридного белка трипсином и карбоксипептидазой Б осуществляют одновременно, а полученный после ферментативного расщепления инсулин очищают хроматографией на СП-сефарозе, затем инсулин очищают методом высокоэффективной жидкостной хроматографии на обращенных фазах.

Новый штамм E.coli JM109/pHINS11, несущий плазмиду pHINS11, является продуцентом гибридного белка, содержащего аминокислотную последовательность проинсулина человека.

Новая рекомбинантная плазмида pHINS11 детерминирует синтез гибридного белка с молекулярной массой около 15,4 кДа, в котором N-концевой фрагмент гамма-интерферона человека соединен через пептидный линкер HisProGlySerHisHisHisHisGlySerArg с аминокислотной последовательностью проинсулина человека и обеспечивает его высокую экспрессию.

Рекомбинантную плазмиду pHINS11 конструировали на основе известной плазмиды pHINS05 [9]. Для улучшения свойств гибридного белка, кодируемого плазмидой pHINS05, в состав его линкерной последовательности были введены дополнительные аминокислотные остатки, способствующие правильному сворачиванию полипептида с проинсулином человека, а также его более эффективному ферментативного расщеплению. С этой целью ДНК плазмиды pHINS05 была подвергнута исчерпывающему гидролизу рестриктазами Bell и BamHI, а полученный BelI - BamHI фрагмент (4,2 т.п.о.) лигировали с олигонуклеотидным дуплексом, полученным в результате отжига синтетических олигонуклеотидов oligo-link24A (SEQ ID NO:4) и oligo-link24B (SEQ ID NO:5). Лигированную смесь использовали для трансформации компетентных клеток Е.coli JM109. В результате получали рекомбинантную плазмиду pHINS09, строение которой подтверждали рестрикционным анализом. Структура гена, кодирующего гибридный белок, была подтверждена секвенированием (фиг.2).

Для увеличения копийности полученной плазмиды pHINS09 ее делегировали по rop-гену (негативному регулятору копийности) [10]. С этой целью ДНК плазмиды pHINS09 подвергали исчерпывающему гидролизу рестриктазами Eco47III и SnaI, a полученный Eco47III - SnaI (4,2 т.п.о.) лигировали. В результате получали рекомбинантную плазмиду pHINS11 размером 3,6 т.п.о., строение которой подтверждали рестрикционным анализом и секвенированием.

Новая рекомбинантная плазмида pHINS11, кодирующая гибридный белок, содержащий аминокислотную последовательность проинсулина человека, характеризуется следующими признаками:

имеет размер 3640 п.о.;

кодирует гибридный белок размером 139 а.о. с молекулярной массой 15,4 кДа, в котором аминокислотная последовательность лидерного пептида, представляющая собой 42 аминокислотных остатка N-концевого фрагмента гамма-интерферона человека (SEQ ID NO:1), соединена через пептидный линкер HisProGlySerHisHisHisHisGlySerArg (SEQ ID NO:2) с аминокислотной последовательностью проинсулина человека;

состоит из: BamHI-EcoRI фрагмента плазмиды рКК223-3 [II], содержащего промотор транскрипции tac; EcoRI-HindIII фрагмента, включающего ген гибридного белка с последовательностью нуклеотидов, представленной на фиг.2, кодирующий N-концевой фрагмент гамма-интерферона человека, пептидный линкер HisProGlySerHisHisHisHisGlySerArg и аминокислотную последовательность проинсулина человека; HindIII-SnaI фрагмента плазмиды рКК223-3, содержащего терминатор транскрипции рибосомого оперона E.coli, ген рекомбинантная плазмидная днк phins11, кодирующая гибридный белок-предшественник   инсулина человека, клетка escherichia coli, трансформированная   рекомбинантной плазмидной днк phins11, штамм бактерий escherichia   coli jm109/phins11 - продуцент гибридного белка-предшественника   инсулина человека и способ получения инсулина человека, патент № 2354702 -лактамазы (bla), участок инициации репликации (ori); Eco47III-EheI фрагмента плазмиды рКК223-3;

содержит tac-промотор транскрипции, ген, кодирующий гибридный белок, в котором N-концевая последовательность гамма-интерферона соединена через пептидный линкер HisProGlySerHisHisHisHisGlySerArg с аминокислотной последовательностью проинсулина человека; в качестве генетического маркера ген рекомбинантная плазмидная днк phins11, кодирующая гибридный белок-предшественник   инсулина человека, клетка escherichia coli, трансформированная   рекомбинантной плазмидной днк phins11, штамм бактерий escherichia   coli jm109/phins11 - продуцент гибридного белка-предшественника   инсулина человека и способ получения инсулина человека, патент № 2354702 -лактамазы (bla), определяющий устойчивость трансформированных плазмидой pHINS11 клеток бактерий к ампициллину; уникальные сайты узнавания рестрикционными эндонуклеазами, расположенные на следующем расстоянии вправо от сайта EcoRI: BamHI - 159 п.о., HindIII - 430 п.о., Pvu I - 1370 п.о.

Преимуществом плазмиды pHINS11 является то, что она обеспечивает более высокий выход конечного продукта инсулина за счет повышения выхода правильно свернутого гибридного белка после его ренатурации.

Штамм-продуцент Е.coli JM109/pHINS11 получают путем трансформации клеток Е.coli штамма JM109 плазмидой pHINS11. После трансформации отбирают колонии, выращенные на среде с ампициллином, выделяют из них плазмиды и подвергают их рестрикционному анализу и секвенированию. Линию клеток, несущую плазмиду pHINS11, несколько раз пересевают на агаризованную среду с ампициллином и полученной моноклоновой культурой инокулируют 5 мл жидкой среды с ампициллином. Культуру проверяют на наличие индуцируемой экспрессии гибридного белка, фасуют, добавляют глицерин и хранят при минус 40°С.

Полученный штамм-продуцент Escherichia coli JM109/pHINS11 характеризуется следующими признаками.

Морфологические признаки: клетки мелкие, палочковидной формы, грамотрицательные, неспороносные, размером 1×3,5 мкм, подвижные, с хорошо различимыми тельцами включения после индукции синтеза гибридного белка.

Культуральные признаки: при росте на агаризованной среде LB колонии круглые, гладкие, полупрозрачные, блестящие, серые. Край ровный, диаметр колоний 1-3 мм, консистенция пастообразная. Рост в жидких средах (LB, минимальная среда с глюкозой) характеризуется ровным помутнением.

Физиолого-биохимические признаки: клетки растут при температуре 4-42°С, оптимум рН 6,8-7,6. В качестве источника азота используют как минеральные соли аммония, так и органические соединения: аминокислоты, пептон, триптон, дрожжевой экстракт. В качестве источника углерода при росте на минимальной среде используют глицерин, углеводы, аминокислоты.

Устойчивость к антибиотикам: клетки штамма-продуцента проявляют устойчивость к ампициллину (до 500 мг/мл), обусловленную наличием в плазмиде гена рекомбинантная плазмидная днк phins11, кодирующая гибридный белок-предшественник   инсулина человека, клетка escherichia coli, трансформированная   рекомбинантной плазмидной днк phins11, штамм бактерий escherichia   coli jm109/phins11 - продуцент гибридного белка-предшественника   инсулина человека и способ получения инсулина человека, патент № 2354702 -лактамазы (bla).

Стабильность плазмиды в штамме. При поддержании клеток в течение нескольких месяцев на агаризованной среде LB, содержащей ампициллин, не наблюдаются потери или перестройки плазмиды, влияющие на экспрессию гибридного белка.

В новом штамме гибридный белок после индуцированной экспрессии накапливается в виде телец включения и его содержание составляет не менее 30% от общего белка клетки.

Новая рекомбинантная плазмида pHINS11 обеспечивает эффективный биосинтез гибридного белка, содержащего проинсулин человека и в других бактериальных штаммах Escherichia coli, например в штамме-хозяине E.coli BL21 (Пример 3).

На фиг.1 представлена физическая карта рекомбинантной плазмиды pHINS11; на фиг.2 - нуклеотидная последовательность гена гибридного белка с происулином человека в составе плазмиды pHINS11 и кодируемая им аминокислотная последовательность.

Полученный штамм-продуцент Е.coli JM109/pHINS11 депонирован в коллекции микроорганизмов ОАО "Национальные Биотехнологии" под номером 11-05.

Способ получения инсулина человека осуществляется следующим образом.

Выращивание посевной и основной культуры штамма-продуцента Е.coli JM109/pHINS11 проводят на питательной среде, содержащей, г/л: гидролизат казеина соляно-кислотный - 30, экстракт пекарских дрожжей - 14, двузамещенный фосфат калия трехводный - 6, однозамещенный фосфат калия - 3, сульфат магния - 0,5, глюкоза - до 50, ампициллина натриевая соль - 0,05, вода очищенная - остальное. Для засева ферментера используют посевной материал в разведении 1:10. Для индукции синтеза гибридного белка в середине логарифмической фазы роста вносят 1-изопропил-рекомбинантная плазмидная днк phins11, кодирующая гибридный белок-предшественник   инсулина человека, клетка escherichia coli, трансформированная   рекомбинантной плазмидной днк phins11, штамм бактерий escherichia   coli jm109/phins11 - продуцент гибридного белка-предшественника   инсулина человека и способ получения инсулина человека, патент № 2354702 -D-1-тиогалактопиранозид (ИПТГ). В процессе выращивания концентрацию растворенного кислорода поддерживают на уровне 40±15%, количество вводимой глюкозы регулируют по уровню растворенного кислорода и рН. После окончания выращивания культуру концентрируют на сепараторе и клетки разрушают на гомогенизаторе Гаулина в 0,1 М трис-буфере, рН 6,8-7, содержащем 1,5 М мочевину и 1 мМ ЭДТА. Тельца включения отделяют центрифугированием.

Выделение гибридного белка из телец включения, его ферментативное расщепление и очистку инсулина проводят по следующей схеме:

- тельца включения растворяют в 0,1 М трис-HCl буфере, рН 8,0, содержащем 8 М мочевину, с последующим добавлением дитиотреитола до конечной концентрации 10 мМ;

- гибридный белок с проинсулином человека ренатурируют в 5-10-кратном объеме 0,1 М глицин-NaOH буфера, рН 9-11 при температуре 10-14°С;

- кислотное осаждение примесных белков проводят доведением рН до 4,0-5,5 раствором HCl, а образовавшийся осадок отделяют микрофильтрацией;

- очистку гибридного белка проводят хроматографией на КМ-сефарозе, уравновешенной 0,05 М Na-ацетатным буфером, рН 4,0÷5,5. Белок элюируют градиентом 0,1-0,6 М хлорида натрия в 0,05 М Na-ацетатном буфере, рН 4,0÷5,5, содержащем 1,5 М мочевину;

- расщепление гибридного белка проводят совместным гидролизом трипсином и карбоксипептидазой Б при массовом соотношении гибридный белок: трипсин: карбоксипептидаза Б=2000:1:(1÷10) при рН=6,9÷7,5 и температуре 4÷36°С. Реакцию останавливают добавлением 10%-ного раствора соляной кислоты до рН 3,6±0,3;

- после ферментативного гидролиза гибридного белка инсулин очищают ионообменной хроматографией на СП-сефарозе в 0,05÷0,2 М аммоний-ацетатном буфере, рН 3,0÷6,0, содержащем 1÷6 М мочевину и 10÷50 мМ KCl. Сорбированный белок элюируют линейным градиентом хлористого калия от 0 до 0,5 М в уравновешивающем буфере. Фракции, содержащие инсулин с чистотой не менее 90%, объединяют и используют для получения высокоочищенной субстанции инсулина;

- очистку инсулина методом препаративной обращенно-фазовой высокоэффективной жидкостной хроматографией проводят на стандартном оборудовании "Armen" (Франция) или аналогичном оборудовании других фирм.

Изобретение иллюстрируется следующими не ограничивающими его примерами.

Пример 1. Конструирование плазмиды pHINS11.

Плазмиду pHINS11 конструируют на основе известной плазмиды pHINS05 [9]. Плазмидную ДНК pHINS05 подвергают исчерпывающему гидролизу рестриктазами BelI и BamHI. Для этого 5 мкг плазмидной ДНК pHINS05 в 20 мкл буфера, содержащего 33 мМ трис-ацетата, рН 7,9, 66 мМ К-асетата, 10 мМ Mg-ацетата и 0,1 мг/мл БСА (буфер 1) и 10 ед рестриктазы BelI и BamHI инкубируют 1,0 час при 37°С. Из полученного гидролизата выделяют BclI-BamHI фрагмент ДНК размером около 4,2 т.п.о. при помощи электрофореза в 0,8% геле легкоплавкой агарозы. Далее ДНК депротеинизируют фенолом, смесью фенола с хлороформом (1:1), хлороформом, осаждают этиловым спиртом, растворяют в 20 мкл воды. Полученный BclI-BamHI фрагмент, содержащий ген гибридного белка и векторную часть плазмиды pHINS05, лигируют с 20-кратным молярным избытком олигонуклеотидного дуплекса, полученного в результате отжига синтетических олигонуклеотидов oligo-link24A (SEQ ID NO:4) и oligo-lmk24B (SEQ ID NO:5):

oligo-link24A

5' GATCACCCGGGATCTCATCATCAT 3'

3' TGGGCCCTAGAGTAGTAGTAGTAC 5'

oligo-link24B

Компетентные клетки штамма E.coli JM109 трансформируют лигированной смесью (10 мкл) и высевают на LB-агар, содержащий 100 мкг/мл ампициллина. Из выросших колоний выделяют плазмидную ДНК и секвенируют между сайтами рестриктаз EcoRI и BamHI для подтверждения вставки в линкерную часть гена гибридного белка. В результате получают плазмиду pHINS09.

Для получения плазмиды с делецией по rop-гену (негативного регулятора копийности) к 5 мкг плазмидной ДНК pHINS09 в 20 мкл буфера 1 добавляют 10 ед рестриктазы Eco47III и SnaI, генерирующие "тупые" концы, и смесь инкубируют 1,0 час при 37°С. Далее ДНК депротеинизируют фенолом, смесью фенола с хлороформом (1:1), хлороформом, осаждают этиловым спиртом, растворяют в 20 мкл воды. Полученную таким образом ДНК лигируют в 30 мкл буфера для лигирования в присутствии 5 ед ДНК лигазы фага Т4 в течение 16 ч при 8°С. Лигированной смесью (10 мкл) трансформирют компетентные клетки штамма E.coli JM109 и высевают на LB-агар, содержащий 100 мкг/мл ампициллина. Отбирают бактериальные клоны, несущие плазмидную ДНК размером 3,6 т.п.о. Выделенные плазмиды подвергают рестрикционному анализу и секвенируют по методу Сенгера. В результате получают плазмиду pHINS11.

Пример 2. Получение штамма-продуцента E.coli JM109/pHINS11.

Плазмидой pHINS11 трансформируют компетентные клетки штамма E.coli JM109 и высевают на LB-агар, содержащий 100 мкг/мл ампициллина. Отдельно локализованную колонию трижды пересевают на чашки с LB-агаром, содержащим 100 мкг/мл ампициллина. Полученной моноклоновой культурой инокулируют 5 мл жидкой среды LB с ампициллином и инкубируют в течение ночи при интенсивном встряхивании при 37°С.

Полученный штамм-продуцент E.coli JM109/pHINS11 хранят в 20% глицерине при минус 40°С.

Для определения уровня индуцируемой экспрессии гибридного белка ночную культуру засевают в разведении 1:50 в 5 мл жидкой среды LB, содержащей 100 мкг/мл ампициллина, и растят до мутности 0,8 при 37°С на качалке при 200 об/мин. К культуре добавляют ИПТГ до концентрации 1,0 мМ и продолжают инкубацию в тех же условиях в течение 3 часов. Клетки собирают центрифугированием, осадок суспендируют в буфере, содержащем 62,5 мМ трис-HCl, рН 6,8, 3% додецилсульфата натрия, 5% 2-меркаптоэтанола, 10% глицерина и 0,01% бромфенолового синего и прогревают 3 мин на кипящей водяной бане. Полученный лизат клеток анализируют электрофорезом в 18% полиакриламидном геле с додецилсульфатом натрия [12]. Гель окрашивают Coomassie R-250, сканируют и проводят его денситометрию. По данным денситометрии содержание гибридного белка составляет не менее 30% от общего белка клетки.

Пример 3. Получение штамма-продуцента E.coli BL21/pHINS11.

Компетентные клетки штамма E.coli BL21 трансформирют плазмидной ДНК pHINS11 и высевают на LB-агар, содержащий 100 мкг/мл ампициллина. Отдельно локализованную колонию трижды пересевают на чашки с LB-агаром, содержащим 100 мкг/мл ампициллина. Полученной моноклоновой культурой инокулируют 5 мл жидкой среды LB и инкубируют в течение ночи при интенсивном встряхивании при 37°С.

Полученный штамм-продуцент E.coli BL21/pHINS11 хранят в 20% глицерине при минус 40°С.

Определение продуктивности штамма E.coli BL21/pHINS11 проводили таким же методом, как и для штамма E.coli JM109/pHINS11, описанным в примере 2. По данным денситометрии содержание гибридного белка в индуцированных клетках полученного штамма составляет не менее 30% от общего белка клетки.

Пример 4. Получение инсулина человека при использовании штамма-продуцента E.coli JM109/pHINS11.

Этап 1. Выращивание биомассы штамма-продуцента Е.coli JM109/pHINS11.

Культивирование клеток штамма Е.coli JM109/pHINS11 проводят в условиях, обеспечивающих накопление гибридного белка. На всех стадиях размножения микробных культур используют питательную среду следующего состава (г/л): гидролизат казеина соляно-кислотный - 30, экстракт пекарских дрожжей - 14, двузамещенный фосфат калия трехводный - 6, однозамещенный фосфат калия - 3, сульфат магния - 0,5, глюкоза - до 50, ампициллина натриевая соль - 0,05, вода очищенная - остальное.

Посевные культуры готовят в количестве 1/10 от объема засеваемой питательной среды и выращивают до оптической плотности (ОП) 7-8 ед (длина волны - 540 нм, длина оптического пути -10 мм).

Условия выращивания посевных культур представлены в таблице 1.

Таблица 1
рН6,9±0,2
pO2 40±15%
Пеногашение По сигналу датчика
Аэрация и режим работы мешалки По уровню pO2
Количество вводимой глюкозы и щелочи По уровню pO2 и рН
Длительность4-6 час
Окончание процессаПри ОП 7-8

Выращивание основной культуры продуцента проводят в ферментере общей емкостью 150 л. Состав питательной среды и основные условия культивирования такие же, как и для посевных культур. Для индукции биосинтеза гибридного белка в середине логарифмической фазы роста культуры вносится индуктор ИПТГ. Культивирование продолжают до образования внутриклеточных включений гибридного белка ("телец включения") у 90-95% клеток. Экспресс-контроль процесса накопления телец включения (ТВ) осуществляют с помощью фазово-контрастной микроскопии препаратов.

Основные параметры процесса культивирования штамма-продуцента E.coli JM109/pHINS11 приведены в таблице 2.

Таблица 2
Полная вместимость ферментера 150 л
Рабочая емкость ферментеров 100 л
Объем питательной среды 90 л
Объем посевной посевной культуры 10 л
Рабочая температура36,5±0,5°С
pH 6,9±0,2
pO2 40±15%
ПеногашениеПо сигналу датчика
Аэрация и режим работы мешалки По уровню pO2
Количество вводимой глюкозы и щелочи По уровню pO2 и рН
Введение ИПТГПри ОП 7-9
Окончание процесса При образовании ТВ у 90-95% клеток

Этап 2. Выделение телец включения.

Рост культуры в ферментере останавливают путем резкого сокращения интенсивности перемешивания, культуру охлаждают до 10-14°С и концентрируют на сепараторе в 8-10 раз. В полученную суспензию добавляют трис-основной до концентрации 0,1 М, мочевину - до 1,5 М, ЭДТА - до 1 мМ. Забуференную до рН 6,8-7,0 суспензию трижды пропускают через гомогенизатор Гаулина при давлении 700-800 атм и температуре 15-20°С. Гомогенат клеток пропускают через проточную центрифугу (g=18000). Основная масса телец включения (не менее 90%) осаждается в роторе центрифуги. Влажный осадок телец включения, 2,6 кг, выгружают из ротора центрифуги, замораживают и хранят при минус 40°С. Потери гибридного белка при выделении телец включения не превышают 15%.

Этап 3. Растворение телец включения, содержащих гибридный белок, и ренатурация гибридного белка.

В реактор объемом 30 л, заполненный 18 л буферного раствора, содержащего 0,1 М трис-HCl, рН 8,0 и 8 М мочевину, загружают 1,8 кг пасты телец включения и включают перемешивающее устройство. После растворения телец включения в реактор добавляют дитиотреитол до конечной концентрации 10 мМ и продолжают перемешивание в течение 10-12 ч при 15°С. Количество гибридного белка в растворе составляло 174 г.

В реактор с охлаждением объемом 250 л заливают 160 л глицин-NaOH буфера, рН 9-11 и охлаждают его до температуры 10-14°С. После охлаждения буферного раствора в реактор подают раствор гибридного белка с восстановленными дисульфидными связями. В течение 20-24 ч инкубируют раствор гибридного белка, перемешивая и поддерживая температуру в реакторе 10-14°С. После ренатурации гибридного белка с образованием правильно замкнутых S-S связей (контроль методом ОФ ВЭЖХ) проводят кислотное осаждение примесных белков путем подкисления реакционной среды в реакторе до рН 4,0-5,5 раствором соляной кислоты. Останавливают перемешивание и через 4-5 ч супернатант осветляют на микрофильтрационной установке.

Содержание ренатурированного гибридного белка в супернатанте составляет 85 г.

Этап 4. Очистка ренатурированного гибридного белка на КМ-сефарозе.

Правильно свернутый гибридный белок сорбируют из фильтрата на ионнообменную колонку объемом 5 л, заполненную КМ-сефарозой, предварительно уравновешенной 0,05 М Na-ацетатным буфером, рН 4,0÷5,5. Сорбированный белок элюируют с колонки градиентом 0,1-0,6 М хлорида натрия в 0,05 М Na-ацетатном буфере, рН 4,0÷5,5, содержащем 1,5 М мочевину. Фракции, содержащие гибридный белок с чистотой не менее 95% (контроль методом ОФ ВЭЖХ), объединяют и используют для дальнейшей работы.

В результате получают 63 г ренатурированного гибридного белка с чистотой не ниже 90%.

Этап 5. Совместный гидролиз гибридного белка трипсином и карбоксипептидазой Б и очистка инсулина на СП-сефарозе.

Расщепление гибридного белка трипсином и карбоксипептидазой Б проводят в реакторе из нержавеющей стали с охлаждением объемом 30 л, снабженном перемешивающим устройством. В реактор вносят 13 л раствора гибридного белка, раствор охлаждают до 4-7°С и доводят его рН до 7,2-7.3 добавлением 1 М раствора трис-основного. Затем в реактор вносят раствор трипсина и карбоксипептидазы Б в массовом соотношении гибридный белок: трипсин: карбоксипептидаза Б, равном 2000:1:1,25. Реакцию гидролиза проводят в течение 10-12 часов, контролируя методом ОФ ВЭЖХ накопление инсулина в гидролизате. Реакцию расщепления останавливают, подкисляя гидролизат до рН 3,4±0,2 10%-ным раствором соляной кислоты до рН 3,6±0,3. В реактор добавляют хлористый калий до концентрации 40 мМ. Полученный раствор наносят на хроматографическую колонку объемом 5 л, заполненную СП-сефарозой, предварительно уравновешенную буфером: 2 М мочевина, 0,1 М аммоний ацетат, рН 3,6. Промывку колонки проводят тем же буфером. Элюцию сорбированного инсулина проводят линейным градиентом хлористого калия от 0 до 0,5 М в уравновешивающем буфере. Объединяют фракции, содержащие 13,2 г инсулина с чистотой не менее 95% (контроль методом ОФ ВЭЖХ).

Этап 6. Получение высокоочищенного инсулина методом препаративной обращенно-фазовой высокоэффективной жидкостной хроматографией (ОФ ВЭЖХ)

Очистку инсулина методом ОФ ВЭЖХ проводят на стандартном оборудовании "Armen" (Франция). Комплексная система для ВЭЖХ включает в свой состав следующие элементы:

- хроматограф "Armen" (производительность 100 мл/мин, давление до 150 атм),

- блок управления,

- двухголовочный мембранный насос высокого давления,

- насос высокого давления для закачки пробы на разделение,

- ультрафиолетовый детектор с переменной длиной волны "Knauer",

- колонка хроматографическая, сталь нерж., V=4 л,

- компьютер для управления и обработки данных.

Подготовку хроматографической установки к работе проводят согласно инструкции фирмы изготовителя для отдельных блоков и установки в целом.

В подготовленную колонку при помощи насоса для подачи пробы из емкости подают раствор инсулина с предыдущей стадии очистки в количестве 13,2 г белка. Включают программирующее устройство и ведут разделение по следующей программе (см. табл.3).

Таблица 3
Время, минСкорость элюции, см3 % раствора В
0350 26
5 350 27,5
15 350 28,5
20 350 30
25 350 70
30 350 26

Регистрацию процесса разделения ведут при 220 нм на проточном спектрофотометре при чувствительности прибора 2,0. Сбор фракций белка ведут при помощи коллектора хроматографа или вручную. Собранные фракции основного пика инсулина анализируются на содержание примесей методом ОФ ВЭЖХ.

После очистки получают 11,4 г высокоочищенного инсулина человека с содержанием основного вещества 98%.

Пример 5. Совместный гидролиз гибридного белка трипсином и карбоксипептидазой Б и очистка инсулина на СП-сефарозе.

Условия гидролиза гибридного белка трипсином и карбоксипептидазой Б и последующая очистка инсулина на СП-сефарозе приведены в таблице 4.

Таблица 4
Условия проведения гидролиза гибридного белка трипсином и карбоксипептидазой Б Условия хроматографии на СП-сефарозе
Массовое соотношение гибридный белок: трипсин: карбоксипептидаза Бt°C pHКонцентрация мочевины, МКонцентрация NH4Ac, мМ pHКонцентрация KCl, мМ в образце
2000:1:415±1 7,5±0,1 1,5130 3,345
2000:1:1,5 4±16,9±0,1 1,5 1303,3 45
2000:1:2 5±1 7,0±0,12 100 3,640
2000:1:10 36±17,2±0,1 3 804,2 30
2000:1:10 36±1 7,5±0,16 50 5,510

Таким образом, предлагаемый способ позволяет получить высокоочищенный инсулин человека с чистотой не ниже 98% и активностью не ниже 27,5 Е/мг.

Подлинность полученного целевого продукта подтверждена следующими параметрами:

- по совпадению времени удержания основного пика целевого продукта и международного референс-стандарта USP (Фармакопея USP 23, США);

- по определению биологической активности целевого продукта (ВФС 42-3045-98), которая составляет не менее 27 Ед/мг;

- по совпадению пептидных карт целевого продукта и референс-стандарта USP.

- по определению молекулярной массы целевого продукта методом масс-спектроскопии.

Чистота полученного целевого продукта подтверждена по фармакопее USP 23, США и составила:

- по содержанию целевого продукта, определяемого методом ВЭЖХ, не менее 98%;

- по содержанию дезамидоинсулина менее 2%.

Источники информации

1. Tang J., Xue Y., Fan X., Fu Y. // Clin. J. BiotechnoL, 1993. v.9. p.71-78.

2. Berg H., Walter М., Mauch L., Seissler J., Northemann W.J. // Immunol. Methods, 1993, v.164, p.221-231.

3. Wei G., Hu М. H., Tang L. G. // Biochem. Mol. Biol. Int., 1995, v.35. p.37-46.

4. Nilson J., Jonasson P., Samuelsson E., Stahl S., Uhlen M. // Journal of biotechnology, 1996, v.48, p.241-250.

5. Патент РФ RU 2208637 C1, 20.07.2003.

6. Патент СССР SU 1829939 A3, 23.07.93. Бюл. № 27.

7. Патент РФ RU 2232813 C1, 20.07.2004. Бюл. № 20.

8. Патент РФ RU 2144957 С1, 27.01.2000.

9. Патент РФ RU 2263147 C1, 27.10.2005. Бюл. № 30.

10. Twigg A.J. and Sherrat D. // Nature, 1980, v.283, p.216-218.

11. Brosius J., Dull T. J., Sleeter D.D., Noller H.F. // J. Mol. Biol., 1981, v.148, p.107-127.

12. Laemmli U.K. // Nature, 1970, v.227, p.680-687.

рекомбинантная плазмидная днк phins11, кодирующая гибридный белок-предшественник   инсулина человека, клетка escherichia coli, трансформированная   рекомбинантной плазмидной днк phins11, штамм бактерий escherichia   coli jm109/phins11 - продуцент гибридного белка-предшественника   инсулина человека и способ получения инсулина человека, патент № 2354702

рекомбинантная плазмидная днк phins11, кодирующая гибридный белок-предшественник   инсулина человека, клетка escherichia coli, трансформированная   рекомбинантной плазмидной днк phins11, штамм бактерий escherichia   coli jm109/phins11 - продуцент гибридного белка-предшественника   инсулина человека и способ получения инсулина человека, патент № 2354702

Скачать патент РФ Официальная публикация
патента РФ № 2354702

patent-2354702.pdf

Класс C12N15/62 ДНК последовательности, кодирующие белки при слиянии

дисплей на поверхности клеток полипептидных изоформ на основе прочитывания терминирующего кодона -  патент 2528858 (20.09.2014)
модифицированный фактор виллебранда с удлиненным полупериодом существования in vivo, его применения и способы получения -  патент 2528855 (20.09.2014)
слитый белок тиоредоксина и домена 4 инфестина, способ его получения, экспрессионная плазмидная днк, кодирующая слитый белок, и бактерия рода escherichia coli, трансформированная такой плазмидной днк -  патент 2528251 (10.09.2014)
искусственный ген mel-tci-a0201, кодирующий полиэпитопный белок-иммуноген mel-tci-a0201, рекомбинантная плазмидная днк pmel-tci-a0201, обеспечивающая экспрессию искусственного гена mel-tci-a0201 и искусственный белок-иммуноген mel-tci-a0201, содержащий множественные ctl- и th-эпитопы антигенов меланомы -  патент 2522830 (20.07.2014)
рекомбинантная днк, кодирующая гибридный белок эпидермального фактора роста человека слитого последовательностью глутатион-s-трансферазы (gst-hegf) и рекомбинантная плазмида pas007, обеспечивающая синтез gst-hegf в клетках escherichia coli -  патент 2521515 (27.06.2014)
рекомбинантная плазмидная днк pg1-rm7, обеспечивающая синтез гибридного белка g1-rm7, и гибридный белок, связывающий фактор некроза опухолей и обладающий биолюминесцентной активностью -  патент 2513686 (20.04.2014)
мутеины кислотной зоны внеклеточного домена рецептора фактора роста фибробластов -  патент 2509774 (20.03.2014)
способы скрининга с применением g-белок сопряженных рецепторов и родственных композиций -  патент 2506274 (10.02.2014)
способ синтеза белка с модифицированным профилем n-гликозилирования в растениях -  патент 2499053 (20.11.2013)
полинуклеотидная последовательность, кодирующая сконструированный белок пертактин, вектор, включающий такую последовательность, и вакцинные композиции, содержащие белок пертактина или вектор -  патент 2499046 (20.11.2013)

Класс C12N15/17 инсулины

аналоги инсулина, устойчивые к протеазам -  патент 2524150 (27.07.2014)
рекомбинантная плазмидная днк phig05, кодирующая гибридный белок с проинсулином glargine человека, клетка escherichia coli, трансформированная рекомбинантной плазмидной днк phig05, и штамм бактерий escherichia coli jm109/phig05-продуцент гибридного белка с проинсулином glargine человека -  патент 2515115 (10.05.2014)
рекомбинатная плазмидная днк рнi03 кодирующая, гибридный белок с проинсулином человека, клетка escherichia coli, трансформированная рекомбинантной плазмидной днк рнi03, и штамм бактерий escherichia coli jm109/phi03-продуцент гибридного белка-предшественника инсулина человека -  патент 2515061 (10.05.2014)
рекомбинантная плазмидная днк philp07, кодирующая гибридный белок с проинсулином lispro человека, клетка escherichia coli, трансформированная рекомбинантной плазмидной днк philp07, и штамм бактерий escherichia coli jm109/philp07-продуцент гибридного белка с проинсулином lispro человека -  патент 2514480 (27.04.2014)
аналоги инсулиноподобного фактора роста-1 (igf-1), содержащие аминокислотную замену в положении 59 -  патент 2511577 (10.04.2014)
стабилизированные полипептиды инсулиноподобного фактора роста -  патент 2477287 (10.03.2013)
способ получения рекомбинантного с-пептида проинсулина человека -  патент 2451750 (27.05.2012)
фармацевтическая композиция для генной терапии заболеваний, требующих стимуляции регенераторных процессов, включая повреждения тканей человека различной этиологии, на основе синтетического модифицированного гена инсулиноподобного фактора роста человека первого типа (ифр-1, igf-1) -  патент 2372941 (20.11.2009)
рекомбинантная плазмидная днк pas-2, кодирующая полипептид проинсулина aspart человека, и штамм бактерий escherichia coli bas2 - продуцент рекомбинантного проинсулина aspart -  патент 2337964 (10.11.2008)
рекомбинантная плазмидная днк pgg-1, кодирующая полипептид проинсулина glargin человека и штамм бактерий escherichia coli bgg18 - продуцент рекомбинантного проинсулина glargin -  патент 2325440 (27.05.2008)

Класс C12N15/63 введение чужеродного генетического материала с использованием векторов; векторы; использование их хозяев; регулирование экспрессии

модифицированный фактор виллебранда с удлиненным полупериодом существования in vivo, его применения и способы получения -  патент 2528855 (20.09.2014)
вакцины и компоненты вакцин для подавления микробных клеток -  патент 2528854 (20.09.2014)
антитела, узнающие углеводсодержащий эпитоп на cd43 и сеа, экспрессируемых на раковых клетках и способы их применения -  патент 2528738 (20.09.2014)
антитела против альфа5-бета 1 и их применение -  патент 2528736 (20.09.2014)
рекомбинантный штамм бактерий escherichia coli - продуцент янтарной кислоты (варианты) и способ получения янтарной кислоты с использованием этого штамма -  патент 2528056 (10.09.2014)
способ получения наноматериала на основе рекомбинантных жгутиков археи halobacterium salinarum -  патент 2526514 (20.08.2014)
проникающие в клетку пептиды и полипептиды для клеток микроорганизмов -  патент 2526511 (20.08.2014)
новая мутация, вовлеченная в повышенную толерантность растений к имидазолиноновым гербицидам -  патент 2525933 (20.08.2014)
способ создания трансгенных животных со стабильным и высоким уровнем экспрессии целевого белка в молоке -  патент 2525712 (20.08.2014)
синтетические 5 utr (нетранслируемые области), экспрессионные векторы и способ повышения трансгенной экспрессии -  патент 2524431 (27.07.2014)

Класс C12N15/70 векторы или системы экспрессий, специально приспособленные для Ecoli

рекомбинантная днк, кодирующая гранулоцитарный колониестимулирующий фактор человека (g-csf) и рекомбинантная плазмида рas017, обеспечивающая синтез g-csf в клетках escherichia coli -  патент 2529363 (27.09.2014)
рекомбинантная днк, кодирующая гибридный белок эпидермального фактора роста человека слитого последовательностью глутатион-s-трансферазы (gst-hegf) и рекомбинантная плазмида pas007, обеспечивающая синтез gst-hegf в клетках escherichia coli -  патент 2521515 (27.06.2014)
рекомбинантная плазмидная днк pg1-rm7, обеспечивающая синтез гибридного белка g1-rm7, и гибридный белок, связывающий фактор некроза опухолей и обладающий биолюминесцентной активностью -  патент 2513686 (20.04.2014)
рекомбинантная плазмидная днк pqe-p35d, обеспечивающая синтез рекомбинантного белка p35d вируса оспы коров, штамм бактерий escherichia coli - продуцент рекомбинантного белка p35d вируса оспы коров и рекомбинантный белок p35d вируса оспы коров, используемый для создания тест-систем и конструирования субъединичных вакцин против ортопоксвирусных инфекций -  патент 2511037 (10.04.2014)
способ получения рекомбинантного антигена g2 хантавируса добрава в клетках e.coli -  патент 2509805 (20.03.2014)
рекомбинантный полипептид а2, селективно связывающий hsa, рекомбинантная днк pa2, кодирующая hsa-связывающую часть полипептида a2, его продуцент - рекомбинантный штамм escherichia coli m15-a2, содержащий рекомбинантную плазмидную днк pqe 32-pa2, обеспечивающую получение полипептида a2 и применение полипептида а2 для диагностики микроальбуминурии и выделения hsa из сыворотки крови -  патент 2506271 (10.02.2014)
способ получения рекомбинантного антигена g2 хантавируса добрава в клетках e. coli -  патент 2495938 (20.10.2013)
система экспрессии компонентов ортогональной трансляции в эубактериальной клетке-хозяине -  патент 2467069 (20.11.2012)
штамм клеток e.coli bl21(de3)plyss, клон ptt9/asfvp30, содержащий рекомбинантную плазмиду со встройкой участка гена ср204l вируса африканской чумы свиней, кодирующего конформационный эпитоп белка p30, для изготовления диагностических препаратов -  патент 2463343 (10.10.2012)
рекомбинантная плазмидная днк pтв323, кодирующая гибридный полипептид gst-дельтамрт64 со свойствами видоспецифичного микобактериального антигена мрт64 (мрв64), рекомбинантный штамм бактерий escherichia coli - продуцент гибридного полипептида gst-дельтамрт64 и рекомбинантный полипептид gst-дельтамрт64 -  патент 2458130 (10.08.2012)

Класс C07K14/62 инсулины

инсулин-олигомерные конъюгаты, их препараты и применения -  патент 2527893 (10.09.2014)
новые производные инсулина с чрезвычайно замедленным профилем время/действие -  патент 2524423 (27.07.2014)
аналоги инсулина, устойчивые к протеазам -  патент 2524150 (27.07.2014)
производные инсулина -  патент 2518460 (10.06.2014)
аналоги инсулина с ацильной и алкиленгликолевой группировкой -  патент 2514430 (27.04.2014)
аналоги инсулиноподобного фактора роста-1 (igf-1), содержащие аминокислотную замену в положении 59 -  патент 2511577 (10.04.2014)
хроматографические способы и соединения, очищенные этими способами -  патент 2508294 (27.02.2014)
способ регулирования условий для сайт-специфического связывания полипептида и непептидильного полимера -  патент 2495881 (20.10.2013)
способ получения рекомбинантного инсулина гларгина -  патент 2495131 (10.10.2013)
препаративный хроматографический способ на основе нелинейного градиента и продукты, очищенные этим способом -  патент 2489441 (10.08.2013)

Класс C12N1/21 модифицированные введением чужеродного генетического материала

рекомбинантный штамм бактерий escherichia coli n41 (pbpun4/mr)-продуцент сайт-специфической эндонуклеазы рестрикции bpun4i -  патент 2529362 (27.09.2014)
рекомбинантная плазмидная днк ppa-oprf-eta, кодирующая синтез рекомбинантного белка oprf-eta pseudomonas aeruginosa, штамм escherichia coli pa-oprf-eta - продуцент рекомбинантного белка oprf-eta pseudomonas aeruginosa и способ получения рекомбинантного белка oprf-eta pseudomonas aeruginosa -  патент 2529359 (27.09.2014)
нуклеиноваяя кислота, обладающая активностью гена фосфатазы фосфатидной кислоты (варианты), белок, рекомбинантный вектор, трансформант и способ получения композиции жирной кислоты -  патент 2528875 (20.09.2014)
слитый белок тиоредоксина и домена 4 инфестина, способ его получения, экспрессионная плазмидная днк, кодирующая слитый белок, и бактерия рода escherichia coli, трансформированная такой плазмидной днк -  патент 2528251 (10.09.2014)
тест-система для скрининга ингибиторов протеинкиназы gsk3 ; человека -  патент 2528059 (10.09.2014)
рекомбинантный штамм бактерий escherichia coli - продуцент янтарной кислоты (варианты) и способ получения янтарной кислоты с использованием этого штамма -  патент 2528056 (10.09.2014)
проникающие в клетку пептиды и полипептиды для клеток микроорганизмов -  патент 2526511 (20.08.2014)
плазмида 40nagal, определяющая синтез -n-ацетилгалактозаминидазы -alnagal, штамм e.coli rosetta(de3)/40nagal - продуцент химерного белка, включающего аминокислотную последовательность рекомбинантной -n-ацетилгалактозаминидазы -alnagal, и способ ее получения -  патент 2525682 (20.08.2014)
антитело к epha2 -  патент 2525133 (10.08.2014)
штамм бактерий escherichia coli - продуцент рекомбинантного флагеллина -  патент 2524133 (27.07.2014)

Класс C12P21/02 с известной последовательностью из двух или более аминокислотных остатков, например глутатиона

лейколектины и их применение -  патент 2528860 (20.09.2014)
модифицированный фактор виллебранда с удлиненным полупериодом существования in vivo, его применения и способы получения -  патент 2528855 (20.09.2014)
l-фукоза 1 6 специфичный лектин -  патент 2524425 (27.07.2014)
мутант тяжелой цепи, приводящий к повышенной выработке иммуноглобулина -  патент 2522481 (20.07.2014)
применение штамма дрожжей komagataella pastoris в качестве реципиента для конструирования продуцентов целевого белка -  патент 2522479 (20.07.2014)
гибридный белок на основе рекомбинантного эритропоэтина человека, обладающий пролонгированным действием (варианты), и способ его получения -  патент 2515914 (20.05.2014)
мутеины липокалина слезной жидкости, обладающие аффинностью к с-мет рецепторной тирозинкиназе человека и способы их получения -  патент 2515063 (10.05.2014)
способ получения токсина actinobacillus pleuropneumoniae apxi, используя культуральную среду, содержащую комплекс кальций-бороглюконат -  патент 2514667 (27.04.2014)
способ модификации изоэлектрической точки антитела с помощью аминокислотных замен в cdr -  патент 2510400 (27.03.2014)
способ получения токсинов actinobacillus pleuropneumoniae apxi или apxiii в жидкой культуральной среде, дополненной воздухом, обогащенным углекислым газом -  патент 2507267 (20.02.2014)
Наверх